ID: 1195540718

View in Genome Browser
Species Human (GRCh38)
Location X:106059531-106059553
Sequence AGAGAGAGCCCAAAGGCTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195540718_1195540722 16 Left 1195540718 X:106059531-106059553 CCACGAGCCTTTGGGCTCTCTCT No data
Right 1195540722 X:106059570-106059592 TTTATGCTAACCACATGACTAGG No data
1195540718_1195540721 -7 Left 1195540718 X:106059531-106059553 CCACGAGCCTTTGGGCTCTCTCT No data
Right 1195540721 X:106059547-106059569 TCTCTCTTGGTGTTTTGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195540718 Original CRISPR AGAGAGAGCCCAAAGGCTCG TGG (reversed) Intergenic
No off target data available for this crispr