ID: 1195508936

View in Genome Browser
Species Human (GRCh38)
Location X:105691938-105691960
Sequence GAGCAGATCTAGAATTAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195508933_1195508936 29 Left 1195508933 X:105691886-105691908 CCCAGTAGCACAGACTTTAAAAA 0: 1
1: 0
2: 1
3: 26
4: 338
Right 1195508936 X:105691938-105691960 GAGCAGATCTAGAATTAAACAGG 0: 1
1: 0
2: 0
3: 6
4: 121
1195508934_1195508936 28 Left 1195508934 X:105691887-105691909 CCAGTAGCACAGACTTTAAAAAT 0: 1
1: 0
2: 0
3: 30
4: 304
Right 1195508936 X:105691938-105691960 GAGCAGATCTAGAATTAAACAGG 0: 1
1: 0
2: 0
3: 6
4: 121
1195508935_1195508936 4 Left 1195508935 X:105691911-105691933 CCAGTTATAACATAGCTGAAAGA 0: 1
1: 0
2: 1
3: 10
4: 170
Right 1195508936 X:105691938-105691960 GAGCAGATCTAGAATTAAACAGG 0: 1
1: 0
2: 0
3: 6
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195508936 Original CRISPR GAGCAGATCTAGAATTAAAC AGG Intronic
904329451 1:29748507-29748529 GAGCAGATTTAAAATAAAAATGG - Intergenic
906258306 1:44367408-44367430 GGGCAGATGTAGAAATAAAGGGG + Intergenic
907691995 1:56678194-56678216 GATCAGATCTACAATTAAAGAGG - Intronic
907735463 1:57107493-57107515 AAGGAGCTCTAGAATTAAAGAGG + Intronic
907820924 1:57967617-57967639 GTGCAGCTCTAGAATCTAACTGG + Intronic
909862267 1:80622639-80622661 GAGTTTATCTAGAATAAAACAGG - Intergenic
910104681 1:83618967-83618989 GTTCAGATTTAGAATTAAGCTGG + Intergenic
919021000 1:192105770-192105792 AAGCAGATCTTGAGTTTAACAGG + Intergenic
920640801 1:207750460-207750482 GAGCAGAACTTGTATTACACAGG - Intergenic
923380509 1:233413029-233413051 CAGCATAGCTAGAATTAAGCAGG + Intergenic
924844892 1:247757080-247757102 GTTCAGATTTAGAATTAAAGGGG - Intergenic
1065473219 10:26104759-26104781 GAGCAGATGTAGATTTAAGGAGG - Intronic
1066693587 10:38057948-38057970 GAGCAGAACCAGAATCAAGCTGG + Exonic
1074597037 10:114876957-114876979 GAGCACAACTAGAATTATTCCGG - Intronic
1076997666 11:306801-306823 TAGCACATCAGGAATTAAACAGG + Intergenic
1078400970 11:11026732-11026754 GATCAGTTCTGGAATTAGACAGG + Intergenic
1078767125 11:14309241-14309263 AAGCAAAACTAGAATTAAAGGGG + Intronic
1081087343 11:38817820-38817842 GGGCAAATATAGAATTAAATAGG + Intergenic
1081104551 11:39048859-39048881 GAGTAGATATAGATTTAAAAGGG + Intergenic
1085997215 11:81933526-81933548 AAGGAGAACTAGAATTGAACTGG + Intergenic
1088236410 11:107728912-107728934 TATGAGATCAAGAATTAAACGGG - Intergenic
1092603316 12:10090990-10091012 GATCAGATCAAGGACTAAACGGG - Intronic
1092871787 12:12812030-12812052 GAGAAGAATTAGAATAAAACTGG - Intronic
1093497099 12:19770643-19770665 AAGCAGATGTAGATTAAAACAGG - Intergenic
1100715281 12:97299256-97299278 CAGCGCATCTAGAATAAAACAGG - Intergenic
1106246902 13:27958064-27958086 CAGCAGATCTTGCATTAAATTGG - Intergenic
1106601669 13:31192786-31192808 CAGCAGATCTAAAACTAAACAGG + Intergenic
1107649593 13:42531141-42531163 GGGCAGATCTAGAAAAAATCTGG + Intergenic
1108354750 13:49620190-49620212 GAGCACAGCTATAATTAAAGCGG + Intergenic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1114793847 14:25689845-25689867 AAACAGATTTAGAAGTAAACTGG + Intergenic
1117027010 14:51631127-51631149 GAGAAGTTCCAGAATTAAACTGG + Intronic
1118469763 14:66065085-66065107 GAGGAGATCTAGGAATAAAGTGG - Intergenic
1119475339 14:74923475-74923497 GAGCAGGTCTAGAATCATCCAGG + Intergenic
1121888859 14:97570818-97570840 ATGCAGATGTTGAATTAAACGGG + Intergenic
1123540936 15:21290370-21290392 GATCAGATCTAAAATTATTCTGG + Intergenic
1126044743 15:44628438-44628460 GGGCAGATCTAGCATTAAGAGGG + Intronic
1128577613 15:68787029-68787051 GAGCAATCCAAGAATTAAACTGG - Intronic
1129019853 15:72506745-72506767 GATCTGAACGAGAATTAAACAGG - Intronic
1202949249 15_KI270727v1_random:17510-17532 GATCAGATCTAAAATTATTCTGG + Intergenic
1132832501 16:1935641-1935663 CAGCAGATCTGGAATTACAGTGG - Intergenic
1134430014 16:14194748-14194770 AAGCAGAGCCAGAATTAAAAAGG - Intronic
1134614245 16:15637840-15637862 GAGAAAATAGAGAATTAAACTGG + Intronic
1137974723 16:53021687-53021709 GAACTTATCTAGAATCAAACAGG + Intergenic
1138041544 16:53675808-53675830 AAGCAAATGTAGAATTTAACAGG + Intronic
1142140352 16:88470025-88470047 GAGCAGATCCAGAAATCAGCTGG - Intronic
1144612243 17:16730994-16731016 GTGCATATTTAGAATAAAACTGG - Intronic
1144900487 17:18584303-18584325 GTGCATATTTAGAATAAAACTGG + Intergenic
1145131959 17:20361382-20361404 GTGCATATTTAGAATAAAACTGG - Intergenic
1153212237 18:2779890-2779912 TGGCAGAGCTAGAACTAAACTGG + Intronic
1153729920 18:8000581-8000603 GAGCACATCTAAAATCAAGCTGG + Intronic
1155345750 18:24855114-24855136 GAGCAGATCTACCATTAATGGGG + Intergenic
1155658294 18:28217656-28217678 GAGCAAAGCTAGGAATAAACAGG - Intergenic
1156566946 18:38202476-38202498 GAGGAGAGCTAGATTTCAACAGG - Intergenic
1157129202 18:44987983-44988005 GAGAATATCAACAATTAAACAGG - Intronic
1157740318 18:50087213-50087235 GAGCAGATGGAGGAGTAAACAGG - Intronic
1157838630 18:50933069-50933091 GAGCAATTCTAGAATAAAAAAGG - Intronic
1157865284 18:51177932-51177954 TAGCAGGCCTAGAATTTAACTGG - Intronic
1159670530 18:71215489-71215511 GAACAGTTCAAGAATTACACAGG - Intergenic
1163208869 19:15825275-15825297 GAGCAGATCTACAACTAATAAGG + Intergenic
1166974931 19:46600527-46600549 GAGCGGATCAAGAATGAAGCGGG + Intronic
925187871 2:1861604-1861626 AGGCAGATCTAGGATTACACAGG - Intronic
925187906 2:1861847-1861869 AGGCAGATCTAGGATTACACAGG - Intronic
936041980 2:109156822-109156844 GAGTAGGTCTAGTTTTAAACTGG - Intronic
941567562 2:167127961-167127983 GAGTTGATCTAGAAGAAAACTGG - Intronic
941813478 2:169777549-169777571 GAGAAGGTCTGGAGTTAAACTGG - Intergenic
945471786 2:210235437-210235459 GAGCAGATCTAAAATCTAAAGGG + Intergenic
946185210 2:217976934-217976956 GAGCAGGTGAAGAATTACACCGG + Intronic
947115121 2:226761688-226761710 GAGCAGAACTAGAATTTTATAGG + Intronic
947414071 2:229875217-229875239 GAGCAGAGGTAAAATTAAAAGGG + Intronic
947584769 2:231347697-231347719 GAGGGGATATAGAATTAAAGTGG - Intronic
1169102606 20:2964285-2964307 GAGCAGAACAAGAATGAACCAGG - Exonic
1169499448 20:6145274-6145296 TAGAAGATCTATAATTGAACTGG - Intergenic
1169547623 20:6666792-6666814 AAGTAGAGCTAGAATCAAACAGG + Intergenic
1172711350 20:36926859-36926881 GAGCAGAAGGAGTATTAAACTGG + Intronic
1179543070 21:42096535-42096557 GAGCAGAGTTAAAATTAAAAGGG - Intronic
1182741292 22:32569814-32569836 GTGAAGATTTAGAAGTAAACTGG + Intronic
1183891541 22:40933915-40933937 CATAAGATCTAGAATTATACTGG + Intergenic
949658435 3:6248890-6248912 GAGTAGATTTAGAATTAAAGGGG + Intergenic
950643667 3:14364407-14364429 TAGCAGAACTAGAATTAGAACGG - Intergenic
957413218 3:79867173-79867195 GAGAAGATTCAGAATAAAACTGG - Intergenic
958626787 3:96636127-96636149 GAGCAGACCCAGATTTAAAAAGG + Intergenic
958868190 3:99525704-99525726 AAGCAGATGTAGGATTGAACAGG - Intergenic
962973875 3:140429405-140429427 GAGCAAATCTAGAAAAATACTGG + Intronic
965210990 3:165788631-165788653 GAGCAGAATTAGAAGAAAACTGG - Intronic
966371595 3:179256110-179256132 GAGCAAATACAGAAGTAAACAGG + Intronic
968209016 3:196831675-196831697 GATCAGATCTAAAATTATTCTGG - Exonic
970493578 4:16602322-16602344 GCGAAGATCTGGAATTAAAGAGG + Intronic
970780304 4:19729801-19729823 AAGCAGATCTAGGATGAAAGAGG + Intergenic
974611506 4:64224115-64224137 GAGCAAAACTACAAATAAACAGG - Intergenic
974782105 4:66565713-66565735 CAAGAGATCTAGAATTAAAAAGG + Intergenic
978662549 4:111145769-111145791 GAGCACATCTTGAAATAAGCAGG - Intergenic
980292863 4:130868008-130868030 CAGAAGATCAAGAGTTAAACAGG - Intergenic
988368618 5:30336903-30336925 GAGCAGAGGTAGAATTAGAGAGG + Intergenic
993035677 5:82754789-82754811 GAGCAAATTTAGAAATAAAATGG + Intergenic
993691991 5:91013242-91013264 AAGCAGATCTATCATTCAACTGG - Intronic
997776627 5:136614283-136614305 GGGCAGTTCTAGAAATGAACTGG - Intergenic
999257973 5:150220375-150220397 GACCAGGTCTAGAAGTAAACAGG + Intronic
1000518686 5:162273106-162273128 GAGCAGAAACAGAATTAACCTGG + Intergenic
1000914671 5:167066179-167066201 GATCAGATCAACAATTAAATAGG + Intergenic
1001209357 5:169795784-169795806 GAGCAGAGCTGGATTTACACTGG + Intronic
1004409837 6:15370705-15370727 CAGCAGAGTTAGCATTAAACTGG + Intronic
1004704893 6:18115626-18115648 AAGCTGGTCTAGAATTAAAGTGG - Intergenic
1006685709 6:35831599-35831621 GAGCAAATTCAGAATTAAAGGGG + Intronic
1007449743 6:41933676-41933698 GATCAGAGCTAGCATCAAACAGG + Intergenic
1007950846 6:45870893-45870915 GAGCTGATCTGGAAATAATCTGG - Intergenic
1010283630 6:74049517-74049539 TAGCAGGTATAGGATTAAACAGG + Intergenic
1011091981 6:83613222-83613244 AAGAAGATAGAGAATTAAACAGG - Intronic
1011985889 6:93445373-93445395 CAGCCTCTCTAGAATTAAACTGG + Intergenic
1015475290 6:133653665-133653687 GAGCAAAGCTAGGAATAAACAGG - Intergenic
1017167055 6:151418582-151418604 GAGCAGATCAAGATATAAACAGG + Intronic
1018299243 6:162383015-162383037 CAAGAGATCTAGAATTAAATTGG - Intronic
1026364986 7:69639293-69639315 TAGCAGATCTCGATTCAAACAGG + Intronic
1030165758 7:106553411-106553433 CAGCAGATGAAGAATTAAAGAGG - Intergenic
1030389228 7:108905118-108905140 GAACAAGTCTAAAATTAAACAGG - Intergenic
1030845551 7:114404668-114404690 AAGCAGATATAAAGTTAAACAGG - Intronic
1032715108 7:134501903-134501925 GAGCAGATATTTAATAAAACTGG + Intergenic
1038935550 8:32246339-32246361 AAGCAGAGCAAGAATTACACAGG - Intronic
1038983832 8:32787738-32787760 TACCAGATCTAGAAATAAAATGG + Intergenic
1042387572 8:68195176-68195198 GAGCAATTTTAGAATTAGACTGG + Intronic
1043173214 8:76991684-76991706 AAGCAGATTTAAAATCAAACAGG + Intronic
1055119134 9:72638077-72638099 GAGCAGATCTGGAATGAAGGGGG - Intronic
1059800533 9:117745565-117745587 GAATACATGTAGAATTAAACAGG + Intergenic
1189591206 X:42513276-42513298 GAAAATATCTAGAATTAAGCTGG + Intergenic
1194247668 X:91536033-91536055 ATGCAGATCTAGAAGTAGACAGG - Intergenic
1194583330 X:95703109-95703131 AAGCAGAACTAGAAATAAAAAGG - Intergenic
1195508936 X:105691938-105691960 GAGCAGATCTAGAATTAAACAGG + Intronic
1200566688 Y:4777563-4777585 ATGCAGATCTAGAAGTAGACAGG - Intergenic