ID: 1195524002

View in Genome Browser
Species Human (GRCh38)
Location X:105864959-105864981
Sequence AATAGAACCCTGCTTTTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 171}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195524002_1195524005 27 Left 1195524002 X:105864959-105864981 CCAGTGAAAAGCAGGGTTCTATT 0: 1
1: 0
2: 2
3: 13
4: 171
Right 1195524005 X:105865009-105865031 GCCCCCCTTCAGGCTCCTGTTGG 0: 1
1: 0
2: 2
3: 21
4: 197
1195524002_1195524007 28 Left 1195524002 X:105864959-105864981 CCAGTGAAAAGCAGGGTTCTATT 0: 1
1: 0
2: 2
3: 13
4: 171
Right 1195524007 X:105865010-105865032 CCCCCCTTCAGGCTCCTGTTGGG 0: 1
1: 0
2: 1
3: 16
4: 140
1195524002_1195524004 17 Left 1195524002 X:105864959-105864981 CCAGTGAAAAGCAGGGTTCTATT 0: 1
1: 0
2: 2
3: 13
4: 171
Right 1195524004 X:105864999-105865021 AACTCTTTATGCCCCCCTTCAGG 0: 1
1: 0
2: 0
3: 6
4: 93
1195524002_1195524009 29 Left 1195524002 X:105864959-105864981 CCAGTGAAAAGCAGGGTTCTATT 0: 1
1: 0
2: 2
3: 13
4: 171
Right 1195524009 X:105865011-105865033 CCCCCTTCAGGCTCCTGTTGGGG 0: 1
1: 0
2: 0
3: 15
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195524002 Original CRISPR AATAGAACCCTGCTTTTCAC TGG (reversed) Intronic
901237267 1:7673881-7673903 AATAAGACCCAGCTTCTCACCGG + Intronic
909229386 1:73066074-73066096 AATAGATCCCTTCTTTTGTCCGG - Intergenic
911524364 1:98966014-98966036 AATAAAACCCCACATTTCACTGG - Intronic
913393458 1:118340254-118340276 AACAGAACTCTGCTGTTCTCAGG + Intergenic
913918145 1:124799353-124799375 AATTTAACCTTGCTTTTCATAGG + Intergenic
913920388 1:124825366-124825388 AATTTAACCTTGCTTTTCATAGG + Intergenic
917245347 1:172995057-172995079 AATATAACCCTGGTTTTCTTTGG - Intergenic
917695653 1:177520562-177520584 AGTAGAAACCTGCTTTGCCCAGG - Intergenic
918960951 1:191276885-191276907 AAGAAAACTCTGCTTTTAACAGG + Intergenic
921022381 1:211248049-211248071 AATGGAACCCTGCTTTTTAGTGG + Intergenic
921553822 1:216572004-216572026 AATATTAGCCTGCTTTTGACAGG - Intronic
923783605 1:237047287-237047309 AAAAGAAACCTCCTTTTCACTGG - Intronic
1063255366 10:4321370-4321392 AAGAGAAGCCTGCTTTTTGCTGG - Intergenic
1063869700 10:10404277-10404299 AACAGAACTCTTCTGTTCACTGG + Intergenic
1063914864 10:10871193-10871215 AAAAGAACCCTTCTTTGCAATGG - Intergenic
1066344000 10:34564363-34564385 AACAGAACCCTGATTTTATCAGG + Intronic
1067742305 10:48904875-48904897 AACAGAACCTTGATTTTCTCAGG - Intronic
1071004341 10:80865129-80865151 AATAAAACTTTGCTTTTCACTGG - Intergenic
1074120302 10:110489121-110489143 AATAGGAACCTGCATTTCAAAGG + Intergenic
1074126453 10:110532299-110532321 AATAGCACCCTGTTTTACAGGGG + Intergenic
1074612111 10:115031628-115031650 AAAAAACCCCTGCTTTTCAGAGG + Intergenic
1077796966 11:5502370-5502392 AAGAGAATCCTGATTTTGACTGG - Intronic
1080698198 11:34621285-34621307 AAGAGAAGCCTGCTTTAAACTGG + Intronic
1080750113 11:35143304-35143326 CTTAGGACCCTGCTTTACACAGG - Intronic
1081323675 11:41720169-41720191 AATAGAAACCTGCTTAACATAGG + Intergenic
1084773715 11:71361370-71361392 AATAGAACCCTGGTTCTATCTGG - Intergenic
1087065638 11:94025515-94025537 ATGAAAACCCTGCATTTCACTGG - Intronic
1087508347 11:99057312-99057334 AATACAAACCTGCTTTGTACTGG - Intronic
1089151437 11:116367358-116367380 AAATGCACCCTGCTTTTCACCGG + Intergenic
1089449269 11:118580816-118580838 AATAGAATACTGACTTTCACGGG - Intronic
1089972705 11:122707163-122707185 CATAGACCCCTGTTTTTCAAAGG + Intronic
1090167536 11:124566448-124566470 ATTAGAGCCTTGCTTTACACTGG - Intergenic
1091501968 12:1026906-1026928 TATAGATCCCTTCCTTTCACAGG - Intronic
1093918340 12:24831310-24831332 ACTAGTAGCCTGCTGTTCACCGG - Intronic
1097182666 12:57180102-57180124 AATCGCACCCTGCTCTTCAGTGG + Exonic
1097901367 12:64876763-64876785 AATTGAACACTGCCTTTCTCTGG + Intronic
1101397177 12:104358579-104358601 AGTGGAAGCCTGCTGTTCACAGG - Intergenic
1101428206 12:104605173-104605195 AATCAAACCCAGATTTTCACTGG + Intronic
1101770600 12:107746822-107746844 ATTAGAACCGTGCTTCTTACTGG - Intronic
1102377121 12:112431513-112431535 AAAAAAACCCTGCTTCTCAGGGG - Intronic
1104438951 12:128779434-128779456 AGGAGAAACCTGATTTTCACAGG + Intergenic
1105090831 13:16286146-16286168 AGTTGAACCTTTCTTTTCACAGG + Intergenic
1105099030 13:16420908-16420930 AAAAGAACCTTCCTTTTGACAGG + Intergenic
1105143497 13:17146913-17146935 AGTTGAACCTTTCTTTTCACAGG + Intergenic
1105152180 13:17288666-17288688 AGTTGAACCTTTCTTTTCACAGG + Intergenic
1106173429 13:27308514-27308536 AAGAGAACTCTGCTTCCCACTGG - Intergenic
1106212967 13:27667910-27667932 AATAGAACAGTGCTTTTAAAAGG - Intergenic
1109591266 13:64486277-64486299 AATAGAACTCAGCTTTTGACTGG - Intergenic
1109895470 13:68681874-68681896 AATAGAACGGTGGTTTTCAGGGG + Intergenic
1110456203 13:75692979-75693001 AATAGCAGACTCCTTTTCACAGG - Intronic
1112118325 13:96382127-96382149 AAAACAACCCTCCTTATCACAGG - Intronic
1113508472 13:110832628-110832650 TCCAGAACCCTGGTTTTCACGGG - Intergenic
1115307275 14:31945651-31945673 AATATAACCATCCTATTCACGGG - Intronic
1116333287 14:43622828-43622850 AATAAAACAAGGCTTTTCACAGG - Intergenic
1117425254 14:55588100-55588122 ACTAGTACCCTACTTTTGACTGG + Intronic
1120700705 14:87695960-87695982 ATTATAACCATGCGTTTCACAGG - Intergenic
1121505471 14:94473689-94473711 AGTAGACCCCAGCTTGTCACAGG - Intronic
1124173592 15:27401328-27401350 AATAGAACCCTGGTTTTTAAAGG - Intronic
1125132349 15:36298204-36298226 CATAGAACACTGCATTTCAAAGG - Intergenic
1125223012 15:37361567-37361589 AATAGATCCATGCATCTCACAGG + Intergenic
1125750742 15:42026253-42026275 GACAGACCCCTGCTTTTCAAGGG + Intronic
1126551295 15:49932887-49932909 AATAGAACCCTCCTTATAATTGG + Intronic
1127618529 15:60710770-60710792 AGCAGAGCCCTGCTTTTCAGAGG - Intronic
1130933576 15:88449907-88449929 TATACAACCCTGCTTTCCTCCGG + Intergenic
1130956118 15:88628628-88628650 AACAGAACCGTGCCTGTCACTGG - Intronic
1132780940 16:1625104-1625126 AAGAGAACCCTGGTTATCACAGG + Intronic
1133659964 16:7906749-7906771 CATAGAACCCTGCTACTCAAAGG + Intergenic
1135850849 16:25962206-25962228 AAAAAAACCCTCCTTTTCCCTGG - Intronic
1138398564 16:56727435-56727457 AACAGAATCCTGTTTTTCAAAGG - Intronic
1138990021 16:62379236-62379258 ATTAAAATCCTGCTTTCCACTGG - Intergenic
1139719995 16:68844476-68844498 GATAGAGCTCTGCTTATCACTGG + Intronic
1140127994 16:72133756-72133778 ATTAGGACCCTGCCTTTCCCTGG - Intronic
1140559707 16:75964369-75964391 AAGAGAACCCTTCACTTCACAGG + Intergenic
1141802394 16:86319727-86319749 AATTGAACTCTGCTCCTCACTGG - Intergenic
1147558318 17:41493727-41493749 TATAGAACCCTGCTTTTCAGGGG - Intergenic
1154582003 18:16115734-16115756 AGTAGAACCTTTCTTTTCATAGG + Intergenic
1154760958 18:18568664-18568686 AGTAGAACCTTTCTTTTCATAGG + Intergenic
1159765709 18:72485639-72485661 GATAGAGCCCTGCTTTTTCCTGG - Intergenic
1160401909 18:78617695-78617717 AAATGAAGCCTGCTTTTCCCGGG - Intergenic
1164861459 19:31565260-31565282 AATGGAACCCTGCCTCTCTCAGG + Intergenic
1168193676 19:54757666-54757688 AATAGGACCCTGTTTTTCCTGGG - Intronic
926989828 2:18666462-18666484 AATAACACCCTACTTTTGACTGG + Intergenic
927790643 2:26006703-26006725 ATTAGAACCCTGGTTTTCCTTGG - Intergenic
929251487 2:39761288-39761310 AAAAGAACCTTGCTATTAACAGG + Intronic
929643186 2:43602363-43602385 AAGAGAACCTTACTTTTGACTGG - Intergenic
930382620 2:50650964-50650986 AATATAAACCTGTTTTTCAGTGG + Intronic
933510952 2:83240972-83240994 AATAGAACACTTGTTTTCCCTGG - Intergenic
933758105 2:85656400-85656422 AAGAGAAGCCTGCCTCTCACAGG - Intergenic
937743900 2:125387942-125387964 ACGTGAACCTTGCTTTTCACTGG - Intergenic
939388689 2:141537021-141537043 AAAAAATCCCTGCTTTTCAAAGG + Intronic
939650806 2:144759565-144759587 AAGAGAAACCAGCTTTTTACTGG + Intergenic
943213376 2:184998732-184998754 AATGGGACTCTTCTTTTCACTGG + Intergenic
943855013 2:192778432-192778454 AATAAAACCCAGCATTTTACAGG + Intergenic
1169744133 20:8926541-8926563 CATAGAACCCATCTTTTGACAGG - Intronic
1171613223 20:26935226-26935248 AATTGAACACTCCCTTTCACAGG + Intergenic
1171646538 20:27434225-27434247 AATTGAACACTCCCTTTCACAGG + Intergenic
1171661419 20:27657711-27657733 AATTGAACACTCCCTTTCACAGG + Intergenic
1171700908 20:28249684-28249706 AATTGAACACTCCCTTTCACAGG + Intergenic
1171714177 20:28449898-28449920 AATTGAACACTCCCTTTCACAGG + Intergenic
1172218804 20:33257604-33257626 AATGGAACCCAGCTATTAACTGG + Intergenic
1173272509 20:41550587-41550609 TCTAAATCCCTGCTTTTCACTGG - Intronic
1177056455 21:16309818-16309840 ATGAGAACCTTGCTTTTCAAAGG + Intergenic
1178827073 21:36025873-36025895 CTTAGAACCCTGCTCCTCACAGG - Intergenic
1181951861 22:26559813-26559835 AATAGAACCATGCTGTTAAGTGG - Intronic
951097628 3:18650299-18650321 AACTGAGCCCAGCTTTTCACTGG + Intergenic
952001425 3:28789732-28789754 AATGGAACCCTGGTTTTCCTTGG + Intergenic
954584568 3:51722153-51722175 AGCAGACCCCTGCTTTTCCCAGG - Intergenic
954892099 3:53940092-53940114 AACAGAACGCTGCTTTTATCTGG - Intergenic
955433948 3:58879596-58879618 AATAGGACCCTGCAGTTCTCAGG + Intronic
955587100 3:60491320-60491342 ATTATAACCCTGTTTTTCATAGG - Intronic
955625712 3:60917044-60917066 GATAGAACCCTAGTTTTTACTGG + Intronic
959630237 3:108499382-108499404 AATAGATACCTCCATTTCACTGG - Intronic
960366840 3:116783148-116783170 AATAAGACCCTGCCTTTCTCTGG + Intronic
963829654 3:149993077-149993099 AAAGCAACCCTGCTCTTCACAGG + Intronic
964016965 3:151959795-151959817 AAAAGAAGCCTGATTTGCACAGG + Intergenic
964820388 3:160762462-160762484 AACATAACACTGCTTTTCACAGG - Intronic
965229159 3:166028830-166028852 AATGGATAGCTGCTTTTCACAGG + Intergenic
967136824 3:186519621-186519643 AATAGGAACCTCCTTCTCACAGG + Intergenic
967742302 3:193016744-193016766 AATAGAGCCCTGCTGTGCTCAGG - Intergenic
969592157 4:8128052-8128074 AGCAGGACCCTGCTCTTCACAGG + Intronic
970324905 4:14913501-14913523 CATATAACCCTGCTTTTGAGGGG - Intergenic
970961417 4:21875607-21875629 TATAGAAGCCTTCTTGTCACCGG + Intronic
972347651 4:38206410-38206432 CATAAAACCCTGCTTTAAACAGG + Intergenic
972439447 4:39072218-39072240 AGTAGAACCCTGCTTTTCAGTGG - Intronic
976832236 4:89328556-89328578 AAAAGAACCTTTCTTTCCACTGG - Intergenic
978675460 4:111309470-111309492 CATAGTATCCTGCTTTTCCCTGG - Intergenic
979903715 4:126256655-126256677 AATAGAACCCTTCTTCTCAAAGG + Intergenic
982304540 4:153916473-153916495 AATAGAACACCTCTGTTCACTGG - Intergenic
983512103 4:168619884-168619906 AGGAGAACTATGCTTTTCACTGG - Intronic
985359210 4:189154787-189154809 AGGAGACCCCTGCCTTTCACAGG + Intergenic
985808956 5:2069112-2069134 AAGATAACGCTGCTTTTCTCTGG + Intergenic
990171139 5:53051082-53051104 ATTAGAACACTGTTTTTAACAGG - Intronic
990636568 5:57734665-57734687 AATTGAGCTCTGCTTTGCACTGG - Intergenic
992498617 5:77319102-77319124 AAGAGATACCTGCTTTTCAAAGG - Intronic
994794532 5:104278929-104278951 AATAGAACCCTCCCTTCCAAGGG - Intergenic
997404729 5:133636208-133636230 AACAGAAGCCTGATATTCACTGG + Intergenic
998022685 5:138784298-138784320 AATCGAGCCCTGCTATTTACAGG + Intronic
998310071 5:141121329-141121351 AATAGAACCTTTCGTTTCAAAGG + Intronic
1000627651 5:163557667-163557689 AATAGAATCCTTCTTTTCATGGG + Intergenic
1001347502 5:170919158-170919180 TATAAAACCATGTTTTTCACAGG + Intronic
1001855240 5:175004952-175004974 ACTAGAACCTTTCTTTTCACAGG - Intergenic
1003336418 6:5177168-5177190 AAAAGAACTCTGCTCTTAACAGG + Intronic
1003860068 6:10314830-10314852 AAAAGAATCCTCCGTTTCACGGG + Intergenic
1005529158 6:26685249-26685271 AATAGCACCCTTCTATACACTGG - Intergenic
1005541638 6:26816397-26816419 AATAGCACCCTTCTATACACTGG + Intergenic
1005628812 6:27688016-27688038 CAAAGAACCCTGCTTCTTACGGG - Intergenic
1006011077 6:31043468-31043490 AATAGATCCCTGCCTATTACGGG - Intergenic
1008589381 6:52977799-52977821 AACCGAATCCTGCTTCTCACAGG - Intergenic
1010179385 6:73067459-73067481 AATAGATCCCTTTTTCTCACAGG - Intronic
1011053613 6:83181832-83181854 AATGGAACACTACTTCTCACAGG - Exonic
1011464090 6:87637414-87637436 AATAAAACACAGCTTTTCAGTGG - Intronic
1013198355 6:107865994-107866016 TATAGAACACTGATTTTCAAAGG - Intergenic
1013295480 6:108754755-108754777 AAGAGAACTCATCTTTTCACTGG - Intergenic
1020983590 7:15103629-15103651 AATAGAATCCTGGTTATCAGAGG + Intergenic
1025568977 7:62531983-62532005 AATTGAACCTTTCTTTTCATAGG + Intergenic
1026050280 7:66940814-66940836 AATAGAATTCAGCTTTTCAGTGG + Intronic
1028823581 7:95243078-95243100 AAAAGAAAATTGCTTTTCACAGG - Intronic
1030289732 7:107859946-107859968 AAGAGCACCCTGGTTTTCTCTGG - Intergenic
1034954495 7:155326249-155326271 AATAGAAACCTCCTTCTCACAGG + Intergenic
1035843929 8:2842854-2842876 AACAGAAGCCTGCTTTTTAAAGG + Intergenic
1037297347 8:17414804-17414826 AATACAACCTTGATTTTAACTGG + Intergenic
1038209868 8:25506560-25506582 AAAAGATCCTTTCTTTTCACTGG - Exonic
1038445286 8:27599600-27599622 AATATAACCCTGCTTTACAAAGG - Intronic
1038539631 8:28381514-28381536 AATAGTACCCTGATGTTTACAGG - Intronic
1041871724 8:62642200-62642222 AATAGAAACCAGTTTGTCACTGG + Intronic
1043635116 8:82375365-82375387 AATATAATCCTGTTTTTCCCTGG - Intergenic
1043765636 8:84128384-84128406 AATAGGAGGCTGCTTTTCAATGG - Intergenic
1047141248 8:122142067-122142089 GACAGAACCCAGCTTTTCATGGG + Intergenic
1048221750 8:132548696-132548718 AATAGAGCCCAGCTTTTCTTGGG + Intergenic
1048680507 8:136836175-136836197 AAAAAAGCCCTGCTCTTCACAGG - Intergenic
1050658683 9:7858577-7858599 AATAGCACCCTGATTTGTACTGG - Intronic
1051490359 9:17657211-17657233 AACAGACACCTGCTTTTCAAGGG + Intronic
1052774197 9:32717441-32717463 AATAGAACACTTCCATTCACAGG - Intergenic
1055179630 9:73368670-73368692 GCTACAACCCTGATTTTCACAGG + Intergenic
1056729718 9:89155229-89155251 AATACAAGCCTCCATTTCACTGG + Intronic
1058345289 9:103953592-103953614 AGCAGAACCTTGCTTTTCTCAGG + Intergenic
1188623879 X:32260432-32260454 AATGGTACCCTGCTTTTCCTTGG + Intronic
1194289122 X:92047333-92047355 AGTAGAACCCTAGTTTTTACTGG - Intronic
1195307205 X:103595477-103595499 TATAGAACAATGCTTATCACTGG + Intergenic
1195524002 X:105864959-105864981 AATAGAACCCTGCTTTTCACTGG - Intronic
1197325379 X:125087025-125087047 ATTATAAACCTGCTTTTCAAGGG - Intergenic
1198452518 X:136781393-136781415 AACAGAAGCCAGATTTTCACTGG - Exonic
1199047637 X:143195117-143195139 AAGAAAACCCAGCTTTACACAGG - Intergenic
1200606638 Y:5271911-5271933 AGTAGAACCCTAGTTTTTACTGG - Intronic
1200908355 Y:8508915-8508937 AATTCCACCCTGCTTTTCTCTGG + Intergenic
1202338887 Y:23839190-23839212 ATTTGCACCCTTCTTTTCACTGG + Intergenic
1202531879 Y:25830882-25830904 ATTTGCACCCTTCTTTTCACTGG - Intergenic