ID: 1195512518

View in Genome Browser
Species Human (GRCh38)
Location X:105733893-105733915
Sequence CTTTCAACAAAAAAGTAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 591
Summary {0: 1, 1: 0, 2: 12, 3: 62, 4: 516}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195512518_1195512520 -4 Left 1195512518 X:105733893-105733915 CCTTGTTACTTTTTTGTTGAAAG 0: 1
1: 0
2: 12
3: 62
4: 516
Right 1195512520 X:105733912-105733934 AAAGCCAGATATGATGTATTGGG 0: 1
1: 5
2: 35
3: 101
4: 321
1195512518_1195512522 19 Left 1195512518 X:105733893-105733915 CCTTGTTACTTTTTTGTTGAAAG 0: 1
1: 0
2: 12
3: 62
4: 516
Right 1195512522 X:105733935-105733957 TAAAAGTAACTGAAGTAAATAGG 0: 1
1: 5
2: 36
3: 153
4: 667
1195512518_1195512519 -5 Left 1195512518 X:105733893-105733915 CCTTGTTACTTTTTTGTTGAAAG 0: 1
1: 0
2: 12
3: 62
4: 516
Right 1195512519 X:105733911-105733933 GAAAGCCAGATATGATGTATTGG 0: 1
1: 4
2: 31
3: 59
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195512518 Original CRISPR CTTTCAACAAAAAAGTAACA AGG (reversed) Intronic
900851564 1:5147072-5147094 TTATCAACAAAAATGTCACATGG + Intergenic
900905774 1:5556220-5556242 CTTTCCACAAAGGGGTAACAGGG + Intergenic
901385010 1:8902315-8902337 CATTCAACAAAAATGTATTAAGG - Intergenic
902134350 1:14292053-14292075 CTTTAAGCAAAAAAATTACAGGG - Intergenic
902228184 1:15010136-15010158 CCTTCAACAAATAATTAGCAAGG - Intronic
903723835 1:25426411-25426433 CTTTCTACAACAATATAACATGG + Intronic
904398371 1:30239052-30239074 CTTTCAACAAAAACATCACGAGG - Intergenic
905071502 1:35229886-35229908 CTTTCCACAACAAAGTAATGAGG - Intergenic
905076574 1:35276948-35276970 TTTTCAACAAATAAATAGCATGG - Intronic
905485790 1:38295366-38295388 ATTTTGACAAAAGAGTAACAAGG + Intergenic
907015639 1:51010070-51010092 CTTTCAACAAAAAGCTCAGAAGG + Intergenic
907234429 1:53032353-53032375 ATTTCCAGAAAAAAGCAACATGG + Intronic
908466766 1:64403699-64403721 TTTTAAATAAATAAGTAACAAGG + Intergenic
911569283 1:99503445-99503467 GTTCCAACAAAGAAGTCACATGG - Intergenic
911612483 1:99971757-99971779 CTTCCTACAAAGAAGAAACAAGG + Intronic
912397905 1:109361620-109361642 ATTATAACATAAAAGTAACAAGG + Intronic
912852658 1:113140588-113140610 CTTTGAACAAAAAGATAAAAAGG - Intergenic
912883564 1:113444678-113444700 TTTTCAACATAAAAATGACAAGG + Intronic
912890838 1:113528293-113528315 CTTTCAAAAAAAAAAAAAAAAGG - Intronic
915850110 1:159312683-159312705 CATTCAACACAAGAGTAAAAAGG - Intergenic
916181763 1:162090946-162090968 TTAACAACAGAAAAGTAACAAGG - Intronic
917336147 1:173926218-173926240 CTGTGAACAAAAAAGTAGCCAGG + Intergenic
917389363 1:174517363-174517385 CTTTTAACAAAAAATTTTCAGGG - Intronic
917814100 1:178690140-178690162 CTTTAAAAAAGAAAATAACAAGG - Intergenic
918308716 1:183270182-183270204 CTTTAACCAAAAAAGTTTCAAGG - Intronic
918429898 1:184448687-184448709 CTTTCAAAGAAATAGTAGCAGGG + Intronic
918617014 1:186556473-186556495 CTTCCAACAAACAAGAAACAAGG - Intergenic
918691180 1:187481228-187481250 CTTTGAACAAGAAAGCAATATGG - Intergenic
918698952 1:187582675-187582697 CATTCAACAAAAATGTAATGGGG + Intergenic
918771906 1:188571805-188571827 CATTCAACAAAAAATTCACAAGG + Intergenic
919047946 1:192476861-192476883 CTATGTACAAAAAAGGAACATGG - Intergenic
919236904 1:194857958-194857980 CTTTCAATATATAAATAACATGG - Intergenic
919367354 1:196679699-196679721 ATTTCAATATAAATGTAACATGG + Exonic
919729932 1:200907208-200907230 CTGTCAAAAAAAAAGAAAAAGGG - Intronic
919851420 1:201675543-201675565 CTTACAACAAAAAATGAACCAGG + Intronic
920450587 1:206058486-206058508 CTTTTAAGAAAAAAACAACAAGG + Intronic
920870842 1:209793307-209793329 CTAAAAACAAAAAAGTAAAATGG - Intronic
922516482 1:226211918-226211940 GTCTCAAAAAAAAAGTAACTAGG + Intergenic
923345484 1:233047526-233047548 CTTTCATCAAAAAAGGAGCAGGG + Intronic
923600058 1:235394871-235394893 GTCTCAACAAAAAATTAGCAAGG - Intronic
923730406 1:236544377-236544399 CTTTCAAGAAGGAAGGAACACGG + Intronic
924203792 1:241689247-241689269 CTATCAAGAAAAAAATTACAAGG + Intronic
924365960 1:243294188-243294210 TTTTCAACAACACAATAACAAGG - Intronic
1063062975 10:2577460-2577482 CTTTCAGCAAAATGGTGACAGGG + Intergenic
1064035689 10:11911730-11911752 CCTTCATCCAAAAAGTATCATGG - Intergenic
1064036222 10:11915540-11915562 CTTTCATCCAAAAAGTATCATGG - Intergenic
1064585067 10:16832030-16832052 GTTGAAACAAAAAAGCAACAAGG - Intronic
1065416873 10:25497814-25497836 TGTTCAACAAAAAAGTAGAAGGG - Intronic
1066315067 10:34237473-34237495 ATTTCTACAAAAAACTATCATGG - Intronic
1066997970 10:42581000-42581022 CTGTCAACAACTAAGTAAAAGGG + Intronic
1067188597 10:44051108-44051130 CCTGCAACAACAAAGAAACAGGG + Intergenic
1067239704 10:44479999-44480021 CTTTCAACAAAAAAATTATGAGG + Intergenic
1067322874 10:45238998-45239020 GTTGAAACAAAAAAGCAACAAGG - Intergenic
1067422717 10:46170563-46170585 TTTTTAACAAAAAAATCACAAGG - Intergenic
1068105845 10:52614967-52614989 CTTTAAAAAAACAAGTAAAAAGG + Intergenic
1069239439 10:66121678-66121700 CTCTCTACAAAAAATTAGCAAGG + Intronic
1069245152 10:66195197-66195219 TTTTAAACAAAAAAGATACAGGG - Intronic
1070060479 10:72978101-72978123 CCTACATCAAAAAAGTAAAAAGG - Intergenic
1070508583 10:77139140-77139162 CTTTCAAAGGAAAAGTAAGAAGG + Intronic
1070614355 10:77958048-77958070 CTTTCAAAAAAAAAAAAAAAAGG - Intergenic
1071809799 10:89167052-89167074 TTATCAAAAAAAAATTAACAAGG - Intergenic
1072075343 10:91966518-91966540 TATTCATCAAAAAAGTCACATGG + Intronic
1072510942 10:96124306-96124328 CTTTCAACAAAGAAATCACAAGG - Intergenic
1074133237 10:110602939-110602961 ATTTCATCAAACAAGTAAAATGG - Exonic
1074177453 10:111023312-111023334 CTTTCAACAAAAAAATTACAAGG + Intergenic
1075680499 10:124327624-124327646 ATTTCCACAAAAAATTAACCAGG + Intergenic
1078926757 11:15882043-15882065 CTTTCAACTGAGAGGTAACATGG + Intergenic
1079043477 11:17079519-17079541 GTCTCAAAAAAAAAGTATCAGGG + Intronic
1079073088 11:17365122-17365144 CTTTCAACTAAAAAATTACAAGG - Intronic
1079368863 11:19832967-19832989 TTTCCAAAAAAAAAGTAACGTGG + Intronic
1080042894 11:27777640-27777662 CTTGCAACAAAAAGGCAACTTGG - Intergenic
1080310048 11:30879539-30879561 CTTTCACCATGAAGGTAACATGG + Intronic
1080470129 11:32537646-32537668 CTTTTAACCAACAAGGAACAGGG + Intergenic
1081374353 11:42341058-42341080 CTATAAACAAAAAATTGACAAGG + Intergenic
1082064500 11:47888624-47888646 TTTTCAATAAGAAAGTATCAGGG + Intergenic
1082117316 11:48341414-48341436 CTCTCAAAATAAAAGAAACAAGG + Intergenic
1082134738 11:48534074-48534096 CTTACAAGAAAAATGAAACAGGG - Intergenic
1083390026 11:62341984-62342006 CTTTCAACAAAAAATAAAAACGG - Intronic
1085225485 11:74916717-74916739 CTTTCAACAAAAAAATCACAAGG - Intronic
1085809541 11:79667782-79667804 CTCTCACCTAAATAGTAACAGGG - Intergenic
1086047780 11:82553217-82553239 GTTTCAACAAAGAGCTAACAAGG + Intergenic
1087523484 11:99275847-99275869 ATTTGACCAAAAAAGTTACAAGG + Intronic
1088129450 11:106470021-106470043 CTTTCAACAAACATGAAAAATGG + Intergenic
1088186348 11:107175956-107175978 CTTTTAACAGAAAACTCACAAGG + Intergenic
1088291307 11:108241058-108241080 TTTTCAACAAAAAAGTTTAAAGG - Intronic
1089449386 11:118582135-118582157 CTTTAAAAAAAAAAGAATCAGGG - Intronic
1089485492 11:118842791-118842813 TTTTTAATAATAAAGTAACAGGG - Intergenic
1089939463 11:122400073-122400095 CTTCCATTAAAAAAGTAAGAAGG + Intergenic
1090065589 11:123500676-123500698 CTGTCAAAAAAAAAATAAAAAGG - Intergenic
1090887819 11:130894725-130894747 CTTTCAAATAAAAAGCAACCTGG - Intronic
1091773797 12:3171135-3171157 CTTTAAACAGAAAAGTCAGAAGG - Intronic
1091859074 12:3762540-3762562 TTTTCAACAAAAAAATGATAAGG + Intronic
1092125269 12:6071022-6071044 CTTTCAGCAAACAGGTAATAAGG + Intronic
1092311401 12:7358687-7358709 CTTTCTACAAAATAATTACAAGG + Intronic
1092761434 12:11814749-11814771 CTTTCACCAAGAAATTAAAAGGG + Intronic
1093073083 12:14727286-14727308 CTTTCAAAGAAAAAGTTTCAAGG - Intergenic
1093394215 12:18660744-18660766 CTTTCAACAAAAAAACCACAAGG + Intergenic
1093506493 12:19872562-19872584 ATTTCAACTAAAAATTAAAATGG - Intergenic
1093523920 12:20084671-20084693 ATCTCAATAAAAAAGTCACAGGG - Intergenic
1093896385 12:24579149-24579171 CTCTCAATAAAAAAATTACAAGG + Intergenic
1094237654 12:28187066-28187088 CTTTCAAAAAAAAAAAAAAAAGG - Intronic
1094767326 12:33612085-33612107 CTCTCTATAAAAATGTAACAGGG - Intergenic
1095301222 12:40586243-40586265 CTTTCAATAAAAAGATAAAAAGG + Intergenic
1095411283 12:41927220-41927242 CTTACTACAAAAAACTGACAAGG + Intergenic
1095804619 12:46304761-46304783 TTTTCAACAAAAAAATCACCAGG + Intergenic
1096349077 12:50879492-50879514 CATGCAACAAAAACGTAATAAGG - Intronic
1096644609 12:53024504-53024526 TTTTAAACAAAAAACAAACATGG + Intronic
1097209723 12:57357888-57357910 CTGTCAACAAAGAATTAATAAGG - Intronic
1097605634 12:61750103-61750125 TATACAACACAAAAGTAACAGGG - Intronic
1097644116 12:62215559-62215581 CTTTCAAAAAAAAAAAAAAAAGG + Intronic
1097705502 12:62864539-62864561 CCTGCAACATAAAAGTAACTTGG - Intronic
1097808881 12:63996393-63996415 CTAACAACAGAAAACTAACATGG - Intronic
1098059264 12:66542461-66542483 CTTTCAAAAACAAAGTATGATGG + Intronic
1098104115 12:67051558-67051580 CTTTCAACACAAAATATACAGGG - Intergenic
1098135317 12:67395932-67395954 CCTTGGAGAAAAAAGTAACATGG + Intergenic
1098352788 12:69581641-69581663 CTTTAAAAAAAAAAAAAACAGGG - Intergenic
1098991677 12:77070610-77070632 TTTTCACCACAAAGGTAACAGGG + Intergenic
1099162902 12:79267115-79267137 CTTCCAAAAAACAAGTAATAAGG + Intronic
1100762783 12:97827961-97827983 CTTTCCATAAAAATGCAACATGG + Intergenic
1100891150 12:99127331-99127353 CTTTAAAAAAAAAAGTAATCGGG - Intronic
1101199893 12:102424237-102424259 CTTTCAAAAAAAAAAAAAAAGGG - Intronic
1101604326 12:106236562-106236584 CTTTAAAATAAAAAGTAAAATGG + Intergenic
1101639058 12:106572582-106572604 CTTTCAACAAAAAAATTATAAGG + Intronic
1102082154 12:110107149-110107171 CTTACAAAAAACAAGAAACAAGG + Intergenic
1102892324 12:116569648-116569670 ATTTCAACAAAGAAGTAGAATGG + Intergenic
1103315925 12:120055248-120055270 CTTTCAACAAATAAGTAAACTGG + Intronic
1104667356 12:130656902-130656924 CTGTCAAAAAAAAATTAAAACGG + Intronic
1105480357 13:20769734-20769756 TTTTCAACATAAAAATTACAAGG + Intronic
1105995607 13:25669106-25669128 TTTTCAAAAAAAAAATTACAAGG - Intronic
1106119426 13:26847060-26847082 TTTTCAACAAAAAAATCACAAGG - Intergenic
1107651183 13:42546865-42546887 ATTTCACCAACAATGTAACATGG - Intergenic
1107848674 13:44547783-44547805 CTTTTAAAAAAAGAGAAACAAGG + Intronic
1108324452 13:49316338-49316360 CTTCCAACAAAAAAGAGACCAGG + Intronic
1109356464 13:61235586-61235608 CTTACATCAAAAAGGTAAAAAGG + Intergenic
1109772780 13:66998558-66998580 CTTTCACCAACTAAGTAAAAAGG - Intronic
1109798595 13:67346285-67346307 ATTTCAACAAAAAGATAAGAGGG - Intergenic
1110035658 13:70679625-70679647 CTTTAAACAAAGAAATAATATGG - Intergenic
1110135202 13:72059264-72059286 TATTCAACAAAAAAATCACAAGG - Intergenic
1110360994 13:74625373-74625395 CTTTAAAAAAAAAGCTAACATGG - Intergenic
1110848406 13:80216583-80216605 ATTTCATCCAAAAAGTAACAAGG + Intergenic
1110918847 13:81058916-81058938 TTTTCAACAAATAAGTTACAAGG + Intergenic
1111167136 13:84474363-84474385 TTTTCAACCAAAATTTAACAAGG + Intergenic
1111335034 13:86809984-86810006 GTTTCAACAAAAAAATTGCAAGG - Intergenic
1111685753 13:91498968-91498990 CTCTCAAAAAAAAAGAAAAAAGG + Intronic
1111857446 13:93656054-93656076 GTTTTAACAAAAAATTGACAAGG - Intronic
1112184274 13:97113125-97113147 CTTTGAAAAAAAAAGTAACCAGG - Intergenic
1112403369 13:99095848-99095870 CTTTCCACAAAGACCTAACATGG + Intergenic
1114348238 14:21820734-21820756 CTATCAAGAAAAAAATTACAGGG - Intergenic
1115214265 14:30998953-30998975 TTTTCAACAAAAAAATAACTAGG + Intronic
1115447106 14:33503575-33503597 CTTTCAAAAAAAAAATGGCACGG + Intronic
1116230388 14:42207814-42207836 CTGTCAACAACAAAGCAATAAGG + Intergenic
1116909227 14:50440853-50440875 CTTTCCACTAAAAAGAACCAGGG + Intronic
1117292594 14:54347972-54347994 CTTTCAACAAAACTGTAACCAGG + Intergenic
1117889361 14:60401494-60401516 CTTTTAAAAAATAAGTAAAATGG + Intronic
1118247989 14:64130327-64130349 ATTTCAACAAAGAAGAAAAATGG - Intronic
1118429032 14:65697097-65697119 CTTTCAATAAAAACATTACAAGG - Intronic
1118642142 14:67802776-67802798 CTTTCCAGAAAAAAAAAACATGG + Intronic
1120380008 14:83765328-83765350 CTTCCAACAAAAAAGCAGCCTGG + Intergenic
1120437212 14:84496084-84496106 CTTTCAAGAAAAAAAGAGCATGG - Intergenic
1120534371 14:85675645-85675667 CTTTCATCCCAAAAGTAGCAAGG + Intergenic
1121435535 14:93916815-93916837 CTTTCCACACCCAAGTAACAAGG - Intergenic
1121805412 14:96815973-96815995 CTTTCAACTAAAAGGAAATAGGG + Intronic
1123834497 15:24174886-24174908 CATTCACCAAAAAAGGAACTAGG - Intergenic
1123854191 15:24390448-24390470 CATTCACCAAAAAAGGAACCAGG - Intergenic
1123959892 15:25386315-25386337 CTATCAAGAAAAAAATTACAGGG + Intronic
1124079763 15:26481034-26481056 ATTTGAAGAAAAAAGTAATAAGG + Intergenic
1124581295 15:30957701-30957723 GTCTCAAAAAAAAAGAAACAAGG + Intronic
1124599129 15:31116913-31116935 CTTTCAATAAAATAATTACAAGG + Intronic
1124809258 15:32918104-32918126 CTTTAAAAAAAAAAGAAACCTGG + Intronic
1124826820 15:33105297-33105319 CTGTCAAGAAAAAAATAAAACGG + Intronic
1125095486 15:35845558-35845580 CCTCCTACAAAAAAGAAACATGG + Intergenic
1125185589 15:36926154-36926176 CTTTCAAGAAAAAAAAAAAAAGG - Intronic
1126764063 15:51995923-51995945 GTTTCAAAAAAAAAGAAAGAAGG + Intronic
1127021019 15:54748848-54748870 CTTTAAACAAAAAAGTAGGTGGG - Intergenic
1127249449 15:57215910-57215932 CAATCAACAGAAAAGTAAGATGG + Intronic
1127394365 15:58532093-58532115 CTTTCAAGAAAAAAGTAAATGGG + Intronic
1127571309 15:60244476-60244498 CTTTCAACAAAAAAATTATAAGG + Intergenic
1128164154 15:65447460-65447482 CTTCCAATAAAAAAGAAAAATGG + Intronic
1129091723 15:73157871-73157893 CTTCCAACAAAATATCAACAAGG - Intronic
1129287092 15:74534251-74534273 GTTTTAAAAAAAGAGTAACAAGG + Intergenic
1130630913 15:85568285-85568307 CTATCAAAAAAAAAGAAAAAAGG + Intronic
1131304443 15:91229170-91229192 CTTCCAACAGAAAGGGAACATGG + Intronic
1133124393 16:3636482-3636504 TTTTCAACAAAAAAATTACAAGG - Intronic
1133427440 16:5704918-5704940 CCTTCAACCAAAAAGTCATATGG + Intergenic
1134161158 16:11890574-11890596 TTTTAAAAATAAAAGTAACAAGG + Intronic
1136503097 16:30684096-30684118 ATTTCAACAAGAACGAAACATGG + Intergenic
1137410733 16:48225867-48225889 CTTTAAACAAAAAACAAAAACGG + Intronic
1137818033 16:51418064-51418086 TTTTCAATAAAAAACAAACATGG + Intergenic
1137992766 16:53176563-53176585 GCTTTAACAAAAAATTAACAAGG + Intronic
1138343482 16:56306128-56306150 CTTTCAACAAAGAGGGAGCAGGG - Intronic
1138379839 16:56592102-56592124 CTGTCAGCAAAAAACTAACTTGG - Intergenic
1138386271 16:56637845-56637867 CTTTAAACTAAAAAGCAAGATGG - Intergenic
1138634793 16:58329542-58329564 CTTTAAAAATAAAAGTAACCAGG + Intronic
1139097355 16:63720580-63720602 CTTCCAAGAAAAAAGATACAGGG + Intergenic
1139127467 16:64096581-64096603 CTTTCAACACAAATCTAATAAGG + Intergenic
1139153631 16:64414820-64414842 ATTTAAAAAAATAAGTAACAAGG + Intergenic
1139419404 16:66841040-66841062 CTTTAAAAAAAAAAGAAAAAAGG + Intronic
1139818118 16:69693803-69693825 TTTTCACCAACAAAGTAACATGG + Exonic
1140617632 16:76685696-76685718 CTATCAAGAAAAAAATTACAAGG + Intergenic
1141313249 16:82935533-82935555 GTTTAAAGAAAAAAGTAAAAAGG + Intronic
1141357948 16:83366128-83366150 CTTTTCACAACAAAATAACAGGG + Intronic
1141397841 16:83720580-83720602 CTTTAAAAAAAAAAGACACAAGG + Intronic
1142546536 17:707840-707862 CTTTCAAAAAAAAAAAAAAAAGG + Intronic
1143057050 17:4170308-4170330 CTTTCCACAAAAGGGTCACAGGG + Intronic
1143705045 17:8691555-8691577 GTTTCTACAAAAAATTAGCAGGG - Intergenic
1144209415 17:13002122-13002144 CTTTGAGCACAAAAGAAACACGG - Intronic
1144231475 17:13208728-13208750 CTTTCATTAAAAAAATTACAAGG + Intergenic
1144940850 17:18939219-18939241 CTATCAAGAAAAAAATTACAGGG + Intergenic
1146622944 17:34414124-34414146 CTTTCAGGAAACCAGTAACAGGG - Intergenic
1147006898 17:37410474-37410496 CTTTCAACAAGTACGTAACAGGG - Intronic
1147419489 17:40315210-40315232 ATTTTAACAAAAAAGACACAGGG + Intronic
1150779387 17:68108051-68108073 CTTACAACAGAATAGTAAAAAGG - Intergenic
1150886808 17:69096422-69096444 CTTTTAAAAAACAAGTAACCTGG + Intronic
1151299679 17:73214805-73214827 CTTTTACCAAAAGAGAAACAAGG + Intronic
1151722818 17:75867717-75867739 CATTCAACAATAATGTATCAGGG - Intergenic
1153873057 18:9338514-9338536 TTATCAACAAAACAGTATCAAGG - Intronic
1154285456 18:13051921-13051943 CTTTGTACAAAAAAGAAAGATGG + Intronic
1154945073 18:21154671-21154693 CCTACATCAAAAAAGTAAAAAGG - Intergenic
1155635748 18:27953233-27953255 ATTTTAAGAAAAAAGAAACAAGG + Intronic
1157073036 18:44432005-44432027 CCTTACACAAAAAAGTAAGATGG - Intergenic
1157234138 18:45947407-45947429 CTCTCAAAAAAAAAGAAAAAAGG + Intronic
1157430287 18:47619246-47619268 ATTTCAACACATAGGTAACACGG - Intergenic
1159748216 18:72266619-72266641 TTTTCAACAAAAATGTGAAATGG - Intergenic
1161089815 19:2354114-2354136 CTCTCAGCAGAAAAGCAACACGG - Intronic
1161275026 19:3411175-3411197 CTTTAAAAAAAAAAGTTACCTGG - Intronic
1161498477 19:4600068-4600090 CTATCACCAAAAAAGAAAAAAGG - Intergenic
1161543312 19:4865484-4865506 GTTTCAAAAAAAAAAAAACATGG + Intronic
1162463444 19:10826882-10826904 CTTTCAAAAAAAAAGTGTCTTGG + Intronic
1163535812 19:17875803-17875825 CTTACAACAACACAGTAAGAAGG + Intronic
1163958975 19:20669457-20669479 CTTTCCAGAAAAAAGTAACTGGG - Intronic
1164235341 19:23327280-23327302 TTTTTAACAATAAAGTATCAGGG - Intronic
1164301429 19:23965294-23965316 TTTTTAACAATAAAGTACCAGGG + Intergenic
1165573560 19:36795614-36795636 CTTTAAATAAATAAGTAAAAAGG - Intergenic
1166598928 19:44076537-44076559 AATTCAACACAAAAGAAACAAGG - Intronic
1167391956 19:49201102-49201124 CTTTCTACAAAAAATAAAAATGG - Intronic
1167484610 19:49754528-49754550 TTTTCAACAAAAAAGTTATAAGG + Intronic
925009770 2:474453-474475 CTATCAACAGAACAGTACCAAGG + Intergenic
925297176 2:2785216-2785238 CTTTAAGCAGAAAAGCAACATGG + Intergenic
925763683 2:7210727-7210749 CTTGCAAAAAAAACGTGACAAGG + Intergenic
926483183 2:13425365-13425387 CATGAGACAAAAAAGTAACAAGG - Intergenic
926495979 2:13589037-13589059 CTTTCTACAAAAATGTCCCAAGG - Intergenic
927315684 2:21678214-21678236 GTTTCAACAAAACTGTCACAAGG + Intergenic
929040882 2:37743435-37743457 CTGTCACCACAAAAGTAAGAAGG - Intergenic
929164717 2:38869770-38869792 TTAACAACAAAAAAGTCACAAGG + Intronic
930234257 2:48873828-48873850 GTTTGAACAAAGAAGTGACATGG + Intergenic
930345261 2:50172349-50172371 CTAACAACAAAAAAGACACAGGG + Intronic
930413412 2:51056480-51056502 CTTCCAACTAAAAGGAAACAGGG - Intergenic
930637955 2:53826479-53826501 GTTTAAAAAAAAAAGTAATAGGG - Intergenic
932747911 2:74349806-74349828 CTTTCAACAAATAAATTATAAGG + Intronic
933549461 2:83757041-83757063 CTTTCAATAGCAAAGCAACAGGG - Intergenic
933823233 2:86134269-86134291 CTTGAAACAAGAAAGGAACAAGG - Intronic
933894762 2:86800730-86800752 CTTTCAACAAAATTGGAAGAAGG + Intronic
934858940 2:97748153-97748175 CTTTCAACAGGTAAGAAACATGG - Intergenic
934866286 2:97815877-97815899 CTATCACCAATAAAGTAGCATGG + Intronic
935423616 2:102896222-102896244 TTTTTAACAAAAAAGTGAAAAGG + Intergenic
935507857 2:103929470-103929492 TTTTCAACTAAAAAGTAATGTGG - Intergenic
935827482 2:106965812-106965834 ATTTCAACTGGAAAGTAACAAGG - Intergenic
935890600 2:107673836-107673858 CTTTCAACACAAAAATCACGAGG - Intergenic
935941982 2:108248584-108248606 CATTCAACAATAAACTAAAAGGG - Intronic
935949564 2:108316477-108316499 TTTTCAACAAAAGAATACCATGG + Intergenic
936774477 2:115956245-115956267 CTTGCACCAAAAAAGCATCATGG - Intergenic
937199650 2:120191788-120191810 TTTTCAAGAAAAAAATCACAAGG + Intergenic
939031502 2:137080869-137080891 CATTCAACCAAAAAATAACTTGG - Intronic
939526535 2:143302349-143302371 GTTTAAACAAAAAATTAACTTGG - Intronic
940185849 2:150984386-150984408 CTTTAAACAAAAATGTAGCCAGG - Intergenic
940377573 2:152972789-152972811 CTTTCAATAACAAAGTATCATGG + Intergenic
941460199 2:165761595-165761617 TTTTTAACAGAAAAGAAACATGG + Intronic
941594638 2:167460667-167460689 TTTTCAACAAAAAAATCACAAGG - Intergenic
941731028 2:168918097-168918119 CTTTCAACAGAAATATAATATGG - Intergenic
941997510 2:171614434-171614456 ATTTAAAAAAAAAAGAAACATGG + Intergenic
942519667 2:176790569-176790591 CTTTCAACAATAAACCAACTGGG + Intergenic
943063796 2:183066060-183066082 TTTCCAAGAAAAAAGTTACAGGG + Intergenic
943280049 2:185920784-185920806 ACTTCAACAAAAAATTTACAAGG - Intergenic
943707502 2:191050991-191051013 CTTACAACCAAAAAGTAGAATGG + Intronic
944545028 2:200790658-200790680 CTTCAAACAAAAACGTAGCAGGG + Intergenic
945884298 2:215358807-215358829 ATTTCAACATAAAAGTAAAGGGG + Intergenic
945960516 2:216129605-216129627 TTTCCAACAAAAAATTAACAGGG - Intronic
946016926 2:216611418-216611440 TTTTCAGCAAAAGAGTAAGATGG - Intergenic
946667978 2:222071064-222071086 TCTTCAACAAATAAATAACATGG - Intergenic
947036416 2:225863125-225863147 TCTTCAACAAAAAAGAACCAAGG + Intergenic
947066567 2:226233083-226233105 CTTTCAACAAGAAAGGAGCTAGG - Intergenic
948972930 2:241443247-241443269 CTTTAAAAAAAAAAATGACATGG - Intronic
1169281779 20:4273903-4273925 CATTCTTCAAAAAAGTCACAAGG + Intergenic
1169821725 20:9718723-9718745 CTTTCCAAAAAAAATTAATATGG + Intronic
1170001558 20:11620453-11620475 CTTTCAGCATAAAAATTACAGGG + Intergenic
1170729845 20:18963931-18963953 ATTTCAAAAAAAAACTAATAGGG - Intergenic
1170799768 20:19581522-19581544 CTTTTAACAAAAAAGTTATAAGG + Intronic
1172350773 20:34238717-34238739 TTTTCAACCAAAAAATCACAAGG - Intronic
1172698927 20:36840841-36840863 GTCTCAAAAAAAAAGAAACATGG + Intronic
1173401226 20:42727772-42727794 TTTTAAACACAAAAGTAACAAGG - Intronic
1173900584 20:46584992-46585014 CTTTCAAAATAAAATTTACAGGG - Intronic
1175324909 20:58116958-58116980 GTTTCAACAAAAAATTTAAAAGG + Intergenic
1175969800 20:62679211-62679233 CAAACAACAAAAAAGTAGCATGG + Intronic
1177246800 21:18536122-18536144 CTTTAAACAAAAAAATAACATGG - Intergenic
1177802440 21:25841124-25841146 CCTGCAACAAAAAAGTAGAAAGG - Intergenic
1178615166 21:34126660-34126682 CTTTCAACAAAAAAGGCAAAAGG - Intronic
1179325131 21:40334842-40334864 CTTTAAACAGAAAAGTCACATGG - Intronic
1181424987 22:22829733-22829755 CCCTCAACAAAAAAGAAATATGG + Intronic
1181971230 22:26691916-26691938 CTGTCAACAAAAAAAAAAGATGG - Intergenic
1182729090 22:32473205-32473227 CTTTCTACAAAAAATAAAAATGG + Intergenic
1182914317 22:34014985-34015007 CCTTCAACAAAAAAATGACAAGG - Intergenic
1182970396 22:34568494-34568516 CTTTCAGAAAACAAGTGACATGG + Intergenic
1182988306 22:34742114-34742136 CTTTCAAAAATAAATTTACATGG + Intergenic
1183561739 22:38580274-38580296 TTTTCAACAAATAAGTTTCAAGG - Intronic
1184077659 22:42193146-42193168 ATTTCAACAGAAAAGGAAAAAGG + Intronic
1184078243 22:42197788-42197810 CATTAAACACAAAATTAACAGGG + Intronic
1184966980 22:47984269-47984291 CTTTCAACAAATAATACACAAGG - Intergenic
1184980598 22:48093254-48093276 TTTTCCACAAAAAAGCATCAAGG + Intergenic
949469909 3:4383421-4383443 TTTTCAACAAATAAATAGCAAGG + Intronic
949791047 3:7792437-7792459 CTTTCAGGAAAAAAATTACAAGG + Intergenic
949984005 3:9524802-9524824 CTATCAAGAAAAAAATTACAAGG - Intronic
950277753 3:11677905-11677927 CTTTCAAAAAAAAAAAAAAAAGG + Intronic
951003964 3:17595750-17595772 CTTTCCACTAAAAAGTAGGACGG + Intronic
952460695 3:33522494-33522516 TTTTCAACAAAAAAATCACAAGG + Intronic
952561366 3:34597430-34597452 TTTTCAACAATAAAGTAATTTGG - Intergenic
953247640 3:41210138-41210160 TTTTCAACAAAAAAGCTAAAAGG - Intronic
954725389 3:52604530-52604552 GTCTCAACAAAAAAGTAGCCTGG + Intronic
955441600 3:58961624-58961646 ATTTCAACAGCAAAGTAACCTGG + Intronic
956002134 3:64740875-64740897 CTTTAAAAAAAAATGAAACAAGG + Intergenic
956186029 3:66562713-66562735 GTTTGAACAACAAAGCAACATGG - Intergenic
956654228 3:71533745-71533767 CATTCAACAAAAGAATAAGATGG - Intronic
957506942 3:81134310-81134332 ACTTCAGCCAAAAAGTAACATGG + Intergenic
957735291 3:84194749-84194771 CTATCAAGAAAAAAATTACAAGG + Intergenic
958094796 3:88929861-88929883 CTTTAAAAAAAAAAATAAAATGG + Intergenic
958666746 3:97149520-97149542 CTTTCTACAAAAAAATAATAAGG - Intronic
958666821 3:97150756-97150778 CTTTCTACAAATAAGGAAAAGGG - Intronic
959090704 3:101899831-101899853 CATTCAAGACAAAAGTTACAGGG + Intergenic
959129936 3:102342002-102342024 CCATCAACAAAGAAGTAGCAAGG - Intronic
959221730 3:103529931-103529953 CTTTAAAAAAAAGAGTGACATGG + Intergenic
959223418 3:103551264-103551286 CTGTCAAAAAAAAAGTCACATGG + Intergenic
960411549 3:117333017-117333039 CTTTCAACAAACAAATTACAAGG - Intergenic
960412081 3:117339729-117339751 CTTTTAACAAAATGGTAAAATGG - Intergenic
961366074 3:126400410-126400432 CTTTCACCAACAATGTAAAAGGG - Intronic
961864392 3:129942995-129943017 CTTTTAAAAAAAAATTAACTGGG + Intergenic
962656621 3:137551791-137551813 TTTTTAACAAAAAAGTTAAAAGG - Intergenic
962696827 3:137957582-137957604 TTTTCAACAAATAATTAGCAAGG - Intergenic
963736506 3:149023111-149023133 GTTTCCAGAAAAAAGAAACATGG - Intronic
963805931 3:149723083-149723105 TTTCCAACAAAAAATTCACAAGG - Intronic
964167464 3:153725741-153725763 TTTACAACAAAGAAGTAGCAGGG - Intergenic
964800351 3:160550269-160550291 CTTTCAAAACAAAACAAACAAGG - Intronic
965637347 3:170796757-170796779 CTTTCAACACAAAAGTACACTGG - Intronic
965690524 3:171351864-171351886 CATTCAACACAAAAGTTAAATGG + Intronic
965809517 3:172577608-172577630 TTTTGAACAAAAAAATCACAAGG - Intergenic
966128967 3:176614673-176614695 CTTGAAACAAAAGAGTAATATGG + Intergenic
966283356 3:178262383-178262405 CTTTCAACAAACATGTAACCAGG - Intergenic
966636064 3:182135036-182135058 CTGTCCATAAAAAAGTAGCATGG - Intergenic
966930900 3:184674849-184674871 CTTTCAACCAAAAAAAAAAAAGG + Intronic
967053496 3:185806511-185806533 CTTTCAAAGAAAAGGTTACATGG + Intronic
968344294 3:197987747-197987769 CTTTTAAAAAAAATGTAACATGG - Intronic
968379927 4:83951-83973 CTATCAACACAAAAGTCAAAAGG - Intronic
968496583 4:920841-920863 CTTTTAACAAAATAGTATCTGGG - Intronic
968560851 4:1280988-1281010 CTATAAACACAAAAGAAACAGGG + Intergenic
969039706 4:4286572-4286594 CCTAAAACAAAAAAGTAAAACGG + Exonic
970151005 4:13089917-13089939 CTCTCAACAAAAATGCAATATGG - Intergenic
970417485 4:15873774-15873796 CCTTAAACAAAATAGTAAGAAGG - Intergenic
970532042 4:16994764-16994786 CTTTCAACAAACATCTAGCAAGG - Intergenic
971416610 4:26437731-26437753 CTTTCAAGAAAACAGTGATATGG + Intergenic
971568795 4:28183387-28183409 AATTCAACAAAAAATTAAAAAGG - Intergenic
971756216 4:30711718-30711740 ATTTTAACAAGGAAGTAACAGGG - Intergenic
971799922 4:31275497-31275519 CTTTCATTTATAAAGTAACAGGG + Intergenic
972653547 4:41043833-41043855 CTTTCAACAAATAAGTTGTAAGG - Intronic
972772280 4:42208714-42208736 GTTTCAAAAAAAAATTAACCAGG - Intergenic
973133260 4:46674677-46674699 CTTTCAACAAAAAAGCCACAAGG - Intergenic
973333867 4:48936471-48936493 CTTACAACATACAAGCAACACGG - Intergenic
973939969 4:55897285-55897307 TTTTCTACAAAAAATTAGCAGGG - Intronic
974210430 4:58766640-58766662 CTTTCCAGAAAAAAATTACAAGG - Intergenic
974248675 4:59357410-59357432 CTTGCAACAAAAAAGAGACCAGG - Intergenic
974911806 4:68132254-68132276 AATTTAACAGAAAAGTAACAGGG + Intergenic
975435568 4:74346830-74346852 CTTTCAACAAAAAAATTACAAGG + Intergenic
976593648 4:86874126-86874148 CCTGCAAAAAGAAAGTAACAGGG + Intergenic
976731864 4:88270250-88270272 CTTTAATCAGAAAAGTAAGATGG + Intronic
977090338 4:92666471-92666493 TTTTCAACACAAAAATCACAAGG - Intronic
977743656 4:100518277-100518299 CTTTCAAAACAAAAGTTAGAAGG - Intronic
978241534 4:106522745-106522767 CTTTCAAAAAAGAGCTAACATGG - Intergenic
978592802 4:110344208-110344230 CTTGCAACACAAACTTAACATGG - Intergenic
978846042 4:113274029-113274051 CTTTCAAAGAAAAAGAACCAGGG - Intronic
979723701 4:123934548-123934570 CTTTGAATAAAGAAGTGACATGG - Intergenic
980108927 4:128616241-128616263 GACTCAACAAAAAAGTAAGATGG + Intergenic
980129652 4:128806670-128806692 CATTCAACAAAATAGCTACAAGG - Intergenic
980283003 4:130744735-130744757 GTTTCTTCAAAAAATTAACAAGG - Intergenic
980315300 4:131191903-131191925 GGTTCAACAAACAAGTAACCAGG - Intergenic
980509080 4:133760961-133760983 CTTTCTACAAAAAAATCACAAGG - Intergenic
981036224 4:140171857-140171879 TCTACAACAAAATAGTAACAAGG + Intergenic
981898393 4:149832692-149832714 CTTTCAACATATAAGCAATAAGG + Intergenic
981960789 4:150536220-150536242 CTTTGGGCAAAAAAGTTACAAGG + Intronic
982058827 4:151582003-151582025 TTTTAAAAAAAAAAGTGACAGGG - Intronic
982571514 4:157056574-157056596 CATTCAACAAAAAAATTACAAGG - Intergenic
982906938 4:161086468-161086490 CTTTCAAAATAAAAGGCACAAGG + Intergenic
983279871 4:165666981-165667003 CTTTCAACAAATAACTAACAAGG - Intergenic
983300254 4:165916035-165916057 CTTTCACCAAACATGAAACAAGG - Intronic
983361045 4:166723702-166723724 TTTTCATCAAAAAAATAAAAAGG - Intergenic
983994468 4:174164617-174164639 CTTACAGCAAAAGAGTAGCAAGG - Intergenic
984816850 4:183846824-183846846 GTTTCAAAAAAAAAATTACAAGG - Intergenic
985086901 4:186323172-186323194 GTTTCAAATAAAAAATAACATGG + Intergenic
986863408 5:11954205-11954227 TTTTCAACAGAAAAGTGAAATGG - Intergenic
986863709 5:11958736-11958758 CTTTCTACAAAAGAATCACAAGG + Intergenic
986921516 5:12689214-12689236 GTTTGAACAGAAAAGTACCATGG - Intergenic
987277817 5:16380072-16380094 TTTTCAAAATAAAAGTAAGATGG + Intergenic
987591726 5:19937328-19937350 TTCTCAACAAGAAAGTAACAAGG + Intronic
987652012 5:20753660-20753682 CATTCAAGAATAAAGAAACAAGG + Intergenic
988237174 5:28561132-28561154 AATTCAACAAAGAAGTGACAGGG + Intergenic
988314469 5:29605230-29605252 CTATCAAAATAAAAGTAAAATGG - Intergenic
988434456 5:31157456-31157478 ATTTCCACAGAAAAGAAACATGG + Intergenic
988664800 5:33314348-33314370 ACTTCACCAAAAAAGTAATAGGG + Intergenic
988743548 5:34107816-34107838 CATTCAAGAATAAAGAAACAAGG - Intronic
988875433 5:35440292-35440314 ATTTCAATAAAAAAATTACAAGG + Intergenic
988958151 5:36340280-36340302 CTTTAAACAAGAAAGGAAAAAGG - Intergenic
989176200 5:38528977-38528999 CTTTGAAAAAAAAAAAAACATGG - Intronic
989748890 5:44867142-44867164 CTTACCACAAAGAAGTAATAGGG + Intergenic
989829821 5:45901859-45901881 GTTTCAAATAAAAAGGAACATGG - Intergenic
990621697 5:57566962-57566984 CTTTCTACAAAACAGTACAAGGG + Intergenic
990644853 5:57832606-57832628 TTAACAACAAAAAAGTAAGACGG - Intergenic
991193649 5:63905997-63906019 TTTTCAAGAAAGAAATAACAAGG - Intergenic
992567813 5:78018151-78018173 CTTTCAATAAGAAAATAACATGG - Intronic
993237955 5:85339578-85339600 CTTTCAACAAAAGTGTGATATGG - Intergenic
993274996 5:85845938-85845960 GTTTCAACAAAAAAGTCATGAGG - Intergenic
993359152 5:86951983-86952005 CTTCCAGCAAACAAGTAACCAGG - Intergenic
993928750 5:93908703-93908725 CTTTCAACTGAAAACTAATAAGG + Intronic
994086033 5:95759940-95759962 CTTTAAAAAAAAAAAAAACAAGG - Intronic
995450167 5:112291472-112291494 ATTTCAACAAAAGACTAACAAGG - Intronic
996604006 5:125299242-125299264 CTTTCAATAAAACAATAAGAAGG - Intergenic
996687410 5:126298112-126298134 TTTTTAGAAAAAAAGTAACATGG - Intergenic
996872354 5:128205585-128205607 GTTTCTACAAAGAAGTCACATGG + Intergenic
997112881 5:131094573-131094595 TTTTCAACCAAAAAGTCACATGG - Intergenic
998089045 5:139351682-139351704 CTCTCAAAAAAAGAGTGACAGGG - Intronic
998439127 5:142141639-142141661 ATTTCTACAAAAGAATAACAGGG + Intronic
998573875 5:143292009-143292031 CTTTCAGCAAAAAAACTACAAGG - Intronic
998652491 5:144136539-144136561 CTGCCAACAAAAAAGAAAGAAGG + Intergenic
998754653 5:145363055-145363077 TTTTCAAAAAAAAAAAAACAAGG + Intergenic
998887882 5:146713468-146713490 TTTACAACAAAAAAGTGAAAGGG + Intronic
1000135593 5:158347140-158347162 TTTTTAAAAAAAAAGCAACAAGG - Intergenic
1000401858 5:160837406-160837428 ATTTCAACAAATATTTAACAAGG - Intronic
1000684142 5:164225886-164225908 CAATCAACAAGAAATTAACATGG - Intergenic
1001127624 5:169034584-169034606 TTTTCAATATAAAATTAACATGG + Intronic
1003843174 6:10143672-10143694 TTTTAAACAAGAAAGAAACAAGG + Intronic
1004413478 6:15403104-15403126 CTTGCCCCAAAGAAGTAACAGGG + Intronic
1005095635 6:22112033-22112055 CTTTGAAAATAAAAGTAAAAGGG - Intergenic
1005108856 6:22255815-22255837 CTTTGAACACAAAAGTACCAGGG - Intergenic
1005432814 6:25776392-25776414 CTTGCAAAAAAAAAAGAACAAGG - Intronic
1005724703 6:28637321-28637343 CTATCAAGAAAAAAGCTACAAGG - Intergenic
1006714750 6:36109841-36109863 TTTAAAATAAAAAAGTAACAAGG + Exonic
1007126069 6:39426749-39426771 TCTTCAAAAAAAAAGTAACATGG + Intronic
1007136094 6:39523361-39523383 TTTTTAACAGAAAAGTAGCATGG - Intronic
1007459434 6:42007232-42007254 TTTACAACAAAAATGTAAAAAGG + Intronic
1007538468 6:42618463-42618485 CCTTTAACATAAAAGTAATATGG - Intronic
1007780731 6:44252882-44252904 CTGTCTACAAAAAATTAACCGGG - Intronic
1007905805 6:45459757-45459779 CTTTAAAGAAAAAAGAACCAGGG + Intronic
1008122181 6:47631436-47631458 CTTTCAAAAAAAAAGAAAAAAGG + Intergenic
1008862845 6:56171002-56171024 CTTTCACCAAAAAAGATAAAAGG - Exonic
1009266170 6:61557527-61557549 TTTTCAACAAAATACTAGCAAGG - Intergenic
1009555261 6:65155946-65155968 TTTTTAACAGAAGAGTAACAAGG + Intronic
1009761335 6:68010628-68010650 CTTACAAGAAAGAAGTAAGAAGG + Intergenic
1009773696 6:68177815-68177837 CATTAACCAAAAAAGTTACAAGG + Intergenic
1009841185 6:69076583-69076605 CTACAAACAAAAAAATAACATGG - Intronic
1011068134 6:83351364-83351386 CATTCAACAGAAAAGAAAGAGGG + Intronic
1011913620 6:92473182-92473204 CTTACAACAAAAAAATTAAAAGG + Intergenic
1012078411 6:94725044-94725066 TTTGAAATAAAAAAGTAACATGG + Intergenic
1012082227 6:94774619-94774641 CTATCAACAAAGCAATAACATGG - Intergenic
1012181690 6:96162542-96162564 CTTTCAACAAAAAATTACAAAGG - Intronic
1012559202 6:100558067-100558089 CTTTGAAAAAAAAAAAAACAAGG + Intronic
1013118124 6:107118324-107118346 CTCACAACAGAAAAGTAAGAGGG + Intergenic
1013651147 6:112196032-112196054 CTGTCAAGAAAAAAATAAAAGGG - Intronic
1014226961 6:118860076-118860098 CTTTCAACAAAAAAATTGCAAGG + Intronic
1014524582 6:122487283-122487305 CATTCTTCAAAAAAATAACAAGG - Intronic
1014812499 6:125902477-125902499 CTTTAAAAAAAAAAAAAACATGG - Intronic
1015746229 6:136512834-136512856 CTTTCAAAAAAAAAAAAAAAGGG - Intronic
1016079876 6:139843119-139843141 CATTCCACAAATATGTAACAAGG - Intergenic
1016328076 6:142926438-142926460 GTTTCCACAACAAAGTAAAAAGG + Intronic
1016467117 6:144336710-144336732 CTTTAAAAAAAAAAGAAAGAGGG - Intronic
1016511910 6:144852065-144852087 CTTTCAACAAGAAAACAACTAGG - Exonic
1017360479 6:153563785-153563807 CTTGCAACAAAAAACTAATCTGG + Intergenic
1018131244 6:160734135-160734157 TTTGCAACAAAAAAGGAAAAGGG + Intronic
1018261577 6:161975906-161975928 GTCTCAAAAAAAAAGTAAAATGG - Intronic
1018437985 6:163780736-163780758 CTTTCAAAAGCAAAGAAACAGGG - Intergenic
1018637929 6:165881049-165881071 TTTTGAACAAAAAAGAAAAATGG + Intronic
1019211688 6:170410860-170410882 TTTTCAACAATAAAATCACATGG + Intergenic
1019338562 7:496495-496517 CTTTATACAAAAAAGAAAAATGG + Intergenic
1020349858 7:7207687-7207709 TTTTCAACAAAAAAGTCACAAGG - Intronic
1020499622 7:8900517-8900539 CTTTTAACAAAAAAGAAATAAGG + Intergenic
1020531308 7:9340115-9340137 TTTTTACAAAAAAAGTAACATGG + Intergenic
1020730654 7:11874898-11874920 TTTTCATCATAAAAGTCACATGG + Intergenic
1020918840 7:14234996-14235018 TGGTCAACAAAAAAGTAACTTGG + Intronic
1021013866 7:15507531-15507553 CCTTCAACAAATAAATTACAAGG + Intronic
1021338083 7:19428665-19428687 CTTTCAACAAAAAATTTATAAGG + Intergenic
1022170370 7:27822318-27822340 CTTTCCCCAAAGAAGTAAAAAGG - Intronic
1022272244 7:28820087-28820109 CTTTTCACAAAATAGTAACCAGG + Exonic
1022420429 7:30215634-30215656 CTTTCTACAAAAAAATTACAAGG + Intergenic
1022825633 7:34009904-34009926 ATTTCAACAAAAATATAAGACGG - Intronic
1023877626 7:44296051-44296073 CTTTCAATAAAAAAACTACAAGG + Intronic
1024206678 7:47168663-47168685 TTTTCAATGAATAAGTAACAAGG + Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1025026272 7:55518824-55518846 TTTTAAGCAAAAAAGTGACATGG + Intronic
1025090427 7:56058566-56058588 CTTTCACCTTAAAAGTAAAAAGG - Intronic
1025832804 7:65068655-65068677 CTTTCACCTTAAAAGTAAAAAGG - Intergenic
1025902576 7:65758182-65758204 CTTTCACCTTAAAAGTAAAAAGG - Intergenic
1026081222 7:67223245-67223267 TTTTCAACAAGAAAATCACAAGG - Intronic
1026695862 7:72590766-72590788 TTTTCAACAAGAAAATCACAAGG + Intronic
1026719361 7:72817403-72817425 ATTTCAAAAAAAAAGAAAAAAGG + Intronic
1027931728 7:84545681-84545703 CTTTCAACAAAATTGAAAGATGG - Intergenic
1030043389 7:105472623-105472645 CTTTCAAAAAAAGAATAAAATGG + Intronic
1030397148 7:109000612-109000634 CTTTCTAGAAAAAAAAAACAAGG - Intergenic
1030432394 7:109467171-109467193 ATTTCAATTAAATAGTAACAGGG + Intergenic
1030450022 7:109696953-109696975 TATTCAACAAAAAATTTACAAGG + Intergenic
1030845954 7:114411533-114411555 ATTTTAACAAAACAGAAACATGG - Intronic
1031744219 7:125473093-125473115 CTTTAAACAAAATTGTAAAAAGG - Intergenic
1032260721 7:130334303-130334325 CTTTCAAAAAAAAAATTACAAGG + Intergenic
1032309403 7:130769348-130769370 CTTTAAACAGAAAAGTAACATGG + Intergenic
1033890811 7:146011068-146011090 TTTTGAACAAAGAAGTGACAAGG - Intergenic
1034696005 7:153054247-153054269 CTTTCCTCCAAAAAGAAACAAGG - Intergenic
1035553846 8:549096-549118 CTTACATCAAAAAAGTAGAAAGG - Intergenic
1035889388 8:3327143-3327165 CTTTCAAAAAAAAAAAAAGATGG - Intronic
1036130004 8:6101165-6101187 CTTTAAACAATAAAGAAACCAGG + Intergenic
1037126513 8:15357980-15358002 CTTGCATAAGAAAAGTAACAGGG + Intergenic
1037930249 8:22875525-22875547 CTTTTAATAAAAAAATAAAAAGG - Intronic
1038290896 8:26249030-26249052 CTTTCAACAAACAAGTACTGAGG - Intergenic
1038390041 8:27189006-27189028 CTTTGAAAAAGAAAATAACATGG + Intergenic
1038592665 8:28854495-28854517 CTTTCAAGAAGAAGGAAACAGGG + Intronic
1038912468 8:31981822-31981844 CTTACAAAAAAAAAGGAATATGG + Intronic
1040879276 8:52187720-52187742 CTCTCAACCAAAAAGCAAAAAGG - Intronic
1041225555 8:55693895-55693917 CTTTGAACAAAAAAAGAATAAGG - Intergenic
1041292988 8:56324899-56324921 CTTTCCCCAACAAAGTGACAGGG - Intergenic
1041598455 8:59686159-59686181 CTTTCAAGAGTCAAGTAACATGG - Intergenic
1041870500 8:62628934-62628956 CATTCAACAAATATGTATCAAGG - Intronic
1042296449 8:67223364-67223386 CTTTGAACAAAAAGTTAACTAGG - Intronic
1042387164 8:68189991-68190013 CTTTTTAAAATAAAGTAACATGG - Intronic
1042397258 8:68306841-68306863 CTCTCAAAAAAAAAATATCAAGG + Intronic
1042688650 8:71470932-71470954 CTTTAAAAAAAAAAGGAAAAAGG + Intronic
1043055103 8:75427652-75427674 CATTCAACAAATACTTAACAAGG - Intronic
1043258811 8:78171163-78171185 CTTTCAAACACAAAGAAACATGG + Intergenic
1043667294 8:82831877-82831899 TTTTCAACAAGAAAGTCACAAGG - Intergenic
1044155753 8:88844389-88844411 CTTTCTAATAAAAAGAAACATGG + Intergenic
1044329288 8:90897499-90897521 GTTTCAATAAAAAATTAAGATGG + Intronic
1046134407 8:110008300-110008322 CTTAAAACAAAAAAGGAAAATGG - Intergenic
1046164937 8:110420246-110420268 TTTTCAACTCAAAAATAACAAGG + Intergenic
1046191083 8:110794458-110794480 TTTTCAACAGAAAAATGACAAGG + Intergenic
1046472188 8:114690317-114690339 CTGCCAACAAAATAATAACATGG - Intergenic
1047240032 8:123078560-123078582 CTTTCTACTAAAAAGAATCAAGG + Intronic
1048353873 8:133637745-133637767 TTTTAAACAAAAAAATGACATGG + Intergenic
1049924912 9:399540-399562 CATTCAACAGAAAATTAACATGG + Intronic
1050812294 9:9763648-9763670 CCTTCAAGAACAAAGTAAAAGGG + Intronic
1051071424 9:13172697-13172719 CTTTCACTAAAAAAATGACAGGG + Intronic
1051720623 9:20033472-20033494 CTGTCTACTAAAAAGTAAAAGGG - Intergenic
1051806638 9:21001023-21001045 TTTTCAGCAAAAAAATAACAAGG + Exonic
1051820442 9:21160149-21160171 CTTTCAGCAAAAAATTAACAAGG - Intergenic
1052608783 9:30741555-30741577 CCTACAACAAAAAAGTAGCAAGG - Intergenic
1053339536 9:37311709-37311731 CTAGCATCAAAAAAGTAAAAAGG - Intronic
1055195755 9:73591501-73591523 TTTTCAGCAAAAAATTAAAAAGG - Intergenic
1055469820 9:76600337-76600359 CTTTCAACAAAAAAATCACAAGG - Intergenic
1055536512 9:77252006-77252028 CCTTACCCAAAAAAGTAACATGG - Intronic
1055943359 9:81671165-81671187 CTCAAAACAAAAAAGAAACAAGG + Intronic
1057093402 9:92281679-92281701 GTTTCAACACAAAAATATCAAGG + Intronic
1057239492 9:93396133-93396155 TTTTCAACGAAAAAATCACAAGG - Intergenic
1057435204 9:95033669-95033691 CTTTCATCAAAAAGGCCACATGG + Intronic
1058186826 9:101864976-101864998 CTTATACCAAAAAAGTAAAAAGG + Intergenic
1058508414 9:105689889-105689911 CTTTAAAAAAAATAGTAACATGG - Intergenic
1058587247 9:106522804-106522826 CTTTCAACAAAAAAAGCCCAGGG + Intergenic
1059218499 9:112589849-112589871 CTTTCCAGAAAAAAGTCAGAAGG - Intronic
1059381282 9:113928472-113928494 CTTTCAACAAAAAAATTACATGG - Intronic
1059860216 9:118452111-118452133 GTTTCTACAAAAAATTAACAAGG + Intergenic
1060709695 9:125846915-125846937 TTTTCAACAAAAAAGTACAAAGG - Intronic
1061688813 9:132307461-132307483 CTTTCAACTAAAATATAGCAAGG + Intronic
1061688911 9:132308419-132308441 TTTTCAACAAAAAAATTGCAAGG + Intronic
1186579673 X:10804333-10804355 CTTTCAACAAAAAAATTACAAGG - Intronic
1187176270 X:16898705-16898727 CTTTCAACAAGAACGTCACCTGG + Intergenic
1187616703 X:21002703-21002725 CTTTAATAAAGAAAGTAACAAGG - Intergenic
1187626545 X:21121023-21121045 CTTAAAAAAAAAAAGTAACTGGG - Intergenic
1187732428 X:22269300-22269322 CTTTAAACAAAAAATTAAATGGG - Intergenic
1188450581 X:30304329-30304351 CTTTTAAAAAAAAAATAGCAGGG - Exonic
1189459572 X:41228290-41228312 TTTTTAACACAAAAGAAACAAGG + Intronic
1190894083 X:54598469-54598491 CTTTTAACAAAAAAATTAGAAGG + Intergenic
1190898788 X:54648541-54648563 CTTTAAACAAAAAAATTACAAGG - Intergenic
1191161424 X:57333358-57333380 CTTTCAACAAAACAATTATAAGG + Intronic
1193313479 X:80036920-80036942 CATTCTACCAAAAAGTCACATGG - Intergenic
1193576039 X:83196990-83197012 CATTCAATCAAAAATTAACATGG - Intergenic
1194239034 X:91421345-91421367 CTTCCAACAAAAAATTACAAAGG + Intergenic
1194511362 X:94799265-94799287 GTTTCAAAAAAAAAGTTTCATGG + Intergenic
1195512518 X:105733893-105733915 CTTTCAACAAAAAAGTAACAAGG - Intronic
1195994495 X:110718152-110718174 CATTCAACTACAAAGTAGCAAGG + Intronic
1196187811 X:112763254-112763276 CAATCATCAACAAAGTAACAGGG + Intergenic
1197039061 X:121913123-121913145 TTTGCAACAAAAAAATAACAAGG - Intergenic
1197360784 X:125500703-125500725 AATTCAACAACAAATTAACAAGG - Intergenic
1197456411 X:126681512-126681534 ATTTTACCAAAAAAGTAGCAGGG + Intergenic
1198928989 X:141832034-141832056 TATTCAACAAAATAGTAACCCGG - Intergenic
1199217556 X:145277918-145277940 CTTTCAACAAAAAATTTTGAGGG - Intergenic
1199455462 X:148022781-148022803 TTAACAACAAAAAAGCAACACGG - Intronic
1199634274 X:149801146-149801168 CTTTCACCAAAAATGTTACAAGG - Intergenic
1200304925 X:155014971-155014993 ATTTCAATAAAAAAGTAAGTTGG + Intronic
1200770977 Y:7125278-7125300 CTTCCAACTAAGAAGTCACAGGG + Intergenic
1200868505 Y:8072174-8072196 CTTTCAGTAAAAAATAAACAAGG + Intergenic
1200869334 Y:8080296-8080318 CTTTCAGTAAAAAATAAACAAGG - Intergenic
1200942004 Y:8793758-8793780 TTTTCTACAAAAAAGACACATGG + Intergenic