ID: 1195521151

View in Genome Browser
Species Human (GRCh38)
Location X:105830829-105830851
Sequence TTGTGTAGGGGGAGGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 20576
Summary {0: 1, 1: 21, 2: 476, 3: 9792, 4: 10286}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195521151 Original CRISPR TTGTGTAGGGGGAGGGGGGA GGG Intronic
Too many off-targets to display for this crispr