ID: 1195548743

View in Genome Browser
Species Human (GRCh38)
Location X:106142276-106142298
Sequence GTTATACTGATACCAAAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195548741_1195548743 0 Left 1195548741 X:106142253-106142275 CCAACTCATTCTATGAAGCCAGC 0: 17
1: 186
2: 459
3: 662
4: 890
Right 1195548743 X:106142276-106142298 GTTATACTGATACCAAAACCTGG No data
1195548738_1195548743 5 Left 1195548738 X:106142248-106142270 CCTCCCCAACTCATTCTATGAAG 0: 7
1: 260
2: 1694
3: 10762
4: 5231
Right 1195548743 X:106142276-106142298 GTTATACTGATACCAAAACCTGG No data
1195548740_1195548743 1 Left 1195548740 X:106142252-106142274 CCCAACTCATTCTATGAAGCCAG 0: 195
1: 1992
2: 11459
3: 6645
4: 4012
Right 1195548743 X:106142276-106142298 GTTATACTGATACCAAAACCTGG No data
1195548739_1195548743 2 Left 1195548739 X:106142251-106142273 CCCCAACTCATTCTATGAAGCCA 0: 19
1: 353
2: 1934
3: 11150
4: 5166
Right 1195548743 X:106142276-106142298 GTTATACTGATACCAAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195548743 Original CRISPR GTTATACTGATACCAAAACC TGG Intergenic
No off target data available for this crispr