ID: 1195541595

View in Genome Browser
Species Human (GRCh38)
Location X:106068638-106068660
Sequence TCCCAGAGACATAGTGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195541590_1195541595 1 Left 1195541590 X:106068614-106068636 CCTTTCTAGTTCAATTCACCCAT No data
Right 1195541595 X:106068638-106068660 TCCCAGAGACATAGTGGGCCAGG No data
1195541585_1195541595 30 Left 1195541585 X:106068585-106068607 CCAGAGGCCCATAGCAAAAATGG No data
Right 1195541595 X:106068638-106068660 TCCCAGAGACATAGTGGGCCAGG No data
1195541589_1195541595 22 Left 1195541589 X:106068593-106068615 CCATAGCAAAAATGGGTTACTCC No data
Right 1195541595 X:106068638-106068660 TCCCAGAGACATAGTGGGCCAGG No data
1195541588_1195541595 23 Left 1195541588 X:106068592-106068614 CCCATAGCAAAAATGGGTTACTC No data
Right 1195541595 X:106068638-106068660 TCCCAGAGACATAGTGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195541595 Original CRISPR TCCCAGAGACATAGTGGGCC AGG Intergenic
No off target data available for this crispr