ID: 1195524005

View in Genome Browser
Species Human (GRCh38)
Location X:105865009-105865031
Sequence GCCCCCCTTCAGGCTCCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 197}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195524002_1195524005 27 Left 1195524002 X:105864959-105864981 CCAGTGAAAAGCAGGGTTCTATT 0: 1
1: 0
2: 2
3: 13
4: 171
Right 1195524005 X:105865009-105865031 GCCCCCCTTCAGGCTCCTGTTGG 0: 1
1: 0
2: 2
3: 21
4: 197
1195524001_1195524005 28 Left 1195524001 X:105864958-105864980 CCCAGTGAAAAGCAGGGTTCTAT 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1195524005 X:105865009-105865031 GCCCCCCTTCAGGCTCCTGTTGG 0: 1
1: 0
2: 2
3: 21
4: 197
1195524003_1195524005 -3 Left 1195524003 X:105864989-105865011 CCATATACACAACTCTTTATGCC 0: 1
1: 0
2: 1
3: 7
4: 130
Right 1195524005 X:105865009-105865031 GCCCCCCTTCAGGCTCCTGTTGG 0: 1
1: 0
2: 2
3: 21
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195524005 Original CRISPR GCCCCCCTTCAGGCTCCTGT TGG Intronic
901139681 1:7020625-7020647 GCCCCTCTGAGGGCTCCTGTAGG + Intronic
901490480 1:9594071-9594093 GCCTCCCTGCATTCTCCTGTAGG + Intronic
903179790 1:21599445-21599467 GCCCCCTTCCAAGCTCCTGTGGG + Intronic
903572491 1:24316839-24316861 TGCCCCCTTCCTGCTCCTGTGGG - Intergenic
905284289 1:36869197-36869219 GCCCACCTACAGGCTCCAGATGG - Intronic
906666122 1:47623332-47623354 GGCCCCCTCCCTGCTCCTGTGGG - Intergenic
907266339 1:53263867-53263889 GCCTTTCTTCAGGCTGCTGTAGG - Intronic
907270184 1:53286507-53286529 ACCCACCTTCAGGCTTCTGTTGG - Intronic
913996440 1:143654656-143654678 GCGCCCCTCCAGGCTCCTGCTGG + Intergenic
914505822 1:148288155-148288177 GCGCCCCTCCAGGCTCCTGCTGG - Intergenic
914506736 1:148296011-148296033 GCGCCCCTCCAGGCTCCTGCTGG + Intergenic
914983787 1:152439604-152439626 GACCCCTTTTAGGATCCTGTGGG + Intergenic
924223556 1:241902604-241902626 GCCTCCCTTCAGGCTCCTGCAGG + Intergenic
924235855 1:241999100-241999122 GGCCTCCTTCAGGCTCCTGCAGG - Intergenic
1062920215 10:1273769-1273791 GCCCCACCACAGGCTCCTGCAGG + Intronic
1063703038 10:8404157-8404179 TGCCCCCTGCAGGCTCCTGAAGG - Intergenic
1063723163 10:8605445-8605467 TCCCCCCTTCTGGCTTCTGGTGG - Intergenic
1067328472 10:45292369-45292391 GCCTCCCTTCTGGGGCCTGTAGG - Intergenic
1068481582 10:57595939-57595961 GCACCTCTTCATGCACCTGTTGG + Intergenic
1074261436 10:111857423-111857445 GGCCTCCTTTAGGCTCCTCTTGG + Intergenic
1075504415 10:123009231-123009253 GACCCCCTTCAGGCCTCTGGTGG + Intronic
1076903216 10:133350083-133350105 GCCCCCCCTCAGGCTCCTCCTGG + Exonic
1076992867 11:284716-284738 GCCCCTCTTCAGGGTCCAGGGGG - Intronic
1077076081 11:702864-702886 GCAGCCCTCCAGGCACCTGTGGG + Intronic
1077109550 11:856037-856059 GGCCCCCTTGAGCCTCCTGTAGG - Intronic
1078354102 11:10621386-10621408 GCCCCGCTTCAAGCTGCTGGGGG - Intronic
1078457837 11:11489192-11489214 TCCCCCATTCATACTCCTGTGGG - Intronic
1080569321 11:33542103-33542125 GTCCCCCTTTAGGCCCCGGTTGG - Intronic
1081651732 11:44828434-44828456 GCACCCCTTCATCCTCCTATAGG - Intronic
1084597135 11:70123591-70123613 GCCCCACCTCTGGCTCCTGGTGG + Intronic
1084948980 11:72654374-72654396 GCCCCAGTTCAGGCACCTGCTGG - Intronic
1085082661 11:73647168-73647190 GGCCCCTTTCAGCCTCCTCTGGG + Intronic
1085200601 11:74699566-74699588 GCCCCCCTGCAGCCTCCTGATGG - Intronic
1087180292 11:95135347-95135369 GCAACCCTTCAGGCTACTGAGGG - Intergenic
1091363604 11:134998832-134998854 GCCCCCCATGAGGCTCTTTTGGG + Intergenic
1091682487 12:2537056-2537078 GCCTCCCTGCCGGCTCCTCTGGG - Intronic
1092244387 12:6855394-6855416 GGCCCCCCTCAGACTCCTGTGGG - Exonic
1096532751 12:52252273-52252295 GCCCTCCAGCAGGCGCCTGTAGG + Intronic
1096537906 12:52287113-52287135 GCCCTCCAGCAGGCGCCTGTAGG + Exonic
1096540865 12:52306247-52306269 GCCCTCCAGCAGGCGCCTGTAGG - Exonic
1096542507 12:52315904-52315926 GCCCTCCAGCAGGCGCCTGTAGG + Exonic
1096549373 12:52362262-52362284 GCCCTCCAGCAGGCGCCTGTAGG + Exonic
1096552184 12:52380374-52380396 GCCCTCCAGCAGGCGCCTGTAGG + Exonic
1097062984 12:56299968-56299990 GCTTCCCTTCTGGCTCCTGGGGG - Intronic
1101717400 12:107322298-107322320 GGGCCCCTTCAGCCTCCTCTGGG + Intronic
1101824087 12:108207244-108207266 GCTCACCTTCAGGCTCCAGGTGG + Intronic
1102039722 12:109793025-109793047 GCATCACTTCAGGATCCTGTGGG - Intronic
1102875388 12:116444914-116444936 GCCTCTCTTCTGGCTCCTGGTGG - Intergenic
1103887802 12:124215934-124215956 GCCTCCCTTCTAGCTCCTGGGGG + Intronic
1104706260 12:130949730-130949752 GCCTCCCCTCCGGCTCCTGTCGG - Intergenic
1113339136 13:109404757-109404779 GCCCCCCTTCAGGCTAGGGAGGG + Intergenic
1113416370 13:110131613-110131635 GCCCCCCATCCAGCCCCTGTTGG + Intergenic
1113437980 13:110307679-110307701 GCCTCCCGTTAGGCCCCTGTGGG - Intronic
1113826545 13:113259425-113259447 GATCCCCATCAGGTTCCTGTTGG + Intronic
1115634394 14:35277360-35277382 GCTCCCCTCCTGCCTCCTGTAGG - Intronic
1118063591 14:62166859-62166881 CTCACCCTTCAGTCTCCTGTTGG + Intergenic
1118637391 14:67760343-67760365 ACCCCCCTTCAGTGTCCTGTAGG + Intronic
1120916047 14:89711305-89711327 GCCCTCCTCAGGGCTCCTGTGGG + Intergenic
1121551484 14:94805839-94805861 GCCCTACTTCAGGCTTCTTTAGG - Intergenic
1121738345 14:96234403-96234425 ACCCTCCCTCAGGCTCCTGCTGG + Intronic
1122121209 14:99554424-99554446 GTCCCTCTGCAGGCTCCTGCAGG + Intronic
1122476150 14:102010799-102010821 GCTGCTCTTCAGCCTCCTGTCGG + Exonic
1122978617 14:105181274-105181296 GCCCGCCCGAAGGCTCCTGTCGG - Exonic
1123043433 14:105499826-105499848 GGCCACCTCCAGGCTCCTGCCGG + Intergenic
1123933532 15:25183218-25183240 GCCCCCCTTCAGGCTCGAAGAGG - Intergenic
1123948804 15:25251659-25251681 ACCCCCCATCAGGCTCCAGGAGG - Intergenic
1125722733 15:41852967-41852989 GCCGCCCTTCCAGCTCCTGCAGG + Exonic
1133384297 16:5356212-5356234 GCCTCCCTCCTGGCTCCTGGTGG - Intergenic
1134075355 16:11287136-11287158 GTCTCCCTTTAGGCTCCTCTGGG + Intronic
1134317734 16:13134875-13134897 CCACCCCTTCAGCCACCTGTGGG + Intronic
1139857091 16:69989982-69990004 GCTCCTCTTCTGGCTCCTGCTGG - Intergenic
1141162502 16:81638733-81638755 GCCCCAGTTCAGCCTCCTGTGGG + Intronic
1142178545 16:88656210-88656232 GCCCCCATACAGGCTCCGGCAGG + Exonic
1142668282 17:1474893-1474915 GCCTCCCCGCAGGCCCCTGTGGG + Intronic
1142671335 17:1488687-1488709 GACACCGTTCAGGCCCCTGTCGG + Intronic
1142812972 17:2404394-2404416 GGCCATTTTCAGGCTCCTGTAGG - Intergenic
1143377852 17:6477990-6478012 GCTCCCCTTCCGGCTGCTGCTGG + Exonic
1143434744 17:6915098-6915120 GCCACCCTCCAGGCTGGTGTTGG - Intronic
1143478233 17:7215037-7215059 TGCCCCCTGCAGGCTCCTCTTGG + Intronic
1144855419 17:18264737-18264759 GCAGCCCCTCGGGCTCCTGTAGG - Exonic
1145774436 17:27518146-27518168 TCCCTCCTTCAGACTCCTTTTGG - Intronic
1145797234 17:27662791-27662813 GCACCACTTCAGGCTCGTGCAGG - Intergenic
1146841824 17:36161696-36161718 GCACCACTTCAGGCTCATGCAGG + Intergenic
1146841983 17:36162572-36162594 GCACCACTTCAGGCTCATGCAGG - Intergenic
1146854133 17:36249656-36249678 GCACCACTTCAGGCTCATGCAGG + Intronic
1146854294 17:36250532-36250554 GCACCACTTCAGGCTCATGCAGG - Intronic
1146870037 17:36373548-36373570 GCACCACTTCAGGCTCATGCAGG + Intronic
1146870197 17:36374424-36374446 GCACCACTTCAGGCTCATGCAGG - Intronic
1146877394 17:36424629-36424651 GCACCACTTCAGGCTCATGCAGG + Intronic
1146877554 17:36425505-36425527 GCACCACTTCAGGCTCATGCAGG - Intronic
1147072918 17:37974172-37974194 GCACCACTTCAGGCTCATGCAGG + Intergenic
1147073078 17:37975048-37975070 GCACCACTTCAGGCTCATGCAGG - Intergenic
1147084440 17:38053710-38053732 GCACCACTTCAGGCTCATGCAGG + Intronic
1147084600 17:38054586-38054608 GCACCACTTCAGGCTCATGCAGG - Intronic
1147100387 17:38177676-38177698 GCACCACTTCAGGCTCATGCAGG + Intergenic
1147100547 17:38178552-38178574 GCACCACTTCAGGCTCATGCAGG - Intergenic
1147211624 17:38875362-38875384 GCACCACTTCAGGGGCCTGTGGG + Intronic
1147323285 17:39658630-39658652 GCTCCCCCTCAGGCTACTGGAGG - Intronic
1147652785 17:42071804-42071826 GCTCCCCTTCTGGGTCCTATGGG - Intergenic
1148102132 17:45098687-45098709 GCTCCCCATCTGGCTCCTGCAGG - Intronic
1149375065 17:56035540-56035562 GACCTGCTTCAGGCTACTGTTGG - Intergenic
1150083329 17:62260723-62260745 GCACCACTTCAGGCTCATGCAGG + Intergenic
1150083486 17:62261598-62261620 GCACCACTTCAGGCTCATGCAGG - Intergenic
1151786087 17:76275743-76275765 GCCCCCTTTCCTGCTCATGTAGG - Intronic
1153706893 18:7754998-7755020 TCTCCTCTTCAGGCTCCTGCCGG + Intronic
1160354572 18:78216116-78216138 GGGCCCCTGCGGGCTCCTGTGGG + Intergenic
1161104585 19:2437029-2437051 GCCTCCCCTCTGGCTCCTGTGGG + Intronic
1161478483 19:4498987-4499009 GGCCCCCAGCAGGTTCCTGTCGG + Intronic
1164715614 19:30388384-30388406 GCCCCCATTAAGGCTTCTGGAGG - Intronic
1165154825 19:33780666-33780688 GACCCTCTTCAGCCTCCTCTGGG + Intergenic
1165445734 19:35856105-35856127 GCCCTCCTTCAGGCTGCTCGGGG + Intronic
1166931308 19:46303344-46303366 GCCCCTCTTAGGGCCCCTGTTGG + Intronic
1167443574 19:49524508-49524530 GCCCCCCTCCATGCGCCTGAAGG + Exonic
1167716087 19:51143655-51143677 GCCCCTCTCCAGCCCCCTGTGGG + Intronic
1167757375 19:51421293-51421315 GCCGCTCTCCTGGCTCCTGTCGG - Intergenic
1167846737 19:52171080-52171102 GCCCGCCGTCCGGCTCCTGAAGG - Intronic
1168519558 19:57037533-57037555 GCTCTCCCTCTGGCTCCTGTTGG - Intergenic
926200539 2:10793202-10793224 GCCTACCTTCCGTCTCCTGTAGG - Exonic
932359449 2:71092425-71092447 GCCCCCATGCAGGATCCAGTGGG - Intergenic
932563803 2:72893357-72893379 GCCCCTATTCAGCCTCCTGGAGG + Intergenic
933274204 2:80266411-80266433 GGCTCCCTTCAGACGCCTGTGGG + Intronic
933851307 2:86368726-86368748 TCCCCCATGCTGGCTCCTGTGGG - Intergenic
934183607 2:89650701-89650723 GCCAGCCCTCAGGCTCCTGGTGG + Intergenic
935497611 2:103801436-103801458 GCCCCCCTTGATCCTCTTGTTGG + Intergenic
937263629 2:120602022-120602044 GCCTCCCTGCAGGCTCCTGAGGG + Intergenic
937326872 2:120994827-120994849 CCCCCACATCAGGCTGCTGTAGG + Intergenic
937687289 2:124712173-124712195 ACCTCCCTTCAGACTCATGTTGG + Intronic
938408520 2:131045813-131045835 CCCCCTCTTCAGGCTGCTGCAGG + Intronic
945169036 2:206976677-206976699 GCTTCCCTTCTGGCTTCTGTAGG - Intergenic
945723113 2:213443893-213443915 ACTCCAATTCAGGCTCCTGTAGG + Intronic
946516676 2:220419465-220419487 GCCGCACTCCAGGCTCTTGTGGG + Intergenic
947385395 2:229585908-229585930 ACCCCCCTTCAGGCTTCAGGGGG - Exonic
948383738 2:237568572-237568594 GCCCCCCTTCCTGTTCCTGCAGG - Intergenic
948640374 2:239372108-239372130 GCTCCCCATCAGGTTCCTATGGG - Intronic
948949030 2:241236944-241236966 GCCCTCTTTGAGGCTGCTGTGGG - Intronic
1168941201 20:1712735-1712757 GCCACACTCCAGGCTCATGTTGG - Intergenic
1169091205 20:2862376-2862398 GCCCCCCTAAAGGCAGCTGTGGG + Intronic
1169386625 20:5155517-5155539 GTCTCCCTTCTGGCTTCTGTTGG + Intronic
1171179851 20:23084500-23084522 CCCCACCTGCAGGCTCCTGGGGG + Exonic
1172776934 20:37413415-37413437 GCCCCCCTGCACCCTCCTGCGGG + Intergenic
1173838333 20:46140030-46140052 GCACACCCACAGGCTCCTGTTGG + Intergenic
1175068682 20:56312869-56312891 CCCTGCCTTCAGGCTCCTCTAGG + Intergenic
1175872741 20:62216137-62216159 AACCTCCTTCTGGCTCCTGTGGG - Exonic
1176038454 20:63051793-63051815 GCCCTCCATCGGGATCCTGTGGG + Intergenic
1176161556 20:63651355-63651377 GCCTGACTGCAGGCTCCTGTTGG + Intronic
1176415983 21:6475060-6475082 GCCACCCCTCAGGCTCCTCCTGG - Intergenic
1179558036 21:42193184-42193206 GCCCCCCTGGAGCCTCCTGCGGG - Intergenic
1179691483 21:43083394-43083416 GCCACCCCTCAGGCTCCTCCTGG - Intergenic
1180786386 22:18549996-18550018 GCCCCGCCCCAGGCTCCTGTCGG - Intergenic
1180847524 22:18992107-18992129 CTCCCCCTTCAGCCCCCTGTGGG + Intergenic
1181848204 22:25730162-25730184 CCCCTCCTTCTGGCTCCTGAGGG - Intergenic
1182475074 22:30572826-30572848 GCCCGGCTGCAGGCTCCTGAAGG - Intronic
1184723213 22:46328167-46328189 GCGCCCGTGCAGGGTCCTGTGGG + Intronic
1185131810 22:49043654-49043676 GCCCTCCCCCAGGTTCCTGTGGG + Intergenic
1185315707 22:50178325-50178347 GCCCCCCTCCTGGCTCCGGGAGG - Exonic
950508561 3:13411666-13411688 CCCCACCATCAGGCTCCTCTTGG + Intronic
953758000 3:45664490-45664512 GCCCTCCTGTAGGTTCCTGTAGG - Intronic
954226955 3:49188356-49188378 GCACCCCTTCAGGTCCCTCTGGG + Intronic
954422791 3:50427352-50427374 GACCCCCAGCTGGCTCCTGTGGG + Intronic
955349097 3:58180807-58180829 GCCCACCTTCATGCTTCTGCAGG + Intergenic
962438507 3:135389511-135389533 GCCTCCCTCCTGGCTCCTGCTGG - Intergenic
962505134 3:136039105-136039127 GGTACTCTTCAGGCTCCTGTGGG + Intronic
968518128 4:1023384-1023406 GCCCCCATTCTGGCTCCGGGGGG - Intronic
970015430 4:11507479-11507501 GCCCCCCTTCAGCTTCCTTGTGG + Intergenic
970232274 4:13922991-13923013 GCCTCCCTTCTGGCTTCTGGTGG + Intergenic
971406219 4:26322108-26322130 GCCCCCCTCCTGGTTCCTGACGG + Intronic
972312149 4:37891377-37891399 GCCACCCTGCTGGCTCCTCTCGG + Intronic
986402276 5:7394217-7394239 GTCCCCCTGAAGCCTCCTGTAGG - Intergenic
990582217 5:57175316-57175338 GCCCTTTTCCAGGCTCCTGTAGG + Intronic
993204304 5:84860899-84860921 TCCCCATCTCAGGCTCCTGTTGG - Intergenic
994507192 5:100657186-100657208 GCCCCCCTGCAGGATCCACTGGG + Intergenic
995713319 5:115056419-115056441 ACCCCCATTCAGCCTCCTGCAGG - Intergenic
997596020 5:135107954-135107976 GCCACCCTTGAGGGTCCTGCGGG + Intronic
999153858 5:149444062-149444084 GCCCCCTTTCAGGCAGCTGAAGG - Intergenic
1002886187 6:1296441-1296463 TCCCTCCTTCAGTCTCCTGATGG - Intergenic
1004866435 6:19857460-19857482 GCCTCCTTCCAGGCCCCTGTGGG - Intergenic
1005889860 6:30127958-30127980 GCTCCCCTTAGGGCTCCTGTTGG + Intergenic
1007341636 6:41194414-41194436 GCCCTCCATCAGGTACCTGTGGG - Exonic
1007476756 6:42124387-42124409 GTCCCCTGGCAGGCTCCTGTAGG + Intronic
1010637824 6:78282736-78282758 GCCCCACTCCAGGCTGGTGTTGG + Intergenic
1011702664 6:89970127-89970149 GCCCACCTTCTTTCTCCTGTTGG - Intronic
1012848330 6:104418059-104418081 GACCCCCTTCACTCTCCTGTTGG - Intergenic
1017401566 6:154070213-154070235 GCCTCCCACCAGGCTCGTGTGGG + Intronic
1018225151 6:161621536-161621558 GGCCCCATTCAGGCTCCTGGGGG - Intronic
1019143998 6:169965129-169965151 CTGCCCCTGCAGGCTCCTGTGGG - Intergenic
1019778259 7:2925133-2925155 GCCCTGCTTCAGGCCCCTGCGGG - Intronic
1022634501 7:32119332-32119354 GCCTCACTTCAGGCTCCTGTTGG + Intronic
1030306657 7:108026037-108026059 TCCATCCCTCAGGCTCCTGTGGG + Intronic
1032193717 7:129778480-129778502 CCGCCCCTTCATGCTCCTGCGGG - Intergenic
1032429673 7:131850398-131850420 GTCCCCCTTCTGGCTTCTGGTGG + Intergenic
1033875864 7:145817880-145817902 ACCCCCCTACAGGCTGCTGCGGG + Intergenic
1033941249 7:146657427-146657449 GCCTCCCTTCAGGTACCTGGTGG + Intronic
1034823329 7:154237146-154237168 GCCCCTCCTCTGGCTGCTGTTGG - Intronic
1035361023 7:158314575-158314597 GCCGCCCTGGAGGCTCCCGTGGG + Intronic
1035463689 7:159062126-159062148 GCCCCCCATCAAGTCCCTGTTGG - Intronic
1035874458 8:3172636-3172658 GCCCCCCTTAAGTGTCCTGTAGG - Intronic
1039848397 8:41342351-41342373 GCCTCCTTTCAGGCCACTGTGGG + Intergenic
1039917624 8:41871595-41871617 GCCCCTCTCCTGGCTCCTGGTGG - Intronic
1040864464 8:52034194-52034216 GCCCATCTGCAGGCTCCCGTTGG + Intergenic
1041299283 8:56393915-56393937 GCTCCCCTTCATGGTCCTGTAGG + Intergenic
1045193914 8:99910921-99910943 GCCCGCCTTCAGCCTCGGGTGGG - Intergenic
1045484191 8:102617827-102617849 ACCCTCGTTCAGGTTCCTGTGGG - Intergenic
1048252911 8:132882072-132882094 GCCCCCTGCCAGGCTGCTGTGGG + Intronic
1048444456 8:134482889-134482911 GGTCCCCTGCAGCCTCCTGTTGG + Intronic
1050243000 9:3658303-3658325 GCCCATCTTCAGGTTCCTGAAGG + Intergenic
1052956791 9:34258715-34258737 ACCCCCTTTCAGGCTTCTCTAGG + Intronic
1056512004 9:87315208-87315230 ACCCTCCTCCAGGCGCCTGTGGG + Intergenic
1057131298 9:92656191-92656213 GCCCTCCTGAAGGCTCCTGCTGG - Intronic
1057221201 9:93258951-93258973 GCCCCCCATCACGCCCCTGGCGG + Exonic
1059397902 9:114050017-114050039 GCTCGCCTTCTGGCTCCTGGCGG + Exonic
1060510568 9:124229107-124229129 GCCACCCTTCAGCCTCCGGGAGG - Intergenic
1060820921 9:126661318-126661340 GGCCCCCTTCAAGGCCCTGTTGG + Intronic
1061278214 9:129581683-129581705 GCCTCCCTCCTGGGTCCTGTGGG + Intergenic
1061362052 9:130149827-130149849 GGCCCCCTTCAGGCCCATCTGGG + Intergenic
1187325915 X:18287879-18287901 TCCCCCCTTCAGCCTCATGGGGG + Intronic
1187463128 X:19505209-19505231 GCCCCCCTCTATGCTGCTGTGGG - Intronic
1187777328 X:22776182-22776204 ACCCTGATTCAGGCTCCTGTTGG + Intergenic
1191936829 X:66436067-66436089 GCTCCTCTTCAGGATCCTCTAGG + Intergenic
1192528298 X:71866840-71866862 TCTCCCCTTCAGGCTCCAGCTGG - Intergenic
1195259996 X:103122529-103122551 GCCCCAGTGCAGGCTCCTGGGGG - Intergenic
1195524005 X:105865009-105865031 GCCCCCCTTCAGGCTCCTGTTGG + Intronic