ID: 1195554005

View in Genome Browser
Species Human (GRCh38)
Location X:106200756-106200778
Sequence ACAGAATTGCCGGCCGGGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1280
Summary {0: 1, 1: 2, 2: 19, 3: 157, 4: 1101}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195553997_1195554005 22 Left 1195553997 X:106200711-106200733 CCCCTCACATTGAATCACCCAAG 0: 1
1: 0
2: 1
3: 13
4: 133
Right 1195554005 X:106200756-106200778 ACAGAATTGCCGGCCGGGCGCGG 0: 1
1: 2
2: 19
3: 157
4: 1101
1195554001_1195554005 4 Left 1195554001 X:106200729-106200751 CCAAGTGAAAACAACAAAACATA 0: 1
1: 0
2: 7
3: 77
4: 785
Right 1195554005 X:106200756-106200778 ACAGAATTGCCGGCCGGGCGCGG 0: 1
1: 2
2: 19
3: 157
4: 1101
1195553998_1195554005 21 Left 1195553998 X:106200712-106200734 CCCTCACATTGAATCACCCAAGT 0: 1
1: 0
2: 2
3: 11
4: 126
Right 1195554005 X:106200756-106200778 ACAGAATTGCCGGCCGGGCGCGG 0: 1
1: 2
2: 19
3: 157
4: 1101
1195553999_1195554005 20 Left 1195553999 X:106200713-106200735 CCTCACATTGAATCACCCAAGTG 0: 1
1: 0
2: 0
3: 5
4: 110
Right 1195554005 X:106200756-106200778 ACAGAATTGCCGGCCGGGCGCGG 0: 1
1: 2
2: 19
3: 157
4: 1101
1195554000_1195554005 5 Left 1195554000 X:106200728-106200750 CCCAAGTGAAAACAACAAAACAT 0: 1
1: 0
2: 3
3: 94
4: 1083
Right 1195554005 X:106200756-106200778 ACAGAATTGCCGGCCGGGCGCGG 0: 1
1: 2
2: 19
3: 157
4: 1101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195554005 Original CRISPR ACAGAATTGCCGGCCGGGCG CGG Intronic
900015883 1:149385-149407 AAAGAAATGGAGGCCGGGCGTGG + Intergenic
900046147 1:507982-508004 AAAGAAATGGAGGCCGGGCGTGG + Intergenic
900068349 1:749694-749716 AAAGAAATGGAGGCCGGGCGTGG + Intergenic
900265494 1:1755107-1755129 ACAGAAGTGTCGGCCGGGCGCGG - Intronic
900278667 1:1850977-1850999 ACATACTGGCCGGCCAGGCGCGG + Intronic
901076272 1:6556690-6556712 AAAGAAAAGCAGGCCGGGCGCGG - Intronic
901581188 1:10244900-10244922 AGAAAAATGGCGGCCGGGCGCGG - Intronic
901625373 1:10621633-10621655 AAAGAATTCTTGGCCGGGCGCGG - Intronic
901698963 1:11033036-11033058 AAAATATTGTCGGCCGGGCGCGG + Intronic
902900024 1:19508449-19508471 AAAGAATGGTTGGCCGGGCGCGG + Intergenic
903397892 1:23016192-23016214 AAAGAATTCCTGGCCGGGTGTGG - Intergenic
903482435 1:23663719-23663741 AAGAAATTGCAGGCCGGGCGCGG + Intergenic
903785799 1:25860444-25860466 ACAAAATTTTTGGCCGGGCGCGG - Intergenic
903894831 1:26596441-26596463 ACAGGGTGGCTGGCCGGGCGGGG - Intergenic
904158740 1:28506473-28506495 ACATGATTTCCGGCCAGGCGCGG - Intronic
904244289 1:29175403-29175425 AAAAAATTTCCGGCCGGGCGTGG + Intronic
904544077 1:31254650-31254672 TCAGAATCTCTGGCCGGGCGCGG - Intergenic
905091488 1:35434375-35434397 ATAGAAATGATGGCCGGGCGCGG - Exonic
905611104 1:39352420-39352442 ACAGAAGTGCCGGACTGGCTTGG - Intronic
905613612 1:39377300-39377322 ACAAAATAGTTGGCCGGGCGCGG - Intronic
905782217 1:40721878-40721900 TAAGAATTGAAGGCCGGGCGCGG + Intronic
905793438 1:40802387-40802409 AAAAAGTAGCCGGCCGGGCGGGG + Intronic
905918048 1:41699518-41699540 ACAGAATTGCTGCCCAGGAGGGG + Intronic
905937655 1:41837614-41837636 ACAAAAGAGCAGGCCGGGCGTGG - Intronic
906036001 1:42750705-42750727 ACAGGGCGGCCGGCCGGGCGGGG - Intronic
906400924 1:45504121-45504143 ACAGGCTTGCTGGCCGGGCACGG + Intronic
906473097 1:46147393-46147415 ACAGAGTTCCTGGCCGGGCGTGG - Intronic
906487944 1:46246248-46246270 AAAGAATTCTGGGCCGGGCGCGG - Intergenic
906633886 1:47395295-47395317 ATAGAATTGTTGGCCGGGCACGG - Intergenic
906742108 1:48192891-48192913 ACAGGGTGGCTGGCCGGGCGGGG - Intergenic
907042702 1:51277703-51277725 ATAAGAATGCCGGCCGGGCGCGG - Intergenic
907179800 1:52559589-52559611 ATAGAATTACCGGCTGGGTGTGG + Intergenic
907216599 1:52869936-52869958 ACAGGGTGGCTGGCCGGGCGGGG + Intronic
907431216 1:54413002-54413024 AAAAAATTGCAGGCCAGGCGCGG - Intronic
907434777 1:54437943-54437965 ACATGATTGGTGGCCGGGCGTGG - Intergenic
908244823 1:62219446-62219468 AAAGAATAGCCTGCCGGGCGTGG + Intergenic
908296937 1:62721848-62721870 AAGAAATTGGCGGCCGGGCGTGG + Intergenic
908306740 1:62826524-62826546 AGGGAATGGTCGGCCGGGCGTGG - Intronic
908616102 1:65924362-65924384 AAAAAATTAGCGGCCGGGCGCGG - Intronic
908833439 1:68204595-68204617 AAAATATTTCCGGCCGGGCGCGG - Intronic
909143547 1:71898323-71898345 ACTGCTTTGCTGGCCGGGCGCGG + Intronic
909639635 1:77858058-77858080 ACAGTATTGCTGGCCAGACGCGG + Intronic
909782524 1:79564168-79564190 CAAGATTTGCAGGCCGGGCGCGG + Intergenic
909783336 1:79577313-79577335 AAAGATTTCTCGGCCGGGCGCGG - Intergenic
910255443 1:85242696-85242718 AAAGAATTCTTGGCCGGGCGTGG - Intergenic
910499226 1:87870590-87870612 AAATAATTGTCGGCCGGGCGCGG + Intergenic
911065671 1:93785901-93785923 ATAAAAGTGCCGGCCGGGCGCGG + Intronic
911152099 1:94605760-94605782 ACAGGGTTGCCGGCCGGGCTCGG - Intergenic
911364443 1:96919761-96919783 AATAAATTCCCGGCCGGGCGCGG - Intergenic
911624168 1:100102384-100102406 ACGGAAAGGCTGGCCGGGCGTGG + Intronic
911836893 1:102630818-102630840 ACATTATTACTGGCCGGGCGCGG - Intergenic
911873344 1:103127864-103127886 ACAAAGTTACAGGCCGGGCGCGG + Intergenic
911933214 1:103931727-103931749 TAAGAATTCACGGCCGGGCGCGG - Intergenic
912335750 1:108861111-108861133 ACATATTTGTAGGCCGGGCGTGG + Intronic
912356364 1:109057345-109057367 ACACCATTTCCGGCCGGGCATGG + Intergenic
912668878 1:111607617-111607639 ACAGGGTGGCTGGCCGGGCGGGG + Intronic
913454420 1:119016457-119016479 TAAGAATTACTGGCCGGGCGCGG - Intergenic
913536622 1:119779024-119779046 TAAGAATTCCAGGCCGGGCGCGG - Intergenic
913676946 1:121149851-121149873 AAAGAATTGGAGGCCGGGCGCGG + Intergenic
914027185 1:143923271-143923293 ACAAAGTAGACGGCCGGGCGCGG + Intergenic
914147531 1:145009296-145009318 ACAAAACTGGCGGCCGGGCGCGG + Intronic
914193755 1:145432736-145432758 ACAAAATAGAAGGCCGGGCGCGG - Intergenic
914201371 1:145488216-145488238 AAAGAATTTACCGCCGGGCGCGG - Intergenic
914221655 1:145687227-145687249 ATAAAATTGCTGGCCGAGCGTGG + Intronic
914302072 1:146386085-146386107 ACAGAATTGGGGGCGGGGGGGGG - Intergenic
914480492 1:148061343-148061365 AAAGAATTTACCGCCGGGCGCGG - Intergenic
914896262 1:151676594-151676616 ACAAAATTCCTGGCCGGGCGTGG - Intronic
915258466 1:154655357-154655379 ACTTAATTACTGGCCGGGCGCGG + Intergenic
915428726 1:155848855-155848877 ACGGAATTGTAGGTCGGGCGCGG + Intronic
915464226 1:156086929-156086951 ATATAATTCCTGGCCGGGCGCGG - Intronic
916589573 1:166177182-166177204 AAATAATTGCAGGCCAGGCGTGG - Intergenic
916718038 1:167461557-167461579 AGAAAATAGTCGGCCGGGCGTGG + Intronic
917552536 1:176048880-176048902 AAAGAATTAAGGGCCGGGCGCGG + Intronic
917771595 1:178285408-178285430 GTAGCAATGCCGGCCGGGCGCGG - Intronic
917848229 1:179040337-179040359 ACGGGGTGGCCGGCCGGGCGGGG + Intronic
917973166 1:180221371-180221393 ACATAAGTGGTGGCCGGGCGTGG - Intergenic
918312632 1:183296138-183296160 AATGAGCTGCCGGCCGGGCGCGG - Intronic
918361879 1:183767660-183767682 AAAGAATTGCTGGCCGGGTATGG + Intronic
918676389 1:187291100-187291122 AAAGATTTAACGGCCGGGCGCGG + Intergenic
918732041 1:188011095-188011117 AAAGAAATGCCGGCCGGGCGCGG - Intergenic
919329268 1:196148222-196148244 GAAATATTGCCGGCCGGGCGCGG - Intergenic
919480699 1:198085305-198085327 AAAAAATTGTCGGCCGGGCTCGG + Intergenic
919994997 1:202740334-202740356 ACGGGGTGGCCGGCCGGGCGGGG + Intronic
920091930 1:203460564-203460586 TATGAATTGTCGGCCGGGCGCGG + Intergenic
920339383 1:205266298-205266320 ACATAATTTTGGGCCGGGCGCGG + Intronic
920577038 1:207069033-207069055 AAAGAAATGTCGGCCGGGCACGG - Intronic
920696808 1:208187009-208187031 ATAACATTGCAGGCCGGGCGCGG - Intronic
920790726 1:209087920-209087942 ACAGATTTTCAGGCCGGGCGTGG + Intergenic
921105753 1:211976090-211976112 ACAGAAATCCTGGCCGGGTGGGG - Intronic
921173644 1:212572000-212572022 AAAGTATTGGCGGCCGGGCGCGG - Intronic
921234326 1:213109425-213109447 ACAGAATATCGGGCCGGGCACGG - Intronic
921385406 1:214563702-214563724 AAAAAATTTCCTGCCGGGCGTGG - Intergenic
921656439 1:217744170-217744192 AAAGAATTTTCGGCCGGGCGCGG + Intronic
921729916 1:218566399-218566421 AAAGGATTGTCGACCGGGCGTGG + Intergenic
922047849 1:221964241-221964263 ATCAAATTGCCGGCCGGGCGCGG + Intergenic
922103711 1:222495079-222495101 AAAGAAATGGAGGCCGGGCGTGG + Intergenic
922264027 1:223967596-223967618 AAAGAAATGGAGGCCGGGCGTGG + Intergenic
922292692 1:224221777-224221799 AGAGACATGTCGGCCGGGCGCGG - Intergenic
922490953 1:226016106-226016128 ATACAATTGCAGGCTGGGCGTGG - Intergenic
922625465 1:227036718-227036740 ACTGAATTGAAGGCCGGGCGCGG - Intronic
922855456 1:228771433-228771455 AGAGAAAGGCAGGCCGGGCGCGG + Intergenic
923413064 1:233729399-233729421 ACAGGGCTGGCGGCCGGGCGCGG + Intergenic
923637772 1:235718152-235718174 AAAAAATTGCAGGCCAGGCGTGG - Intronic
923830378 1:237549282-237549304 ACAGTATTTCTGGCTGGGCGGGG + Intronic
923848013 1:237759374-237759396 ACAGCATTACAGGCTGGGCGTGG - Intronic
924238783 1:242021723-242021745 ACAGACTTTCCAGCTGGGCGTGG - Intergenic
924345875 1:243072591-243072613 AAAGAAATGGAGGCCGGGCGTGG + Intergenic
924745747 1:246832239-246832261 GTAGAAATGCTGGCCGGGCGCGG + Intergenic
1063901047 10:10732812-10732834 AAAGAATTGGAGGCTGGGCGTGG - Intergenic
1064033884 10:11900182-11900204 ACTGAATGGCCGGCCGGGCCTGG - Intergenic
1064050384 10:12054736-12054758 ATAGAACTGCCAGCAGGGCGCGG - Intergenic
1064134018 10:12735184-12735206 ACGAAAGTGTCGGCCGGGCGCGG + Intronic
1064211532 10:13364182-13364204 AAAAAATTTCTGGCCGGGCGCGG + Intergenic
1064253366 10:13724096-13724118 AGAGATTTGTCAGCCGGGCGCGG + Intronic
1064460679 10:15532138-15532160 TCAAAGATGCCGGCCGGGCGTGG + Intronic
1064880301 10:20044598-20044620 AAAGAATTGCAGGCTGGACGCGG - Intronic
1065211702 10:23410362-23410384 AAAGAATGCCAGGCCGGGCGCGG + Intergenic
1066530399 10:36331927-36331949 ACATGATTTCTGGCCGGGCGCGG + Intergenic
1066597637 10:37068891-37068913 AAAGAAATACTGGCCGGGCGCGG - Intergenic
1066952943 10:42138390-42138412 ACAGGGTGGCTGGCCGGGCGGGG - Intergenic
1067763748 10:49069960-49069982 AAAGAAATATCGGCCGGGCGCGG + Intronic
1068539122 10:58271328-58271350 AAAAAATAGTCGGCCGGGCGCGG - Intronic
1068702460 10:60034394-60034416 ACAGAATTTCAGGCTGGGCATGG - Intronic
1068832208 10:61508372-61508394 AAATAATGGCAGGCCGGGCGTGG + Intergenic
1068882756 10:62067371-62067393 ACAGAAGTTCTGGCCGGGCATGG - Intronic
1068979217 10:63043937-63043959 AAAAAACTGTCGGCCGGGCGCGG + Intergenic
1069438139 10:68405022-68405044 AAAAAATTTCCGGCCAGGCGCGG + Intronic
1069516062 10:69078184-69078206 ACAGTATTTCTGGCCGGGCATGG - Intergenic
1069545390 10:69324298-69324320 AAATATTTGCTGGCCGGGCGTGG + Intronic
1070069980 10:73078900-73078922 AGAAAATTACCAGCCGGGCGCGG - Intronic
1070193514 10:74133941-74133963 ACTGAAGTCCTGGCCGGGCGCGG - Intronic
1070193940 10:74139489-74139511 AAACAATTTCAGGCCGGGCGTGG + Intronic
1070199016 10:74185540-74185562 GCAGAGTCGTCGGCCGGGCGCGG + Intronic
1071034129 10:81222900-81222922 ATAGCATTGCCGGCCGGGCGTGG + Intergenic
1071297944 10:84236004-84236026 AACGTATTGCCGGCCGGGTGCGG + Intronic
1072045985 10:91655701-91655723 AAAAAATTGTTGGCCGGGCGTGG - Intergenic
1072144783 10:92625057-92625079 ACAGAAATACCGGCAGGGCATGG - Intronic
1072230213 10:93408257-93408279 AAATAAATGCTGGCCGGGCGCGG + Intronic
1072414383 10:95234585-95234607 AAAGTATTACTGGCCGGGCGTGG + Intergenic
1072467494 10:95679878-95679900 TTAGAAATGACGGCCGGGCGCGG - Intronic
1072499914 10:96003744-96003766 ACAGAATTTACGGCCCGGCATGG - Intronic
1072749642 10:97968526-97968548 AAAGAATTGCAAGCTGGGCGTGG - Intronic
1072786803 10:98288995-98289017 ATGCAATTGCAGGCCGGGCGCGG - Intergenic
1072946611 10:99816254-99816276 ACAGAGATGGAGGCCGGGCGCGG - Intronic
1073059908 10:100727420-100727442 ATAGAATTGTTGGCCGGGCGTGG - Intergenic
1073133831 10:101208250-101208272 AAACAACTACCGGCCGGGCGTGG + Intergenic
1073253617 10:102137046-102137068 AAATAAGTGTCGGCCGGGCGTGG + Intronic
1073276217 10:102313851-102313873 ACACAATTGCAGGCTGGGCTAGG + Intronic
1073354881 10:102846015-102846037 AGAGAATTCCTGGCCGGGCATGG + Intergenic
1073399242 10:103243232-103243254 AAATAATTTCAGGCCGGGCGTGG - Intergenic
1073410462 10:103337772-103337794 ACAAAATTAGCGGCCGGGCGCGG + Intronic
1073785420 10:106883701-106883723 ATAGATTTGAAGGCCGGGCGTGG - Intronic
1074725103 10:116300169-116300191 AAAAAATTCCCGGCCAGGCGCGG + Intergenic
1074739153 10:116467833-116467855 AAAGTAATGTCGGCCGGGCGCGG + Intronic
1074745568 10:116528801-116528823 ACCCAAATCCCGGCCGGGCGTGG - Intergenic
1075000145 10:118790907-118790929 ACATAATGGGGGGCCGGGCGCGG + Intergenic
1075843774 10:125528397-125528419 AAAGTATTTCTGGCCGGGCGTGG - Intergenic
1076359253 10:129875484-129875506 ACGAAAAAGCCGGCCGGGCGCGG - Intronic
1076972476 11:144454-144476 AAAGAAATGGAGGCCGGGCGTGG + Intergenic
1077079350 11:717586-717608 ACACAATTCCTGGCTGGGCGAGG + Intronic
1077314163 11:1909320-1909342 ACAGAAGTTGGGGCCGGGCGCGG + Intergenic
1077545830 11:3169397-3169419 ACAGGCTTGCCGGCAGTGCGGGG - Intergenic
1078265167 11:9750045-9750067 ACAGCTTTGGGGGCCGGGCGTGG + Exonic
1078470881 11:11585644-11585666 AAAGATTTTTCGGCCGGGCGCGG - Intronic
1079216785 11:18520740-18520762 ACAAAATTTCCGGCCAGGCGTGG + Intronic
1079608598 11:22401984-22402006 TTAGAAATGCAGGCCGGGCGCGG + Intergenic
1079914330 11:26349836-26349858 AAACAATTCTCGGCCGGGCGTGG - Intronic
1081465220 11:43309962-43309984 AAAAAATTGCAGGCCAGGCGCGG - Intergenic
1081909097 11:46688790-46688812 AAAGTCATGCCGGCCGGGCGCGG + Intronic
1082281319 11:50274141-50274163 ACAAAATGGAGGGCCGGGCGCGG + Intergenic
1082677013 11:56117668-56117690 AAATAATTGCCGGCCGGGCGTGG - Intergenic
1083020422 11:59501372-59501394 AAAAAATTGCCAGCCAGGCGCGG + Intergenic
1083182191 11:60994148-60994170 GCTGAATTTCTGGCCGGGCGCGG + Intronic
1083345897 11:61991839-61991861 ACAGACTTCCTGGCCGGGCATGG + Intergenic
1083362794 11:62122827-62122849 AAAGAATCTCTGGCCGGGCGCGG - Intergenic
1083453257 11:62761107-62761129 AGATAGTTGCCGACCGGGCGCGG + Intergenic
1083468389 11:62864754-62864776 AAAAAATTAGCGGCCGGGCGTGG - Intronic
1083573907 11:63775592-63775614 ACAGGATAGCCGGCTGGGAGTGG + Intergenic
1084135723 11:67179568-67179590 ACAGCATTCCAGGCCGGGTGCGG - Intronic
1084363808 11:68685040-68685062 ACATCAGAGCCGGCCGGGCGTGG + Intronic
1084382425 11:68821441-68821463 ACAAAAATGTAGGCCGGGCGCGG - Intronic
1084745582 11:71167644-71167666 ACAGGACAGCTGGCCGGGCGGGG + Intronic
1085088889 11:73692658-73692680 AAACAAATGCCTGCCGGGCGCGG + Intronic
1085097030 11:73769597-73769619 AAAAATTAGCCGGCCGGGCGTGG + Intergenic
1085137654 11:74107858-74107880 AAAAAAATGCCGGCCGGGCATGG + Intronic
1085178679 11:74513227-74513249 ACAGAATATCAGGCCGGGCGCGG + Intronic
1085214945 11:74821366-74821388 ATACAAGTGCGGGCCGGGCGCGG + Intronic
1085289772 11:75389546-75389568 AAAGCAATGACGGCCGGGCGCGG + Intergenic
1085989867 11:81828561-81828583 AAAAAGTTGCCCGCCGGGCGTGG + Intergenic
1086050821 11:82588472-82588494 ATAAAAATGCTGGCCGGGCGTGG + Intergenic
1086245032 11:84741342-84741364 AGAGCATAGGCGGCCGGGCGCGG - Intronic
1087126550 11:94633009-94633031 AAAGATTTTCCGGCCGGGCGCGG + Intergenic
1087256212 11:95957405-95957427 AAAGAATGGCAGGCCGGGCGCGG + Intergenic
1087420241 11:97913950-97913972 AAAGAAATATCGGCCGGGCGCGG - Intergenic
1087532723 11:99405597-99405619 TCTGAATTCCTGGCCGGGCGCGG + Intronic
1087544284 11:99564376-99564398 ACAGAATTGTTGGCCAGGTGTGG - Intronic
1087774262 11:102243213-102243235 AGAGAATTGCAGGCCAGGCACGG + Intergenic
1087800295 11:102496403-102496425 ACAGAATCCCACGCCGGGCGCGG + Intronic
1088025787 11:105180768-105180790 TCAGGATTGTCGGCCGGGCGCGG + Intergenic
1088389399 11:109297737-109297759 ACAAACTTCCTGGCCGGGCGCGG + Intergenic
1088874356 11:113921465-113921487 AGAAAATTGCTGGCCGGGCGTGG + Intronic
1088969681 11:114761862-114761884 AGAGGCTTGGCGGCCGGGCGCGG - Intergenic
1089249436 11:117146976-117146998 AAAAAAAAGCCGGCCGGGCGTGG + Intronic
1089433889 11:118446056-118446078 AAAGATTTGCAGGCCGGGTGGGG + Intronic
1089503160 11:118944721-118944743 AAAAAATTCCTGGCCGGGCGCGG - Intronic
1089627662 11:119761910-119761932 AAGGAAATGCTGGCCGGGCGTGG - Intergenic
1089786567 11:120911525-120911547 AGAGAATTTTGGGCCGGGCGCGG - Intronic
1089819290 11:121209111-121209133 ATACAATAGCAGGCCGGGCGCGG - Intergenic
1089851653 11:121502424-121502446 ATAGAATTGTCGGCCGGGCATGG - Intronic
1090322989 11:125863229-125863251 ACGGCATGGCTGGCCGGGCGGGG - Intergenic
1090984742 11:131756293-131756315 AAAGAATTGCAGGCGGGGCGTGG + Intronic
1091297404 11:134483494-134483516 ACAGAACTTCCGGCCGGAGGGGG - Intergenic
1091297427 11:134483598-134483620 ACAGAACTTCCGGCCGGAAGGGG - Intergenic
1091350166 11:134887482-134887504 ACTGAAATGACGGCCAGGCGCGG - Intergenic
1091478309 12:799419-799441 ACAGACATGCAGGCCGGGTGCGG - Intronic
1091726733 12:2851631-2851653 ACAAATTTAGCGGCCGGGCGTGG - Intronic
1091878020 12:3952629-3952651 AAAGAATTATCGGCCGGGCGCGG - Intergenic
1091947533 12:4561864-4561886 ACAGAAGTTCTGGCCGGGCGCGG - Intergenic
1092349829 12:7747111-7747133 AAAGAAAGGCCGGGCGGGCGCGG - Intronic
1092352698 12:7768820-7768842 AGAAATATGCCGGCCGGGCGCGG - Intronic
1092570967 12:9720629-9720651 ACAGAGGTGGCGGCTGGGCGCGG - Intronic
1092584791 12:9888198-9888220 TTAGAATTGCAGGCCGGGCATGG + Intronic
1092811139 12:12272408-12272430 ACTGAAACGCTGGCCGGGCGCGG + Intergenic
1093294996 12:17379001-17379023 AAAGAGGTCCCGGCCGGGCGCGG + Intergenic
1093716583 12:22390231-22390253 ACATAATTAACGGCCAGGCGTGG + Intronic
1093973205 12:25393217-25393239 AAGGTATTGCTGGCCGGGCGTGG + Intergenic
1094130432 12:27068930-27068952 ACCGAAGTCTCGGCCGGGCGCGG - Intergenic
1094315311 12:29133046-29133068 ACAATGTTGCTGGCCGGGCGAGG - Intergenic
1094446354 12:30534936-30534958 AAAGTATTGCTGGCCGGGCACGG + Intergenic
1094766926 12:33607289-33607311 TAAGAATTGCAGGCTGGGCGAGG - Intergenic
1095304561 12:40624545-40624567 AAAAAAATGTCGGCCGGGCGCGG + Intergenic
1095539963 12:43297988-43298010 ACAGTAATGCTGGCCGGGCACGG - Intergenic
1095614591 12:44173013-44173035 AAAGATTTTGCGGCCGGGCGCGG - Intronic
1095867228 12:46985196-46985218 AAAGAAATTTCGGCCGGGCGCGG + Intergenic
1096020142 12:48317218-48317240 GAAGAATAGCTGGCCGGGCGCGG - Intergenic
1096039331 12:48500456-48500478 ACGGGACTGCTGGCCGGGCGGGG + Intergenic
1096166289 12:49427963-49427985 AAAAAATTTCAGGCCGGGCGCGG + Intronic
1096448762 12:51719784-51719806 AAAGAATTCTTGGCCGGGCGCGG + Intronic
1096631613 12:52930509-52930531 ACAGAATTGGGGGCCGGGCGTGG - Intronic
1096642175 12:53003399-53003421 AAAAAAAAGCCGGCCGGGCGCGG + Intergenic
1096722811 12:53536595-53536617 ATACAATTGCTGGCCGGGCGCGG + Intronic
1096733903 12:53637429-53637451 AAAGCTTTGCAGGCCGGGCGCGG + Intronic
1096951607 12:55479230-55479252 ACAGGGTGGCTGGCCGGGCGGGG + Intergenic
1097057695 12:56259667-56259689 AAAGCCTTCCCGGCCGGGCGCGG + Intergenic
1097097568 12:56561809-56561831 AAAGAAATGCAGGACGGGCGCGG - Intronic
1097126984 12:56783567-56783589 ACAGGACGGCTGGCCGGGCGGGG + Intronic
1097127936 12:56789382-56789404 ACAGGACGGCTGGCCGGGCGGGG + Intergenic
1098355146 12:69605572-69605594 TCACAATTACTGGCCGGGCGCGG + Intergenic
1098552695 12:71781177-71781199 ACAGTTTTTCCGGCCGGGCGCGG + Intronic
1099369652 12:81813504-81813526 AAAGAATTTCCGGCCGGACGCGG + Intergenic
1099518752 12:83631971-83631993 TAAGAAAGGCCGGCCGGGCGCGG - Intergenic
1099832034 12:87856433-87856455 ATATCATTGTCGGCCGGGCGCGG - Intergenic
1099912907 12:88854978-88855000 AAGAAATTGCCGGCCGGGCGCGG - Intergenic
1100200493 12:92293185-92293207 TAAAAATTGCCGGCCGGGCGCGG + Intergenic
1100399034 12:94211982-94212004 ATAGAAAAGACGGCCGGGCGCGG + Intronic
1100477876 12:94950579-94950601 AAATTGTTGCCGGCCGGGCGCGG - Intronic
1100480466 12:94973007-94973029 ACAGAACTGCAGCCCGGGGGTGG + Intronic
1100668799 12:96786469-96786491 ACAAAATTTCAGGCCAGGCGCGG - Intronic
1100676556 12:96874905-96874927 GCAGAGATCCCGGCCGGGCGCGG - Intronic
1100940432 12:99718188-99718210 AGAGTATTGTCGGCTGGGCGCGG - Intronic
1101081982 12:101195983-101196005 AAAGCATTACCGGCCAGGCGCGG - Intronic
1101357335 12:103992780-103992802 AGAGAACTTTCGGCCGGGCGTGG - Intronic
1101406857 12:104436436-104436458 AAAGCTTTGCTGGCCGGGCGCGG + Intergenic
1101656710 12:106727907-106727929 ACTGAATTCAGGGCCGGGCGCGG - Intronic
1101922184 12:108941953-108941975 ACAGAATTTCTTGCCGGGCGTGG - Intronic
1101978094 12:109380019-109380041 TTAAAATTGCTGGCCGGGCGTGG - Intronic
1102343221 12:112140128-112140150 ACTGAATTGGAGGCCGGGCGTGG + Intronic
1102368271 12:112358883-112358905 TAAGAACGGCCGGCCGGGCGCGG + Intronic
1103092638 12:118108223-118108245 ACTGGATGGCCGGCCAGGCGTGG - Intronic
1103124467 12:118409433-118409455 ACAGAATTTTAGGCCGGGCGTGG - Intronic
1103307004 12:119973181-119973203 ACTGAAATTCTGGCCGGGCGCGG - Intergenic
1103338354 12:120207301-120207323 ACATAACTGCCGGCCGGCCACGG - Intergenic
1103688485 12:122751869-122751891 AAAAAATTGTAGGCCGGGCGCGG + Intergenic
1103756694 12:123213147-123213169 ACAGAATGGTCAGCCAGGCGCGG - Intronic
1104430384 12:128711242-128711264 ACACAACTGCGGGCCGGGCGCGG + Intergenic
1104445351 12:128828672-128828694 ATGGAGTTGCTGGCCGGGCGTGG - Intergenic
1104560790 12:129842236-129842258 ACAGGAGTGCTGGCCGGGCGCGG - Intronic
1104751235 12:131240609-131240631 TCAGAAATTCAGGCCGGGCGCGG + Intergenic
1105016679 12:132790039-132790061 ACTAAATTACAGGCCGGGCGTGG + Intronic
1105026880 12:132854949-132854971 ACAAAATTAGCGGCCGGGCGCGG + Intronic
1105238101 13:18580141-18580163 AAAGAATTGTAGGCCGGGCGCGG - Intergenic
1105253822 13:18726326-18726348 AAAGAACTTCCGGCCGGGCGCGG - Intergenic
1105367913 13:19779696-19779718 ACAGGGTGGCTGGCCGGGCGGGG - Intronic
1105423003 13:20269759-20269781 ACACAGTTGCAGGCCAGGCGCGG + Intergenic
1105516469 13:21095222-21095244 AAAAAAATCCCGGCCGGGCGCGG - Intergenic
1105728870 13:23191893-23191915 AGGGAAGTGTCGGCCGGGCGCGG + Intronic
1106536635 13:30650284-30650306 AAAGAAATGCTGGCCGGGCATGG + Intronic
1106718113 13:32412334-32412356 AGTAAATTGCAGGCCGGGCGCGG + Intronic
1106758402 13:32844755-32844777 AAAGAATTGCCGGCTGGGCATGG - Intergenic
1107053134 13:36074210-36074232 ACAGAGAAGACGGCCGGGCGTGG + Intronic
1107081736 13:36382058-36382080 AAAGAAATGCTGGCCCGGCGTGG - Intergenic
1107253634 13:38396013-38396035 AAATTATTCCCGGCCGGGCGCGG + Intergenic
1107530761 13:41280223-41280245 AAAGGATTGTGGGCCGGGCGCGG - Intergenic
1108380081 13:49846882-49846904 AAAGAATTGCCGGCCGGGCGCGG + Intergenic
1108380249 13:49848003-49848025 ACAGTAATGCCGAGCGGGCGAGG - Intergenic
1108382465 13:49867616-49867638 ATAGAATTACCGGCCAGGTGTGG - Intergenic
1108783711 13:53868627-53868649 AATGAATTGGCGGCTGGGCGCGG - Intergenic
1109151044 13:58847539-58847561 ACAAAATCTCAGGCCGGGCGCGG - Intergenic
1110070779 13:71174377-71174399 AAAGAAAAACCGGCCGGGCGTGG + Intergenic
1110357591 13:74585931-74585953 ACAAAATTTCTGGCCAGGCGCGG + Intergenic
1110859668 13:80334075-80334097 ACTGAATTAGAGGCCGGGCGCGG + Intergenic
1111008746 13:82284211-82284233 ACAGAAATGTCGGCTGGGCACGG - Intergenic
1111443504 13:88313172-88313194 ACTGACTTGAAGGCCGGGCGCGG + Intergenic
1111724374 13:91986353-91986375 AATGTATTGGCGGCCGGGCGTGG - Intronic
1111770989 13:92595476-92595498 ATAGTATTTACGGCCGGGCGCGG + Intronic
1112514811 13:100044299-100044321 AAAGATTTCCTGGCCGGGCGCGG - Intergenic
1112524118 13:100127600-100127622 AAAGATTTGAGGGCCGGGCGTGG + Intronic
1113189415 13:107726892-107726914 AAGAATTTGCCGGCCGGGCGTGG - Intronic
1113493323 13:110709382-110709404 ACAGAATTAGCTGCCGGGCACGG - Intronic
1113810252 13:113137073-113137095 ATAGAGTTGCTGGCCAGGCGTGG - Intronic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1114165320 14:20213033-20213055 ACAGGGTGGCTGGCCGGGCGGGG - Intergenic
1114186927 14:20409728-20409750 AGAAAAATGCTGGCCGGGCGCGG + Intronic
1114256595 14:21007837-21007859 ACACAATTGACGGCCAGCCGCGG - Intergenic
1114304764 14:21412432-21412454 ACAGATCTGCTGGCCAGGCGCGG - Intronic
1114475434 14:22991234-22991256 AAAGTTTTGCCAGCCGGGCGCGG + Intronic
1114475570 14:22992173-22992195 AAAGTTTTGCCGGCTGGGCGTGG + Intronic
1114507597 14:23230362-23230384 AAGCCATTGCCGGCCGGGCGCGG + Intronic
1114878426 14:26752383-26752405 TGATAATAGCCGGCCGGGCGCGG - Intergenic
1114929788 14:27452460-27452482 ACATAATTTGAGGCCGGGCGTGG - Intergenic
1115412936 14:33095969-33095991 AGAGAATGACCGGCCAGGCGCGG - Intronic
1115491352 14:33961138-33961160 AAAGTAATGGCGGCCGGGCGCGG + Intronic
1115556683 14:34549810-34549832 ACGGAACTGTCGGCCGGGCGCGG + Intergenic
1115679470 14:35720040-35720062 TAAGAATTGTTGGCCGGGCGCGG - Intronic
1115696125 14:35900526-35900548 ATAGTTTTGTCGGCCGGGCGTGG - Intronic
1116005298 14:39285543-39285565 ACGGGATGGCTGGCCGGGCGGGG + Intronic
1116636338 14:47401045-47401067 AAAAAAATGCCGGCCGGGCACGG - Intronic
1116874079 14:50094091-50094113 ATGGAAGTGCCGGCTGGGCGTGG - Intergenic
1116980645 14:51166377-51166399 ACACATTGGCCGGCCGGGCGCGG - Intergenic
1117078509 14:52127953-52127975 AGGCAAATGCCGGCCGGGCGCGG + Intergenic
1117532988 14:56677014-56677036 AAAGGACTCCCGGCCGGGCGCGG - Intronic
1117707144 14:58482100-58482122 TCAGAGATGCCGGCCGGGCACGG - Intronic
1118619287 14:67600114-67600136 GCAGAATTCCCGGCAGGACGGGG + Exonic
1119240727 14:73057447-73057469 AAATGATTACCGGCCGGGCGCGG - Intergenic
1119269725 14:73291972-73291994 ACAGAAATACCGGCCAGGCACGG - Intronic
1119286597 14:73459595-73459617 AGAAAGTTGCTGGCCGGGCGCGG - Intronic
1119298360 14:73551515-73551537 ACAAAATGGCAGGCCAGGCGCGG + Intronic
1119302653 14:73583707-73583729 ACAAAATGGCAGGCCAGGCGCGG + Intergenic
1119342890 14:73895672-73895694 ACAATATTACAGGCCGGGCGTGG + Intronic
1120235667 14:81887942-81887964 AAAGAATTCCTGGCCAGGCGCGG - Intergenic
1120419783 14:84269270-84269292 ATACAATTTCAGGCCGGGCGCGG + Intergenic
1120653255 14:87159944-87159966 AAAGAAATGTGGGCCGGGCGCGG - Intergenic
1120986769 14:90341986-90342008 ACTGCATTGCCGGCCGGGCTCGG + Intergenic
1121390186 14:93566905-93566927 AAAGAATTCCAGGCCGAGCGTGG - Intronic
1121626536 14:95389424-95389446 AGTAAATTTCCGGCCGGGCGCGG - Intergenic
1122177578 14:99932345-99932367 ACAGATATGGGGGCCGGGCGCGG + Intronic
1122618420 14:103037738-103037760 AAAGAATTTTAGGCCGGGCGTGG + Intronic
1122725732 14:103750538-103750560 ACTGGATTGCAGGCCGGGTGCGG + Intronic
1123107968 14:105851840-105851862 ACACAACTGGAGGCCGGGCGGGG + Intergenic
1123765983 15:23478598-23478620 AAAGTATTCCCGGCCGGGCGCGG - Intergenic
1123773913 15:23557677-23557699 AAATAATTTCCGGCCGGGCACGG - Intergenic
1124128770 15:26966620-26966642 CCAGAATGGCAGGCCAGGCGCGG + Intergenic
1124357874 15:29010546-29010568 AAAGAACTCCCGGCCGGGTGTGG - Intronic
1124418416 15:29493421-29493443 AAAGAGTTGTCGGCCGGGCGCGG - Intronic
1124464900 15:29928651-29928673 ACACACTTGTCGGCCGGGCACGG + Intronic
1124472791 15:30003094-30003116 GCAAAATTTTCGGCCGGGCGTGG - Intergenic
1124585080 15:30997804-30997826 ACATATCTGCAGGCCGGGCGCGG + Intergenic
1125029225 15:35059780-35059802 ACAGAAATACAAGCCGGGCGCGG - Intergenic
1125247613 15:37659965-37659987 AAAGAACTCCCGGCCGGGTGTGG + Intergenic
1125543674 15:40487432-40487454 AAAAAATTGTTGGCCGGGCGCGG + Intergenic
1125643678 15:41252455-41252477 ACAGCTTTCCAGGCCGGGCGTGG - Intronic
1125650462 15:41312916-41312938 TAAGAATTCCTGGCCGGGCGTGG - Intronic
1125905508 15:43388139-43388161 ATAGAAGTACCTGCCGGGCGTGG - Intronic
1126008272 15:44279157-44279179 ACAAAATTAGCGGCTGGGCGCGG - Intergenic
1126129286 15:45324806-45324828 ACATAGTTGCTGGCCGGGCATGG - Intergenic
1126130670 15:45338244-45338266 AAAAAATTAGCGGCCGGGCGCGG - Intergenic
1126139730 15:45427539-45427561 ATATAATCGCCGGCCAGGCGCGG + Intergenic
1126150024 15:45515362-45515384 AAAGAAATTTCGGCCGGGCGTGG + Intronic
1127695620 15:61443931-61443953 TAAGAATTTCAGGCCGGGCGCGG + Intergenic
1127852299 15:62924471-62924493 AAGAAATTGCGGGCCGGGCGCGG - Intergenic
1128077290 15:64835541-64835563 ACATAAATCCAGGCCGGGCGCGG - Intergenic
1128273316 15:66331263-66331285 AAAGAAAGGCTGGCCGGGCGCGG + Intronic
1128424442 15:67525722-67525744 ACAGTAATGTTGGCCGGGCGCGG + Intronic
1128691790 15:69729972-69729994 AAATAATTCCTGGCCGGGCGCGG - Intergenic
1128906930 15:71475630-71475652 AAAGAAATGGCGGCCAGGCGTGG + Intronic
1128993483 15:72279743-72279765 GCAGAAAAGGCGGCCGGGCGAGG - Intronic
1129131868 15:73505820-73505842 GGAGAAGTGCAGGCCGGGCGCGG - Intronic
1129278397 15:74462773-74462795 ACAAAATTTCAGGCCGGGCGTGG - Intergenic
1129286566 15:74530003-74530025 ACAAAATTTGAGGCCGGGCGCGG - Intergenic
1129346639 15:74925030-74925052 AAGAAAGTGCCGGCCGGGCGTGG + Intronic
1129993640 15:79986159-79986181 ACAGAATTTCTGGCCGGGCGTGG - Intergenic
1130609725 15:85349915-85349937 ACAAAATTCCAGGCCGGGCACGG - Intergenic
1130667026 15:85878610-85878632 TCACAAGTCCCGGCCGGGCGCGG + Intergenic
1131624328 15:94101601-94101623 ACTTACTTGTCGGCCGGGCGCGG + Intergenic
1132475657 16:136397-136419 ACACAAGTGCAGGCTGGGCGCGG + Intronic
1132490373 16:225773-225795 ACAGAATTTCAGGCTGGGTGCGG - Intronic
1132494137 16:252470-252492 ACAGACTTTCCGGCCGGGCACGG - Intronic
1132542358 16:516584-516606 ACAGAAAAGAGGGCCGGGCGCGG + Intronic
1133104963 16:3501490-3501512 ACCGAACAGCAGGCCGGGCGCGG + Intronic
1133139511 16:3733930-3733952 ATAGACTTCCAGGCCGGGCGTGG - Intronic
1133159505 16:3901120-3901142 AAAAATTTACCGGCCGGGCGCGG + Intergenic
1133253752 16:4503103-4503125 ACAGCTTTGCTAGCCGGGCGCGG - Intronic
1133260877 16:4549182-4549204 ACAGAACACCAGGCCGGGCGCGG + Intergenic
1133393111 16:5425392-5425414 ACACACATGCTGGCCGGGCGCGG - Intergenic
1133664226 16:7950079-7950101 ATAGAATTGTTGGCCGGGAGTGG + Intergenic
1133726091 16:8538794-8538816 ACAGCACGGCCGGGCGGGCGCGG - Intergenic
1133793181 16:9025328-9025350 AAAGAATTATTGGCCGGGCGCGG - Intergenic
1133858762 16:9574460-9574482 ACGGCATTGCTGGCCGGGCGCGG - Intergenic
1133943616 16:10330333-10330355 AAAAAATTTCAGGCCGGGCGTGG - Intronic
1134138209 16:11694437-11694459 AAAGCATTGCTGGTCGGGCGCGG - Intronic
1134482929 16:14633941-14633963 AGACAATTCTCGGCCGGGCGCGG - Intronic
1134790370 16:16984263-16984285 ATACAAATGCCGGCCAGGCGCGG + Intergenic
1135041942 16:19124179-19124201 AAAGACTTGTCGGCAGGGCGTGG + Intronic
1135476524 16:22781059-22781081 AGAGACATGCTGGCCGGGCGCGG - Intergenic
1135717916 16:24788936-24788958 AAAGAATTTTGGGCCGGGCGTGG - Intronic
1136218428 16:28811429-28811451 ACAGCAGTGTTGGCCGGGCGAGG - Intergenic
1136521680 16:30800765-30800787 AAAGAATTCATGGCCGGGCGTGG - Intergenic
1136532965 16:30882236-30882258 ACAGAATAAATGGCCGGGCGTGG - Intronic
1136735380 16:32462149-32462171 AGACAAATGCAGGCCGGGCGCGG + Intergenic
1136858905 16:33683477-33683499 ACACCTTTGGCGGCCGGGCGCGG + Intergenic
1137581515 16:49636406-49636428 CCACAATATCCGGCCGGGCGAGG - Exonic
1137642400 16:50044318-50044340 AAATAGTGGCCGGCCGGGCGCGG + Intergenic
1138043487 16:53698379-53698401 ACAGGACGGCTGGCCGGGCGGGG - Intronic
1138138359 16:54544368-54544390 ACAGATTTTTAGGCCGGGCGCGG - Intergenic
1138623613 16:58231747-58231769 AAAGAATTACAGGCCGGGCATGG - Intronic
1139080931 16:63520080-63520102 TGAGAATTCCCGGCTGGGCGTGG + Intergenic
1139411629 16:66766159-66766181 AAAAAATACCCGGCCGGGCGCGG - Intronic
1139467232 16:67160418-67160440 ACAAGATTGGCGGCCGGGCGCGG + Intronic
1139467549 16:67162037-67162059 AAATAATTGCTGGCCGGGCGTGG + Intronic
1139554227 16:67696301-67696323 AAAAGATTCCCGGCCGGGCGCGG - Intronic
1139869740 16:70097350-70097372 ACAGTATTACAGGCCGGGCGCGG + Intergenic
1139918732 16:70445261-70445283 AAAAAATTGAAGGCCGGGCGCGG - Intergenic
1140281006 16:73555442-73555464 ACAAACATGGCGGCCGGGCGCGG - Intergenic
1140358733 16:74327402-74327424 ATAGAATTATCGGCCGGGCCTGG + Intergenic
1140382491 16:74502858-74502880 AAAAAATTACTGGCCGGGCGCGG - Intronic
1140435148 16:74940992-74941014 ACAGCATTTTCGGCTGGGCGCGG - Intronic
1140444691 16:75016211-75016233 AGAGTATTAGCGGCCGGGCGCGG - Intronic
1140538311 16:75731407-75731429 ATACAGTTGCCTGCCGGGCGTGG + Intronic
1140603125 16:76501778-76501800 TAAGAATTTACGGCCGGGCGCGG + Intronic
1140709074 16:77659511-77659533 AAAGAATACCCGGCTGGGCGTGG - Intergenic
1141455759 16:84140811-84140833 ACAGTATTGCTGGCCGGGCGCGG + Intronic
1141970234 16:87476834-87476856 ACTGAAGTGGTGGCCGGGCGCGG + Intronic
1142140175 16:88469237-88469259 TCTGAAGTGCCGGCCGGGCCAGG + Intronic
1142176818 16:88649224-88649246 ACAGAATGGCTGGCAGGGCAAGG - Intronic
1142314790 16:89336833-89336855 AAACAACTGCAGGCCGGGCGCGG + Intronic
1142391361 16:89802691-89802713 AAAGAATAGCTGGCCGGGCATGG - Intronic
1142447776 16:90153068-90153090 AAAGAAATGGAGGCCGGGCGTGG - Intergenic
1203017700 16_KI270728v1_random:367442-367464 AGACAAATGCAGGCCGGGCGCGG - Intergenic
1203036035 16_KI270728v1_random:640600-640622 AGACAAATGCAGGCCGGGCGCGG - Intergenic
1142459714 17:82256-82278 AAAGAAATGGAGGCCGGGCGTGG + Intergenic
1142607387 17:1089667-1089689 AAGGAAATGCAGGCCGGGCGCGG + Intronic
1142746566 17:1961989-1962011 AAAGAAAAGCAGGCCGGGCGTGG + Intronic
1142856949 17:2736137-2736159 AGAGAAAGGCGGGCCGGGCGCGG + Intergenic
1142871932 17:2826715-2826737 GGAGGATTTCCGGCCGGGCGCGG + Intronic
1142891506 17:2947043-2947065 ACACAGTTTCCGGCCGGGCACGG - Intronic
1143357781 17:6343410-6343432 ACAGAAGTCCAGGCCAGGCGTGG + Intergenic
1143572145 17:7766065-7766087 GTAGAAATGCGGGCCGGGCGCGG - Intronic
1143814667 17:9502810-9502832 AGTGAAATGCAGGCCGGGCGCGG + Intronic
1143942827 17:10560358-10560380 AAAAAAATGCAGGCCGGGCGGGG - Intergenic
1144065827 17:11623262-11623284 AAAGAAATGCTGGCCGGGCACGG - Intronic
1144176051 17:12708679-12708701 ATAGTATTGCTGGCCAGGCGCGG - Intronic
1144251930 17:13426224-13426246 AAAGAATTCTGGGCCGGGCGTGG + Intergenic
1144289842 17:13815786-13815808 ATACGATTGCTGGCCGGGCGCGG - Intergenic
1144296404 17:13879132-13879154 TAAGAATAGCTGGCCGGGCGCGG + Intergenic
1144963267 17:19058955-19058977 ACAGAAATGTAGGCCGGGCATGG + Intergenic
1144964423 17:19067085-19067107 ACAGAAATGTAGGCCGGGCATGG - Intergenic
1144971892 17:19115570-19115592 ACAGAAATGTAGGCCGGGCATGG - Intergenic
1145028976 17:19490182-19490204 AAAAAAATGTCGGCCGGGCGTGG + Intergenic
1145057264 17:19711299-19711321 AAAGAAATGCAGGCCAGGCGTGG + Intronic
1145082573 17:19907307-19907329 CCAGAAATGGGGGCCGGGCGTGG - Intronic
1145128358 17:20320397-20320419 AGAAAAGTGACGGCCGGGCGCGG - Intergenic
1145951778 17:28824165-28824187 AAAAAATTCTCGGCCGGGCGTGG - Intronic
1146992333 17:37286178-37286200 ACAGTACTGCCAGCCAGGCGCGG - Intronic
1147089763 17:38088306-38088328 ACAGCATACACGGCCGGGCGCGG - Intergenic
1147288250 17:39420489-39420511 AGAGAATTTGCAGCCGGGCGTGG - Intronic
1147621738 17:41872617-41872639 ACAGTATTTGGGGCCGGGCGCGG - Intronic
1148288573 17:46419564-46419586 ACTGAATGGCAGGCCGGGCGCGG - Intergenic
1148310742 17:46637142-46637164 ACTGAATGGCAGGCCGGGCGCGG - Intronic
1148421110 17:47547734-47547756 AAATAATTTACGGCCGGGCGCGG + Intronic
1148697483 17:49570003-49570025 AACGAATGGCGGGCCGGGCGCGG - Intergenic
1149300181 17:55298038-55298060 AAAGAAATGCTGGCTGGGCGCGG - Intronic
1149600008 17:57887109-57887131 ACAGAATTTATGGCCGGGCACGG - Intronic
1149643513 17:58220740-58220762 AAATTATTTCCGGCCGGGCGCGG - Intronic
1149791315 17:59480069-59480091 AAAGAATTACAGGCTGGGCGCGG - Intergenic
1150056453 17:62021342-62021364 ACAGGGTGGCTGGCCGGGCGGGG + Intronic
1150186153 17:63183725-63183747 AAAGAAATGCAGGCTGGGCGCGG + Intronic
1150219039 17:63485488-63485510 ACTCAATTTCGGGCCGGGCGCGG + Intronic
1150223446 17:63509904-63509926 GAACAATTGCCGGCCGGGCATGG + Intronic
1150344181 17:64391417-64391439 ATAGAATTAACGGCTGGGCGTGG + Intronic
1150681437 17:67287768-67287790 ACAAAAATACAGGCCGGGCGTGG + Intergenic
1150959773 17:69900701-69900723 AAAGAACTTGCGGCCGGGCGTGG - Intergenic
1151001052 17:70377181-70377203 AGAAAAATGCCGGCCGGGTGCGG + Intergenic
1151022092 17:70628793-70628815 AGAGATTTCACGGCCGGGCGCGG - Intergenic
1151798646 17:76364043-76364065 ACAAAAGTACAGGCCGGGCGCGG - Intronic
1151851440 17:76692541-76692563 TCAGACTTCCAGGCCGGGCGCGG - Intronic
1152187473 17:78866968-78866990 ACTGAATTGTAGGCCGGGCGCGG + Intronic
1152675382 17:81637506-81637528 ACTGCATTTCAGGCCGGGCGCGG + Intronic
1153034621 18:749201-749223 ACTGCATTTCTGGCCGGGCGCGG + Intronic
1153036985 18:772720-772742 ATAGAGATGCTGGCCGGGCGTGG - Intronic
1153205377 18:2693919-2693941 AAAAAATTGCAGGCCGGGCGTGG - Intronic
1154005909 18:10526897-10526919 TCAGCATTGTGGGCCGGGCGCGG + Intronic
1154010651 18:10571440-10571462 ACAAAATTAACGGCCAGGCGCGG - Intergenic
1154110000 18:11559666-11559688 AATGACTTCCCGGCCGGGCGCGG + Intergenic
1154183544 18:12158822-12158844 AAAAAATTTCTGGCCGGGCGCGG - Intergenic
1154208286 18:12356440-12356462 AAAGAATTGACGGCTGGGCGCGG - Intronic
1155211389 18:23605209-23605231 ACAGAATTCTGGGCCGGGCATGG - Intronic
1155275016 18:24178579-24178601 AAAGAATTGTTGGCCGGGCATGG - Intronic
1155429570 18:25741585-25741607 ACTCAATTCCAGGCCGGGCGTGG + Intergenic
1155783065 18:29863661-29863683 ACGTAATTGCTGGCTGGGCGTGG + Intergenic
1155894483 18:31306935-31306957 ATGGAAGTACCGGCCGGGCGCGG - Intergenic
1155953858 18:31940785-31940807 AAAAAATTTTCGGCCGGGCGCGG - Intronic
1156098388 18:33563952-33563974 ATAGAATTTGAGGCCGGGCGCGG + Intergenic
1156313743 18:35948711-35948733 TAAAACTTGCCGGCCGGGCGCGG - Intergenic
1156792338 18:40990727-40990749 AAAAAATTTCAGGCCGGGCGCGG + Intergenic
1157107401 18:44787562-44787584 AGAAAATTGTTGGCCGGGCGCGG + Intronic
1157262724 18:46190227-46190249 ACAGCTTTTCAGGCCGGGCGTGG + Intronic
1157309207 18:46539168-46539190 ACAGATTTGCAGGCCAGGTGTGG + Intronic
1157825541 18:50808845-50808867 AAAGAACTGTCGGCCGGGCGCGG + Intronic
1158088637 18:53683768-53683790 AAAGAATTATCGGCTGGGCGCGG - Intergenic
1158263222 18:55632326-55632348 AAAGAACTGTTGGCCGGGCGCGG - Intronic
1158364614 18:56719271-56719293 ACAGAATTGCTGGCCGGGCGCGG + Intronic
1158465432 18:57685955-57685977 ACACAATTGTAGGCCGGGTGTGG + Intronic
1158605698 18:58894172-58894194 GTAGACTTTCCGGCCGGGCGTGG + Intronic
1158719134 18:59908340-59908362 ACACAAGTTCAGGCCGGGCGAGG - Intergenic
1159002089 18:62983358-62983380 ATAGAATTTCAGGCCGGGCACGG + Intergenic
1159024698 18:63172489-63172511 AGTGAATTCCCGGCCGGGCGTGG + Intronic
1159308538 18:66677651-66677673 ACAGGAGAGTCGGCCGGGCGCGG - Intergenic
1159444464 18:68524134-68524156 ACAGCATTGCCGGCGGGGCATGG + Intergenic
1159814445 18:73055190-73055212 ACAGAGTTTTCGGCCGGGCGCGG - Intergenic
1160410304 18:78671186-78671208 ACTGAATAGCCGGGCGGGGGAGG + Intergenic
1160506603 18:79430671-79430693 ACAAAATTCATGGCCGGGCGTGG - Intronic
1160629787 18:80238849-80238871 ACAGAATCGGGGGGCGGGCGGGG + Intronic
1160649430 19:214764-214786 AAAGAAATGGAGGCCGGGCGTGG + Intergenic
1160734242 19:654674-654696 AAAAAAGTGCTGGCCGGGCGCGG + Intronic
1160814491 19:1028838-1028860 TCAAAGTTGCCGGCGGGGCGGGG + Intronic
1160839567 19:1140007-1140029 GAAGAAATGCAGGCCGGGCGCGG + Intronic
1160906663 19:1454855-1454877 TAAAAATAGCCGGCCGGGCGCGG - Intronic
1160919921 19:1514463-1514485 AGAGAAGGGCAGGCCGGGCGCGG + Intergenic
1161044121 19:2125710-2125732 ACAGAAATGTAGGCCGGGCGCGG + Intronic
1161172285 19:2818718-2818740 AAAGAATAGGTGGCCGGGCGCGG + Intergenic
1161373880 19:3928953-3928975 ACAGAAAAGAAGGCCGGGCGCGG + Intergenic
1161452020 19:4351570-4351592 ATAGACTTGGCGGCCGGGCACGG + Intronic
1161548889 19:4899637-4899659 AAAGAACTAGCGGCCGGGCGCGG + Intronic
1161752290 19:6107003-6107025 CCACAGGTGCCGGCCGGGCGCGG + Intronic
1161809958 19:6465908-6465930 GCAGGAGTCCCGGCCGGGCGCGG + Intronic
1161889178 19:7021746-7021768 ATGGAATTGTCGGCCGGGTGCGG + Intergenic
1161892274 19:7049003-7049025 ATGGAATTGTCGGCCGGGTGCGG - Intergenic
1162244361 19:9387171-9387193 ATAGAATTGCAGGCCAGGCGTGG + Intergenic
1162643238 19:12029789-12029811 AAAAAATAGCTGGCCGGGCGCGG + Intronic
1162649254 19:12073444-12073466 ACAGTACTGTGGGCCGGGCGCGG - Intronic
1163060313 19:14755868-14755890 ACAGAAGGGCCTGCAGGGCGAGG + Exonic
1163065486 19:14789736-14789758 ACAGAAGTGCTGGCCGGGCACGG - Intergenic
1163083617 19:14962615-14962637 ATAGAACTACCGGCCGGGCATGG + Intronic
1163118950 19:15204388-15204410 ACAAAGTTGCATGCCGGGCGTGG + Intergenic
1163321522 19:16577484-16577506 ACACAACTGCCGGCCGGAGGTGG - Exonic
1163450067 19:17371771-17371793 ACAGCTTTGCTGGCCAGGCGTGG - Intronic
1163480460 19:17552775-17552797 ACAAAATTAGCGGCCGGGAGTGG + Intronic
1163535713 19:17875077-17875099 ATAGTAATGGCGGCCGGGCGCGG + Intronic
1163707648 19:18824883-18824905 AGAAAATTGACGGCCAGGCGCGG - Intergenic
1163855112 19:19695505-19695527 AAAGAATAGCCGGCCAGGTGCGG - Intergenic
1163865173 19:19767446-19767468 AAAGATTTACTGGCCGGGCGCGG - Intergenic
1164028906 19:21382218-21382240 AGTAAATTGCCAGCCGGGCGTGG - Intergenic
1164077724 19:21835643-21835665 ACAGGAGAGTCGGCCGGGCGCGG - Intronic
1164335341 19:24312313-24312335 AAAGTATTTCCGGCCGGGCGCGG - Intergenic
1164370749 19:27641849-27641871 AGAAATTTTCCGGCCGGGCGCGG - Intergenic
1164598227 19:29544234-29544256 ACTGAATGTGCGGCCGGGCGCGG + Intronic
1165048137 19:33122611-33122633 ACTAAAGAGCCGGCCGGGCGTGG - Intronic
1165341230 19:35213709-35213731 ACAAAATTCTTGGCCGGGCGCGG - Intergenic
1165456972 19:35917816-35917838 AAAGAATTAATGGCCGGGCGCGG + Intergenic
1165682284 19:37788379-37788401 ACAAAATTTTTGGCCGGGCGCGG + Intronic
1165816934 19:38648105-38648127 AGAGAATTGGCGGCTGGGTGGGG + Intronic
1166404901 19:42513306-42513328 ACTGCACTGCAGGCCGGGCGCGG + Intronic
1166577522 19:43856309-43856331 AAAGAATGCCTGGCCGGGCGTGG - Intergenic
1166611734 19:44204204-44204226 ACAGGGTGGCTGGCCGGGCGGGG - Intergenic
1166651152 19:44576152-44576174 AAAGAATTTCCGGCTGGGCGTGG + Intergenic
1166830678 19:45637965-45637987 ATAAAATAGCAGGCCGGGCGCGG - Intronic
1167033692 19:46980092-46980114 AGAAAATTGAGGGCCGGGCGCGG + Intronic
1167247083 19:48380044-48380066 AAAGAGATGCCGGCCGGGTGCGG + Intergenic
1167344426 19:48936404-48936426 AAAAAGATGCCGGCCGGGCGCGG + Intronic
1167347241 19:48954363-48954385 ACAGAAAAGCAGGCCTGGCGCGG + Intergenic
1167446370 19:49540011-49540033 AAAAAATTCCTGGCCGGGCGTGG - Intronic
1167616568 19:50537663-50537685 AAAGAACAGTCGGCCGGGCGCGG - Intronic
1167946877 19:52995271-52995293 AAAGATTTTTCGGCCGGGCGCGG + Intergenic
1168055642 19:53863512-53863534 AAAGAATTGACGGCTGGGCACGG + Intergenic
1168071216 19:53953040-53953062 ATAAAATTCTCGGCCGGGCGCGG - Intergenic
1168143125 19:54402924-54402946 AAAGACTTGTTGGCCGGGCGCGG - Intergenic
1168143727 19:54407184-54407206 GTAGAATTGTTGGCCGGGCGTGG + Intergenic
1168209491 19:54879973-54879995 AAAGAAATGTCGGCCGGGCGCGG - Intronic
1168323386 19:55523933-55523955 AAAAATTAGCCGGCCGGGCGCGG + Intergenic
1168529975 19:57119711-57119733 ACAGTCATCCCGGCCGGGCGCGG - Intronic
925076037 2:1016529-1016551 ATAAAGTTGTCGGCCGGGCGTGG - Intronic
925615996 2:5744913-5744935 ACAAATTAGCCGGCCGGGCGCGG - Intergenic
925642363 2:5998395-5998417 AGAAAATTGAGGGCCGGGCGCGG + Intergenic
925897849 2:8487276-8487298 AAAAAATATCCGGCCGGGCGAGG - Intergenic
925972747 2:9118497-9118519 ACTGCATTACAGGCCGGGCGTGG - Intergenic
926264444 2:11302094-11302116 CCATAGTTGCTGGCCGGGCGTGG - Intronic
926736156 2:16074637-16074659 ATAATATTGACGGCCGGGCGCGG + Intergenic
927204518 2:20598846-20598868 AAAGAAGTACCGGCCGGGCGCGG - Intronic
927254410 2:21027601-21027623 ATAGAAATGCAGGCCTGGCGAGG - Intronic
927536021 2:23859655-23859677 ATTTAATTGCCGGCCGGGCTTGG + Intronic
927665622 2:25030433-25030455 AAAGAATTGTAGGCTGGGCGTGG + Intergenic
927896768 2:26787503-26787525 ACCAAAAAGCCGGCCGGGCGCGG - Intronic
927900298 2:26814033-26814055 ACAGAATTCCAGGCCGGGCGCGG + Intergenic
927907212 2:26867743-26867765 AAACAATTGGGGGCCGGGCGCGG - Intronic
927919667 2:26962150-26962172 ACAGAATGCCGGGCCAGGCGCGG + Intergenic
928290106 2:30029432-30029454 AAAGAATTTCTGGCCGGGTGCGG + Intergenic
928646314 2:33356387-33356409 TCAGAAATGTCTGCCGGGCGAGG + Intronic
929118301 2:38463421-38463443 ACAGAATTGGGGGCCGGGCGTGG - Intergenic
929165161 2:38874697-38874719 ACAGTATTTCAGGTCGGGCGCGG - Intronic
929213406 2:39384234-39384256 ACAGCACTGTCGGCCGGGCATGG + Intronic
929336350 2:40751318-40751340 AAATAATTCCCGGCCGGGCGCGG - Intergenic
929471671 2:42200017-42200039 ATAGAAATACCGGCCAGGCGCGG + Intronic
930174862 2:48291566-48291588 ACTTAACTGCTGGCCGGGCGTGG + Intergenic
930470161 2:51802086-51802108 TCAGAAATACTGGCCGGGCGCGG - Intergenic
930653841 2:53989036-53989058 ACTGAATTACAGGCCGGGCGTGG - Intronic
930677723 2:54222257-54222279 ATAGAATTACAGGCCAGGCGTGG + Intronic
930727892 2:54699160-54699182 ACGGAGCGGCCGGCCGGGCGGGG - Intergenic
931654953 2:64502475-64502497 ACAAAATTGTGGGCCGGGCACGG + Intergenic
931658785 2:64536660-64536682 AGAGAATTGCCAGCAGGGCGTGG + Intronic
931678762 2:64725166-64725188 AGATTATTGCCGGCCGGGTGCGG + Intronic
931792432 2:65676557-65676579 TAAGAATTGGGGGCCGGGCGCGG + Intergenic
931958314 2:67452776-67452798 AAAGAATAACCGGCCGGGCATGG - Intergenic
932034616 2:68230281-68230303 ACAGAAATGAAGGCCGGGCATGG - Intronic
932225146 2:70033862-70033884 AAAGCAATGCTGGCCGGGCGCGG + Intergenic
932246399 2:70200426-70200448 TCAGAACTTCTGGCCGGGCGCGG + Intronic
932261301 2:70330038-70330060 TCAAAAGTGCCGGCTGGGCGCGG + Intergenic
932979508 2:76647336-76647358 TAAGAATTGTAGGCCGGGCGCGG - Intergenic
933050098 2:77591916-77591938 ACAGAATTGTCAGCTGGGCGCGG + Intronic
933062015 2:77749648-77749670 CCAAAATTCCTGGCCGGGCGCGG + Intergenic
933084671 2:78040664-78040686 AAAGTATGGCGGGCCGGGCGCGG - Intergenic
933309272 2:80639810-80639832 AAATATTTGTCGGCCGGGCGCGG + Intronic
933455812 2:82517693-82517715 AAAGAGTTTTCGGCCGGGCGAGG - Intergenic
933706908 2:85298201-85298223 AAAAAAGTGCAGGCCGGGCGCGG + Intronic
935040971 2:99426891-99426913 AAAAAATTGCTGGCCGGGTGCGG + Intronic
935484398 2:103635327-103635349 ATAGAATAGGGGGCCGGGCGTGG - Intergenic
935996040 2:108773935-108773957 AAAGAATTCCTGGCCAGGCGCGG - Intronic
936749325 2:115621966-115621988 ACAGAATTTGTGGCTGGGCGTGG - Intronic
937044721 2:118845198-118845220 CCACAGCTGCCGGCCGGGCGCGG - Intronic
937162593 2:119779325-119779347 AAAGAATTGTCGGCTGGGCGCGG + Intronic
937184568 2:120028152-120028174 AAATAACTTCCGGCCGGGCGCGG - Intronic
937619442 2:123968646-123968668 ATAGAAATATCGGCCGGGCGCGG - Intergenic
937962677 2:127473093-127473115 ACAGAATTCTTGGCTGGGCGTGG - Intronic
938005907 2:127788271-127788293 ACAGGGCGGCCGGCCGGGCGGGG + Intronic
938451603 2:131425524-131425546 ACAGGGTTGCCGGGCGGGCGGGG - Intergenic
938460992 2:131496455-131496477 TGGGAATTGCTGGCCGGGCGTGG + Intergenic
938840768 2:135160379-135160401 ACACATTTTGCGGCCGGGCGCGG + Intronic
938847850 2:135229655-135229677 AAAATATTGGCGGCCGGGCGCGG - Intronic
939404788 2:141742542-141742564 ACAGAACTGGAGGCCAGGCGTGG - Intronic
939878414 2:147603299-147603321 AAGAAATTGCCAGCCGGGCGCGG - Intergenic
940746908 2:157577143-157577165 AGAAAATTTCAGGCCGGGCGCGG - Intronic
940939632 2:159543822-159543844 AAAGAATTGTTGGCCAGGCGCGG - Intronic
941475807 2:165950896-165950918 ACAGAGCTGTCGGACGGGCGTGG - Intronic
941694794 2:168539253-168539275 ACAATATTTTCGGCCGGGCGCGG - Intronic
941715724 2:168761045-168761067 ACAGTAAACCCGGCCGGGCGCGG - Intronic
941779040 2:169425262-169425284 ATATAATTGTTGGCCGGGCGCGG + Intergenic
941817608 2:169813417-169813439 AAAGAATTTCAGGCCGGGCGTGG - Intronic
941847875 2:170150167-170150189 ACAGGGTGGCTGGCCGGGCGGGG - Intergenic
941935238 2:170976589-170976611 ACAGAGCTGTCGGCCGGACGCGG + Intergenic
942035776 2:172009331-172009353 AGAAAATTCCAGGCCGGGCGCGG - Intronic
942238031 2:173931630-173931652 ACAGATTTTCCGGCTGGGCGTGG - Intronic
942481612 2:176394239-176394261 AATGGATTGACGGCCGGGCGTGG + Intergenic
942809202 2:179976862-179976884 ACAGAATTACCAGCCAGGTGCGG + Intronic
943568975 2:189550051-189550073 ATAAAAATGCTGGCCGGGCGTGG + Intergenic
943676029 2:190717260-190717282 AGAAAAATGCCGGCCGGGCGCGG - Intergenic
944361581 2:198863170-198863192 AAACAATTTTCGGCCGGGCGCGG - Intergenic
944585090 2:201166188-201166210 ACGGGATAGCTGGCCGGGCGGGG + Exonic
945233866 2:207616552-207616574 ACAGAATATCCGGCTGGGTGCGG + Intronic
945236249 2:207634565-207634587 GAAGAATTACCGGCTGGGCGAGG + Intergenic
945280420 2:208030549-208030571 AAAGTATTGGAGGCCGGGCGTGG - Intergenic
945660712 2:212681976-212681998 ATATTATTACCGGCCGGGCGCGG - Intergenic
945760714 2:213910776-213910798 AAAGAATTCTTGGCCGGGCGTGG - Intronic
945792830 2:214326653-214326675 ACAGTACTTCCGGCCGGGCGCGG + Intronic
946217977 2:218200693-218200715 AAAGAAGTTCCGGCCGGGCGCGG + Intergenic
946238063 2:218337361-218337383 TAAGAATTGAAGGCCGGGCGCGG - Intronic
946594871 2:221295348-221295370 ACAGCATTGGAGGCCTGGCGTGG - Intergenic
946900169 2:224364609-224364631 ACAGAGCTATCGGCCGGGCGCGG + Intergenic
946920866 2:224581104-224581126 ACAGAACTATTGGCCGGGCGTGG + Intronic
947114219 2:226751571-226751593 AAAAAATACCCGGCCGGGCGCGG - Intronic
947150585 2:227110968-227110990 GCAGTTTTGCCGGCCAGGCGTGG - Intronic
947162667 2:227229756-227229778 AGAAATTTCCCGGCCGGGCGCGG + Intronic
947168932 2:227291271-227291293 AAACACTTGTCGGCCGGGCGCGG + Intronic
947403536 2:229751895-229751917 AGAAAAATGTCGGCCGGGCGCGG + Intergenic
947552305 2:231055192-231055214 AGTGAATTCCTGGCCGGGCGCGG - Intergenic
947745553 2:232505707-232505729 ACAGAACAGCCAGCCGGGCATGG - Intergenic
947789519 2:232856220-232856242 AAAGAACTGCAGGCCGGGTGTGG - Intronic
948145004 2:235702134-235702156 ACAGAATTGGGGGCTGGGCTGGG + Intronic
948382613 2:237561305-237561327 ACAGAACTGCAGGCCTGGCCTGG - Intergenic
948725639 2:239932122-239932144 GCAGAGGTGCAGGCCGGGCGCGG - Intronic
948977762 2:241474014-241474036 ATAGAGCTGCAGGCCGGGCGCGG + Intronic
949005502 2:241644578-241644600 TCAGAAGTGTTGGCCGGGCGCGG + Intronic
1169603945 20:7293991-7294013 AATGTATTGTCGGCCGGGCGCGG - Intergenic
1169923292 20:10757638-10757660 AAAGTATTGAAGGCCGGGCGTGG + Intergenic
1169999874 20:11604028-11604050 ATATAATTCCTGGCCGGGCGCGG + Intergenic
1171187614 20:23134080-23134102 AAAAAAATACCGGCCGGGCGCGG + Intergenic
1171287077 20:23949182-23949204 TCAGAGATGACGGCCGGGCGCGG - Intergenic
1171477709 20:25426271-25426293 TCAGAATTTCCGGCTGGGCACGG + Intronic
1172051470 20:32122004-32122026 ACAGGGTGGCTGGCCGGGCGGGG + Intronic
1172258018 20:33536402-33536424 ACAGGGTGGCTGGCCGGGCGGGG + Intronic
1172710438 20:36918506-36918528 AAAGAATTTATGGCCGGGCGCGG + Intronic
1172713867 20:36948972-36948994 ACACATAGGCCGGCCGGGCGCGG + Intronic
1173494225 20:43507491-43507513 ACAGGTTTGCCGCACGGGCGTGG - Intergenic
1173513455 20:43648444-43648466 ACAAATTTGTAGGCCGGGCGCGG - Intergenic
1174184212 20:48694200-48694222 ACAGAAATTCGGGCTGGGCGTGG - Intronic
1174243146 20:49154573-49154595 ACACAATTCCTGGCCAGGCGTGG + Intronic
1174251832 20:49225743-49225765 AGAGAGTTCTCGGCCGGGCGCGG - Intronic
1174350376 20:49963304-49963326 AAAAAATTCACGGCCGGGCGCGG - Intergenic
1174384807 20:50180938-50180960 ACAGAATTACTGGCCGGGCGTGG + Intergenic
1174445588 20:50588788-50588810 AAAGAATTCTAGGCCGGGCGCGG + Intronic
1174855845 20:54044545-54044567 AGAAATTTTCCGGCCGGGCGCGG + Intronic
1175106425 20:56618236-56618258 ACAGTAGTGCCAGCCGGGTGCGG - Intergenic
1176014579 20:62923462-62923484 AAAGAATTCCCGGCCGGGCATGG - Intronic
1176782083 21:13208418-13208440 AAAGAATTGTAGGCCGGGCGCGG - Intergenic
1176839332 21:13826317-13826339 AAAGAACTTCCGGCCGGGCGCGG - Intergenic
1177048585 21:16202543-16202565 TAAGAATTGGAGGCCGGGCGTGG - Intergenic
1177617751 21:23546039-23546061 ACACAATTTATGGCCGGGCGTGG + Intergenic
1178317069 21:31575719-31575741 AAAGAAAAGCCTGCCGGGCGGGG + Intergenic
1178545917 21:33492977-33492999 ATAGGATTTCTGGCCGGGCGCGG + Intergenic
1178558748 21:33617997-33618019 ATAGAAATGATGGCCGGGCGCGG + Intronic
1179056764 21:37943628-37943650 AAAAAAATGCCGGCCGGGCGCGG - Intergenic
1179341190 21:40511699-40511721 AAAGTATTCTCGGCCGGGCGCGG + Intronic
1179653760 21:42832447-42832469 GAAGAATTGCAGGCCGGGCCCGG - Intergenic
1179676408 21:42985706-42985728 AACAAATTGCAGGCCGGGCGTGG + Intronic
1180097614 21:45565884-45565906 AAACAATTCCCGGCCGGGTGCGG + Intergenic
1180232523 21:46435830-46435852 ACAAAACTGCCGGCCGGGCGCGG - Intronic
1180666202 22:17514741-17514763 ACAGACTTGTGGGCCAGGCGCGG + Intronic
1180681360 22:17629073-17629095 ACATGATTGTTGGCCGGGCGTGG + Intronic
1180684872 22:17658108-17658130 AAAGAAATGTCGGCCGGGCGTGG - Intronic
1180687958 22:17685023-17685045 AAAAAATTACAGGCCGGGCGTGG - Intronic
1180860416 22:19076453-19076475 GTAGAATTACCTGCCGGGCGCGG - Intronic
1180890040 22:19280998-19281020 AAAGAGTTGTGGGCCGGGCGCGG + Intronic
1180994257 22:19957238-19957260 ACAGGAATGCTGGCCGGGCGCGG - Intronic
1181115031 22:20626902-20626924 TGGGAATTGCTGGCCGGGCGTGG - Intergenic
1181262592 22:21609185-21609207 AAGAAACTGCCGGCCGGGCGCGG - Intronic
1181299521 22:21869593-21869615 CCACAATAACCGGCCGGGCGCGG + Intergenic
1181578671 22:23814118-23814140 TCAAAATTGCTGGCCGGGTGTGG - Intronic
1181670381 22:24423214-24423236 CCCCCATTGCCGGCCGGGCGCGG - Intronic
1181723529 22:24794846-24794868 AAAAAATTACAGGCCGGGCGCGG + Intergenic
1182233437 22:28856725-28856747 AAACAATTTCCGGCCGGGCGTGG - Intergenic
1182450745 22:30419259-30419281 ACAGAAGTGATGGCCGGGCGTGG + Intronic
1182487568 22:30648459-30648481 AGAGAAATCCAGGCCGGGCGCGG + Intronic
1182514099 22:30843072-30843094 ACTGAATTGCAGGCCGGGTGCGG - Intronic
1182736934 22:32537447-32537469 AAGGAAGTGCCGGCCGGGTGCGG - Intronic
1182759834 22:32713538-32713560 ACAGATATCCCGGCTGGGCGCGG + Intronic
1183157152 22:36084435-36084457 ACATAATTGCTGGCAGGGTGTGG - Intergenic
1183219821 22:36505476-36505498 ATAGAATTGAAGGCCGGGTGCGG + Intronic
1183586679 22:38756746-38756768 ACAGAAGAGCTGGCCGGGCGCGG - Intronic
1183826147 22:40389307-40389329 ACTGCAGTGCAGGCCGGGCGCGG + Intronic
1183850211 22:40579567-40579589 ACACAAATGCTGGCCAGGCGTGG + Intronic
1183887028 22:40892473-40892495 ATAGATTTGCCAGCCAGGCGTGG - Intronic
1184048398 22:41986789-41986811 ACAGGGTTTCGGGCCGGGCGTGG - Intronic
1184107294 22:42375546-42375568 AAAGAACTGCTGGCCGGGCACGG - Intergenic
1184299341 22:43546578-43546600 AGAGATTTTCAGGCCGGGCGTGG + Intronic
1184540052 22:45116191-45116213 AAAGAATTCCTGGCCGGGCGTGG + Intergenic
1184990598 22:48166561-48166583 AGAGTATTCACGGCCGGGCGCGG - Intergenic
1185298923 22:50069015-50069037 AAAGAAAGGCAGGCCGGGCGCGG - Intronic
1185345923 22:50310652-50310674 AGAAAAGTCCCGGCCGGGCGCGG + Exonic
949339140 3:3009721-3009743 AAAGAAATGCTGGCCGGGCGCGG - Intronic
949478121 3:4467907-4467929 ACAACATAGCAGGCCGGGCGCGG + Intergenic
950007193 3:9698876-9698898 AAAAAATTGCAGGCCGGGCATGG + Intronic
950294664 3:11818604-11818626 ACAGACTTCCAGGCTGGGCGCGG + Intronic
950504255 3:13384249-13384271 ACAACAGGGCCGGCCGGGCGTGG - Intronic
950749686 3:15118869-15118891 AAAGAATTCTGGGCCGGGCGCGG + Intergenic
950922398 3:16707878-16707900 AATGGATTCCCGGCCGGGCGCGG + Intergenic
951030539 3:17876968-17876990 AAAGAGTTCCAGGCCGGGCGCGG + Intronic
951180061 3:19649209-19649231 AGGCAATTCCCGGCCGGGCGCGG - Intergenic
951589975 3:24254071-24254093 TCAGATTTACCGGCCGGGCGTGG + Intronic
952047958 3:29346681-29346703 AATGAATTGCTGGCCAGGCGCGG - Intronic
952996638 3:38889507-38889529 AAAGAAATGCTGGCCGGGCGCGG + Intronic
953274478 3:41481535-41481557 AAAGCATTCCTGGCCGGGCGCGG + Intronic
953628141 3:44587761-44587783 AAAGAAATACCAGCCGGGCGCGG + Intronic
953857221 3:46508623-46508645 AGATCATTTCCGGCCGGGCGCGG - Intergenic
953959543 3:47256532-47256554 ACAGGGCGGCCGGCCGGGCGGGG - Intronic
954020330 3:47735043-47735065 AAAAAATTGAAGGCCGGGCGTGG - Intronic
954095068 3:48319851-48319873 ATAAAAATACCGGCCGGGCGCGG + Intronic
954190054 3:48953218-48953240 TCAGAATTGCTGGCCAGGCGCGG - Intronic
954237262 3:49266264-49266286 AAAGAATTGCTGGCCAGGCACGG + Intergenic
954515337 3:51170652-51170674 AAAGATTTGTCAGCCGGGCGCGG + Intronic
954709754 3:52499607-52499629 ACAAACTGGCCGGCCGGGCGCGG + Intronic
955321028 3:57974448-57974470 AAGAAATTCCCGGCCGGGCGTGG + Intergenic
955323642 3:57992969-57992991 ACAGACTTGTAGGCTGGGCGCGG + Intergenic
955342611 3:58137008-58137030 ACTGAAAGGCCGGCCAGGCGTGG - Intronic
955740042 3:62080965-62080987 ACATAATTAGAGGCCGGGCGCGG + Intronic
955911896 3:63865599-63865621 AAGTAATTGTCGGCCGGGCGCGG + Intronic
956703570 3:71980370-71980392 AGAGACTGGCCGGCCGGGCGCGG - Intergenic
956887854 3:73578458-73578480 AAAGAATGGTCGGCTGGGCGCGG - Intronic
957203204 3:77164450-77164472 ACAGCACTGCTGGCCAGGCGGGG - Intronic
957203224 3:77164499-77164521 ACAGCACGGCTGGCCGGGCGGGG - Intronic
957224730 3:77428644-77428666 AAAATATTACCGGCCGGGCGCGG - Intronic
957499180 3:81032002-81032024 TTAAAATTCCCGGCCGGGCGCGG + Intergenic
958020314 3:87986812-87986834 ACACCATTGCAGGCCGGGCATGG + Intergenic
958784492 3:98582779-98582801 AAAGTATTGTGGGCCGGGCGTGG - Intronic
958955443 3:100461019-100461041 GCAGAAGTGACGGCCGGGCGCGG - Intergenic
958992830 3:100867349-100867371 AGAAAATTTCCGGCCGGGCGTGG + Intronic
959030793 3:101297196-101297218 TAAAAACTGCCGGCCGGGCGTGG - Intronic
959049553 3:101512108-101512130 ACAGATTTATTGGCCGGGCGCGG - Intronic
959658904 3:108843239-108843261 ACTAGATTGCCAGCCGGGCGTGG + Intronic
959738602 3:109689566-109689588 AGAGAACTACCGGCCGGGTGCGG - Intergenic
960622924 3:119653765-119653787 AAAGAATTGCTTGCCGGGCGCGG - Intronic
960666205 3:120111522-120111544 ACACACTTCTCGGCCGGGCGCGG + Intergenic
961071466 3:123932806-123932828 ACAAAAATGCTGGCCAGGCGTGG + Intronic
961120721 3:124368165-124368187 ACAGCACGGCTGGCCGGGCGGGG + Intronic
961784376 3:129339689-129339711 ACAGGGTGGCTGGCCGGGCGGGG + Intergenic
962075900 3:132081343-132081365 TAAGATTTGTCGGCCGGGCGCGG - Intronic
962112823 3:132470866-132470888 ACAGGGCGGCCGGCCGGGCGGGG + Intronic
962123624 3:132590535-132590557 ACAGAACTACTGGCCGGGCACGG - Intronic
962225188 3:133600218-133600240 AAAGAATTGCAGGCCAGGCACGG - Intronic
962522734 3:136212216-136212238 ACAGAACTTCTGGCTGGGCGCGG - Intergenic
962586120 3:136844066-136844088 ACAAATTTGCTGGCCGGGCACGG + Intronic
962719277 3:138157762-138157784 AGATAATTTCTGGCCGGGCGCGG - Intergenic
962790918 3:138810935-138810957 AAATAAATGTCGGCCGGGCGCGG + Intronic
963201681 3:142592460-142592482 AGTGAATGGCGGGCCGGGCGCGG - Intergenic
963394363 3:144713959-144713981 AAAGAATTCAAGGCCGGGCGCGG + Intergenic
963497460 3:146083869-146083891 AAAAAATTCCCGGCCGGGTGTGG - Intronic
963892861 3:150655306-150655328 ACAGAATTTCTGGCTGGGCATGG - Intergenic
964110309 3:153080414-153080436 ACATAATTTTGGGCCGGGCGCGG - Intergenic
964280671 3:155061160-155061182 AAAGTATCGCCGGGCGGGCGCGG + Intronic
964353772 3:155830071-155830093 ACAGCAATACAGGCCGGGCGCGG + Intronic
964395205 3:156238131-156238153 AATGGGTTGCCGGCCGGGCGTGG + Intronic
964733217 3:159889804-159889826 AAAGAAAAGCTGGCCGGGCGCGG + Intronic
964747314 3:160024484-160024506 ACAGCATTACTGGCCGGGCACGG + Intronic
964797861 3:160519502-160519524 AAAAAATAGGCGGCCGGGCGCGG + Intronic
965265492 3:166537729-166537751 AGAAAACCGCCGGCCGGGCGCGG + Intergenic
965665823 3:171092236-171092258 ACAGCATTTGCAGCCGGGCGCGG - Intronic
965719449 3:171645592-171645614 TCTGAGTGGCCGGCCGGGCGTGG + Intronic
965783735 3:172315084-172315106 ACGGAATTTACAGCCGGGCGCGG + Intronic
966271665 3:178114933-178114955 ACAAAATTAGCGGCCGGGCGCGG + Intergenic
966358189 3:179104545-179104567 AAATAATTGCCGGCCGGGTGCGG + Intergenic
966402489 3:179562279-179562301 AAAAAATTTCAGGCCGGGCGTGG - Intergenic
966614066 3:181895584-181895606 AAAAAATTGGGGGCCGGGCGCGG - Intergenic
966845291 3:184124340-184124362 ACAGAAAGTTCGGCCGGGCGCGG + Intergenic
967028486 3:185584842-185584864 ACAGCATTCCAGGCCGGGTGTGG - Intronic
967034217 3:185635927-185635949 AAATAATTGCAGGCCAGGCGCGG - Intergenic
967071984 3:185970269-185970291 AAGAAATTCCCGGCCGGGCGAGG - Intergenic
967779173 3:193417830-193417852 AAAAAATTAGCGGCCGGGCGCGG + Intronic
968168530 3:196489144-196489166 ATGGAATTCCAGGCCGGGCGTGG - Intronic
968182965 3:196610729-196610751 ACAAAACTGAGGGCCGGGCGTGG - Intergenic
968368416 3:198205367-198205389 AAAGAAATGGAGGCCGGGCGTGG - Intergenic
968483374 4:847086-847108 AAAAGACTGCCGGCCGGGCGCGG + Intergenic
968670320 4:1846553-1846575 ACATAAATGCTGGCCGGGCACGG - Intronic
968671474 4:1854501-1854523 CAAGAATTGGGGGCCGGGCGCGG + Intronic
968822335 4:2864120-2864142 ACAGAATTTATGGCCGGGCGTGG + Intronic
968924098 4:3538453-3538475 ACAGGGTGGCTGGCCGGGCGGGG + Intergenic
969366955 4:6701416-6701438 AAAGAATTATAGGCCGGGCGCGG - Intergenic
969367050 4:6702009-6702031 TCAGAATTGTTGGCCAGGCGTGG - Intergenic
969418028 4:7073825-7073847 ACAGAATTGTCAGCAGGGAGTGG - Intergenic
969819931 4:9712223-9712245 ACAAAATTGAGGGCCGGGCACGG - Intergenic
970235624 4:13955582-13955604 ATACAATTGCTGGCCGGGCACGG - Intergenic
970497841 4:16645244-16645266 AAAGGATTGGTGGCCGGGCGCGG + Intronic
972427155 4:38944358-38944380 AATGAATGACCGGCCGGGCGCGG - Exonic
972431627 4:38988520-38988542 AAAGAATTTCAGGCCGAGCGCGG - Intronic
972518227 4:39829659-39829681 AAAAAATTTCCGGCCAGGCGCGG + Intronic
973889432 4:55354383-55354405 ACATATTTGCTGGCCGAGCGCGG - Intronic
974256653 4:59465255-59465277 AAATAATTTTCGGCCGGGCGCGG + Intergenic
974712922 4:65625819-65625841 AAAGAATGCGCGGCCGGGCGCGG + Intronic
974860684 4:67517545-67517567 ACTGCATTGTCGGCCGGGTGCGG + Intronic
974911090 4:68120676-68120698 AAAGATTTCTCGGCCGGGCGCGG - Intronic
975082914 4:70301839-70301861 ATACAATTTCTGGCCGGGCGCGG - Intergenic
975496278 4:75039239-75039261 ACACAGTTTCCGGCCGGGTGTGG + Intronic
975555336 4:75658438-75658460 AAAAAAAAGCCGGCCGGGCGCGG + Intronic
975760787 4:77617843-77617865 AAATTATTTCCGGCCGGGCGCGG - Intergenic
975930262 4:79512937-79512959 ACAGAAAAGTTGGCCGGGCGTGG - Intergenic
977245212 4:94622957-94622979 AAAGAAATGGAGGCCGGGCGTGG - Intronic
977371221 4:96139403-96139425 AGAAACATGCCGGCCGGGCGCGG + Intergenic
977691494 4:99916842-99916864 ACATAATTGCCAGCCGGGCGTGG + Intronic
977901805 4:102431052-102431074 AGAGCAGTACCGGCCGGGCGCGG + Intronic
978135348 4:105250970-105250992 ACAGAAGTACAGGCCAGGCGTGG - Intronic
978145304 4:105365345-105365367 AAAGAACTGCCGACCGGGCGTGG - Intergenic
978448467 4:108803459-108803481 ACAGACTAGACGGCCGGGTGCGG + Intergenic
979256841 4:118615090-118615112 AAAGAAATGGAGGCCGGGCGTGG - Intergenic
979270966 4:118761005-118761027 ATAGAATTACCGGCCAGGTGCGG - Intronic
979331508 4:119425455-119425477 AAAGAAATGGAGGCCGGGCGTGG + Intergenic
979544188 4:121921230-121921252 AAAGACTTCCTGGCCGGGCGCGG + Intronic
979937266 4:126713476-126713498 AAAAAATTACCGGCCGGGCTTGG - Intergenic
980105572 4:128585199-128585221 TTAGAAATGCCGGCCGGGTGTGG + Intergenic
980471015 4:133251596-133251618 ACAAAATTTCAGGCTGGGCGTGG + Intergenic
980524465 4:133971399-133971421 AAAGAATTTAAGGCCGGGCGCGG - Intergenic
980852738 4:138402964-138402986 ACAGAATTTCAGGCCAGGCATGG + Intergenic
980937326 4:139238432-139238454 AAAGAATTGGCGGCCGGGCATGG + Intergenic
980973002 4:139584474-139584496 AAAGAATGCCAGGCCGGGCGAGG + Intronic
981408444 4:144399194-144399216 ACATAATACCCAGCCGGGCGGGG + Intergenic
981690738 4:147505936-147505958 AAGAAACTGCCGGCCGGGCGCGG - Intronic
981876213 4:149549223-149549245 AGAAAATTGATGGCCGGGCGCGG + Intergenic
982740569 4:159053244-159053266 AAATAATAGTCGGCCGGGCGCGG - Intergenic
982744725 4:159094757-159094779 AAAAAAATGCAGGCCGGGCGCGG - Intergenic
982744748 4:159094889-159094911 AAAAAAATGCAGGCCGGGCGCGG - Intergenic
982988651 4:162242923-162242945 AAAAAAGTTCCGGCCGGGCGCGG + Intergenic
983026779 4:162747384-162747406 ACTCAATAGTCGGCCGGGCGTGG - Intergenic
983205639 4:164908113-164908135 GCCAAATTGCAGGCCGGGCGCGG + Intergenic
983232548 4:165143724-165143746 ACAGTATTGGTGGCCGGGTGTGG - Intronic
983347208 4:166542451-166542473 AAAGAATTTCAGGCTGGGCGCGG + Intergenic
983648825 4:170018855-170018877 ACAGAACTGCAGGCCTGGCCGGG + Intronic
983728819 4:170967709-170967731 ACTGACGTGCAGGCCGGGCGCGG + Intergenic
983747467 4:171219468-171219490 AAAGAAATGCAGGCCGGGCGTGG + Intergenic
984108859 4:175583318-175583340 AGTTGATTGCCGGCCGGGCGCGG - Intergenic
984372950 4:178890088-178890110 ATAAAATTGAAGGCCGGGCGCGG + Intergenic
984500359 4:180550801-180550823 ACATAAATCTCGGCCGGGCGCGG + Intergenic
984516743 4:180750743-180750765 ACGAAATTAACGGCCGGGCGCGG - Intergenic
984919293 4:184749815-184749837 ACAGAAGTACCGGCCAGGCGCGG + Intergenic
984974291 4:185216809-185216831 ACACTTTTGTCGGCCGGGCGAGG - Intronic
984996226 4:185433010-185433032 AAAGAATTTCTGGCCAGGCGTGG - Intronic
985032719 4:185806746-185806768 ACAGGATTCTAGGCCGGGCGCGG - Intronic
985272130 4:188203614-188203636 GCAGAATTATGGGCCGGGCGCGG - Intergenic
985562835 5:600283-600305 AAAAAATGGGCGGCCGGGCGCGG - Intergenic
986945774 5:13017683-13017705 ATATAAATGTCGGCCGGGCGTGG + Intergenic
987135685 5:14897528-14897550 AGGGAAATTCCGGCCGGGCGAGG + Intergenic
987176376 5:15314994-15315016 AGAGAAGGTCCGGCCGGGCGCGG + Intergenic
987304374 5:16623880-16623902 TCATAATTGACGGCCGGGCACGG - Intergenic
987372117 5:17202928-17202950 AAAGAACTCCCAGCCGGGCGCGG - Intronic
987561149 5:19522602-19522624 GCAGAATTGCACGCCGGGCATGG + Intronic
987771514 5:22311412-22311434 AAACAATTGTGGGCCGGGCGCGG + Intronic
987840056 5:23211714-23211736 AAAGAATGGGGGGCCGGGCGCGG - Intergenic
988240852 5:28606904-28606926 ACAAACATGGCGGCCGGGCGCGG + Intergenic
988461832 5:31446154-31446176 AAATAATTCCAGGCCGGGCGTGG + Intronic
988528484 5:32007206-32007228 CCAGCATGGCAGGCCGGGCGCGG - Intronic
988556428 5:32240108-32240130 AATGAATTGTAGGCCGGGCGCGG + Intronic
988578186 5:32445999-32446021 AAGGAAATGCTGGCCGGGCGCGG + Intergenic
988890699 5:35614072-35614094 AAAAAATTGAGGGCCGGGCGCGG + Intergenic
989225952 5:39028470-39028492 TAAGAATTCCAGGCCGGGCGCGG - Intronic
989294004 5:39802784-39802806 ACCAAATTGCAGGCCAGGCGCGG + Intergenic
990050556 5:51494582-51494604 ATGGGCTTGCCGGCCGGGCGCGG - Intergenic
990181320 5:53163579-53163601 ACAGTATCCTCGGCCGGGCGCGG - Intergenic
990685498 5:58296293-58296315 AGAGACCTCCCGGCCGGGCGCGG + Intergenic
990729526 5:58793266-58793288 TAAGAATTCCTGGCCGGGCGCGG + Intronic
990805032 5:59650963-59650985 AAATAATTGTTGGCCGGGCGCGG + Intronic
991022763 5:61997803-61997825 AAACAATTTTCGGCCGGGCGCGG + Intergenic
991059331 5:62356087-62356109 AAAGCATTCCCGGCTGGGCGTGG - Intronic
991069195 5:62457856-62457878 AGATAAATGCCGGCCGGGCGCGG + Intronic
991377915 5:65985378-65985400 ACAAAATGTCGGGCCGGGCGTGG - Intronic
991712065 5:69417651-69417673 AAAGAATTAGCGGCCGAGCGTGG + Intronic
991727055 5:69546025-69546047 AAATAATTGCCGGCCAGGCGCGG - Intronic
991772181 5:70050565-70050587 ACAAAATAAACGGCCGGGCGCGG + Intronic
991773512 5:70061669-70061691 ACAAAAATTCTGGCCGGGCGTGG - Intronic
991851474 5:70925983-70926005 ACAAAATAAACGGCCGGGCGCGG + Intronic
991852806 5:70937093-70937115 ACAAAAATTCTGGCCGGGCGTGG - Intronic
991867902 5:71081849-71081871 AAATAATTGCCGGCCAGGCGCGG + Intergenic
992919037 5:81493463-81493485 AAAAAATTGCAGGCCGGACGTGG + Intronic
992990903 5:82282563-82282585 AAAAAATTTCTGGCCGGGCGTGG + Intronic
993295518 5:86133939-86133961 ACAGATTTCCAGGCCGGGCGCGG + Intergenic
994060422 5:95470266-95470288 ATTGAATTGTTGGCCGGGCGCGG - Intronic
994199360 5:96955070-96955092 ACATAATTGCAGGCCGGGCGCGG - Intronic
994268593 5:97747763-97747785 AATGAATTGAAGGCCGGGCGGGG - Intergenic
994588203 5:101738688-101738710 ACAGCAATCACGGCCGGGCGCGG + Intergenic
994608975 5:102011881-102011903 AAAATATTGCCGGCCGGGCGCGG + Intergenic
994622253 5:102177346-102177368 ACCGAAAAGCTGGCCGGGCGCGG - Intergenic
995003792 5:107166508-107166530 TAAGAAATGTCGGCCGGGCGCGG + Intergenic
995141000 5:108735026-108735048 TATGAATTGCCGGCCGGGGGAGG + Intergenic
995243918 5:109916060-109916082 AGAGCATTGGAGGCCGGGCGTGG - Intergenic
995680973 5:114718839-114718861 AAGAAATTGTCGGCCGGGCGTGG - Intergenic
995813342 5:116134909-116134931 AAAAAATTGTAGGCCGGGCGCGG - Intronic
995884107 5:116873978-116874000 AAACAGTTGTCGGCCGGGCGCGG - Intergenic
995994564 5:118282972-118282994 CCAGAAGGGGCGGCCGGGCGGGG - Intergenic
996121588 5:119679758-119679780 AGAGACTTCTCGGCCGGGCGCGG - Intergenic
996207809 5:120763422-120763444 ACATTATTGCAGGCCAGGCGTGG - Intergenic
996614075 5:125418914-125418936 AGAAAATTGGGGGCCGGGCGCGG + Intergenic
996616838 5:125452379-125452401 AAAGAAATTCCGGCCGGGCGCGG + Intergenic
996736282 5:126761625-126761647 AAAGAATTGTTGGCCGGGTGCGG + Intergenic
996759628 5:126974185-126974207 ATAGATTTTGCGGCCGGGCGCGG - Intronic
996926016 5:128827580-128827602 AAGAAATTGCTGGCCGGGCGAGG + Intronic
997480152 5:134178499-134178521 ACAGATTTTGGGGCCGGGCGTGG + Intronic
998249517 5:140542401-140542423 ACAGAAGTGGAGGCCGGGCATGG + Intronic
998274974 5:140743841-140743863 ATAGAATTACCGGCAGGGCACGG - Intergenic
998502990 5:142649695-142649717 ACAAAATGTCCGGCCGGGCGTGG - Intronic
998577597 5:143333477-143333499 ACTGTATTGCTGGCCGGGCGCGG + Intronic
998632047 5:143910204-143910226 ACAGGATTAGTGGCCGGGCGCGG + Intergenic
998931491 5:147186257-147186279 AAAAAATTGTCGGCTGGGCGGGG - Intergenic
999312844 5:150563219-150563241 AGAAAATTGCAGGCCAGGCGTGG + Intergenic
999329937 5:150666321-150666343 ATAGAAATGGGGGCCGGGCGCGG + Intronic
999579350 5:153018625-153018647 GTAAAATTGTCGGCCGGGCGCGG + Intergenic
999988595 5:157028125-157028147 ATATATTTGCCGGCCGGGCATGG - Intergenic
1000329674 5:160196861-160196883 ATAGAATTGGAGGCCAGGCGCGG - Intronic
1000700506 5:164443536-164443558 ACAGATATGTCGGCCGGGCGCGG - Intergenic
1000960572 5:167596501-167596523 ATAAAAATGCAGGCCGGGCGCGG + Intronic
1001043702 5:168355201-168355223 ACAGCATTTCAGGCTGGGCGTGG + Intronic
1001393987 5:171403711-171403733 ACAGGGCGGCCGGCCGGGCGGGG + Intronic
1001628970 5:173160522-173160544 ACAGAAATACGGGCCGGGCGTGG - Intronic
1001934958 5:175697171-175697193 AGAGGATGCCCGGCCGGGCGCGG + Intergenic
1002042204 5:176522660-176522682 ACAAAAATGAAGGCCGGGCGTGG - Intergenic
1002286767 5:178167927-178167949 ACAGAGCTACAGGCCGGGCGTGG - Intergenic
1002500735 5:179645780-179645802 ATAAATTTGCCGGCCGGGCGCGG + Intergenic
1002562928 5:180094552-180094574 TCAAAATTACAGGCCGGGCGTGG - Intergenic
1002613811 5:180437904-180437926 AAAGAGTTTCTGGCCGGGCGAGG + Intergenic
1002629605 5:180562448-180562470 AAAGAAGTCCTGGCCGGGCGCGG + Intronic
1002700772 5:181122884-181122906 AAAGAATTGCTGGCCAGGCACGG - Intergenic
1002727637 5:181310594-181310616 AAAGAAATGGAGGCCGGGCGTGG - Intergenic
1003085893 6:3061198-3061220 AAAAAATTGCCGGCCAGGCACGG + Intergenic
1003343396 6:5243061-5243083 GCAGAAATCCTGGCCGGGCGCGG - Intronic
1003666472 6:8116225-8116247 AAAGAAATTGCGGCCGGGCGTGG + Intergenic
1003773701 6:9336406-9336428 AAAGAACTCCAGGCCGGGCGCGG + Intergenic
1003894819 6:10597443-10597465 AGACAATTCCTGGCCGGGCGTGG - Intronic
1003910634 6:10740661-10740683 GCAGAATGGCCAGCCAGGCGTGG - Intergenic
1003919502 6:10819820-10819842 ACAGGATTCATGGCCGGGCGCGG + Intronic
1003935290 6:10969652-10969674 AGATAATTTCCGGCCAGGCGCGG - Intronic
1003972017 6:11308657-11308679 AAAGATGTCCCGGCCGGGCGCGG - Intronic
1004203335 6:13570216-13570238 ACAGAAATTTCAGCCGGGCGTGG + Intergenic
1004660046 6:17702215-17702237 ACACCATTTCTGGCCGGGCGAGG + Intronic
1005156687 6:22814776-22814798 ACAGACTCACAGGCCGGGCGCGG - Intergenic
1005242250 6:23844455-23844477 AAATAATTTCGGGCCGGGCGCGG - Intergenic
1005293959 6:24405813-24405835 AAAGGTGTGCCGGCCGGGCGTGG + Intronic
1005482194 6:26265491-26265513 AAAGAATTTATGGCCGGGCGCGG + Intergenic
1005522136 6:26610842-26610864 AGAGAAATGCCGGCCGGGCGCGG + Intergenic
1005634315 6:27738900-27738922 AAAGAAGAGCGGGCCGGGCGCGG - Intergenic
1005742150 6:28802183-28802205 ACAAAATGGAAGGCCGGGCGCGG + Intergenic
1006179688 6:32147433-32147455 ACAGAATTCACGGCTGGGCACGG - Intergenic
1006246331 6:32740283-32740305 AAAAAATTACTGGCCGGGCGCGG + Intergenic
1006533124 6:34674315-34674337 AAAGATTTGGGGGCCGGGCGCGG - Intronic
1006755888 6:36415150-36415172 AAAGAATTGCCGGCCAGGCGCGG + Intronic
1006859904 6:37164674-37164696 CCAGCATTTTCGGCCGGGCGCGG + Intergenic
1006949705 6:37811403-37811425 AAAGAATTTCAGGCCGGGCACGG - Intergenic
1007091408 6:39187084-39187106 ACAGCAATGACGGCCGGGCACGG + Intergenic
1007546928 6:42701411-42701433 ACAAAAATGACGGCCAGGCGCGG - Intronic
1007570493 6:42886703-42886725 ACTGTATTGCTGGCCGGGCGCGG + Exonic
1008788110 6:55195679-55195701 ACAGTATTCATGGCCGGGCGTGG + Intronic
1008803335 6:55397226-55397248 AAAAAAATGCCGGCCGGGCGCGG + Intronic
1008858927 6:56125307-56125329 AAAGATTTACAGGCCGGGCGCGG - Intronic
1009328226 6:62381160-62381182 AAAGAATTCTTGGCCGGGCGCGG + Intergenic
1009414525 6:63400701-63400723 ACATAAATTTCGGCCGGGCGTGG + Intergenic
1010135919 6:72552754-72552776 ACAGAGTGCCCGGCCGGGTGTGG - Intergenic
1010347426 6:74827682-74827704 ACTGTATAGCTGGCCGGGCGCGG - Intergenic
1010383319 6:75248960-75248982 ACAGAATTTTGGGCCGGGCACGG + Intronic
1010826777 6:80485147-80485169 AGAGTGTTGTCGGCCGGGCGCGG + Intergenic
1011674838 6:89722556-89722578 ACAGGCTTGCTAGCCGGGCGTGG + Intronic
1012313191 6:97754216-97754238 AAAGAATAACCGGCCAGGCGCGG + Intergenic
1012793877 6:103735310-103735332 AAAGAAATTCAGGCCGGGCGCGG + Intergenic
1012875146 6:104717427-104717449 ACAATATTGCTGGCCGGGCGTGG - Intergenic
1013062421 6:106648005-106648027 AAAGTATTGTAGGCCGGGCGTGG + Intronic
1013515930 6:110885962-110885984 AAAGATTTGCCGGCTGGGCACGG + Intronic
1014040364 6:116818242-116818264 AAAGAATTTTCGGCCGGGCGCGG + Intronic
1014127202 6:117790054-117790076 ACCTAATTGTTGGCCGGGCGCGG - Intergenic
1014537194 6:122628325-122628347 AAAGAACTGGAGGCCGGGCGCGG - Intronic
1014556792 6:122848698-122848720 ACAGGGCGGCCGGCCGGGCGGGG + Intergenic
1014556895 6:122848927-122848949 ACAGGGCGGCCGGCCGGGCGGGG + Intergenic
1014715930 6:124864170-124864192 ACATAAGTGCAGGCTGGGCGCGG + Intergenic
1014878290 6:126688555-126688577 AAAAAATTGCCGGCTGGGCGTGG + Intergenic
1015424573 6:133050681-133050703 GAAAAATTGGCGGCCGGGCGCGG - Intergenic
1015476720 6:133664944-133664966 ACGGCATGGCTGGCCGGGCGGGG - Intergenic
1015591403 6:134826349-134826371 AAAGAAATGCTGACCGGGCGCGG - Intergenic
1015606699 6:134963710-134963732 ATAGAACTCTCGGCCGGGCGCGG - Exonic
1015958850 6:138626601-138626623 AAAAAATTGTAGGCCGGGCGCGG + Intronic
1016081886 6:139866702-139866724 AAGAAATTGCCGGCCAGGCGCGG + Intergenic
1016701956 6:147064364-147064386 AAACATTTGCTGGCCGGGCGTGG + Intergenic
1016813313 6:148281630-148281652 AGAAAATTCCAGGCCGGGCGCGG + Intronic
1016819463 6:148334131-148334153 AGATAATAGCAGGCCGGGCGCGG + Intronic
1016819600 6:148335005-148335027 AAAGAATTTGAGGCCGGGCGTGG + Intronic
1017248261 6:152251466-152251488 ATAAAAATGCAGGCCGGGCGCGG + Intronic
1017442423 6:154476164-154476186 ACAGACCTTCGGGCCGGGCGCGG + Intronic
1017460905 6:154649430-154649452 ATGGCATTACCGGCCGGGCGCGG + Intergenic
1017506271 6:155071612-155071634 AAAGAATTATTGGCCGGGCGCGG + Intronic
1017747108 6:157456855-157456877 ACTGAGTTGTGGGCCGGGCGTGG + Intronic
1018048639 6:159988223-159988245 AAAGCATAGCAGGCCGGGCGCGG + Intronic
1018753596 6:166829299-166829321 AATGAATTATCGGCCGGGCGCGG + Intronic
1018871427 6:167786121-167786143 TAAAAATTGCCGGCCGGGCGTGG - Intronic
1018970259 6:168523376-168523398 AAAGAATTACTGGCCGGGCGCGG - Intronic
1019094986 6:169572248-169572270 AAAGAATTCTGGGCCGGGCGTGG + Intronic
1019416417 7:929001-929023 AGAGGAATGCCGGCCGGGCGCGG + Intronic
1019787240 7:2984843-2984865 ACAGAAGCCACGGCCGGGCGTGG - Intronic
1019885747 7:3903434-3903456 AAAAAACTGTCGGCCGGGCGCGG - Intronic
1020015777 7:4830722-4830744 ACAAAATTAGCGGCTGGGCGCGG + Intronic
1020027886 7:4911935-4911957 AAAGGATTGGAGGCCGGGCGCGG - Intronic
1020162452 7:5782557-5782579 AAATAATTGCTGGCCAGGCGTGG + Intergenic
1020201053 7:6080440-6080462 AAAGAATTACTGGCTGGGCGCGG + Intergenic
1020291935 7:6729302-6729324 ATAGAATTTGTGGCCGGGCGCGG - Intergenic
1020611624 7:10404383-10404405 ATAGAATTTCAGGCCAGGCGCGG - Intergenic
1020951891 7:14689459-14689481 AGAGAAGTTTCGGCCGGGCGCGG - Intronic
1020952944 7:14704143-14704165 AAATGTTTGCCGGCCGGGCGCGG + Intronic
1021001119 7:15331634-15331656 TAAGAATTGCCGACCAGGCGCGG + Intronic
1021012910 7:15493663-15493685 AAAGAAATGTGGGCCGGGCGCGG - Intronic
1021344622 7:19509642-19509664 AAAGCATTTCAGGCCGGGCGCGG - Intergenic
1021559583 7:21956536-21956558 ACAGAACTCTTGGCCGGGCGCGG - Intergenic
1022194311 7:28049372-28049394 AAAGGGTTTCCGGCCGGGCGCGG - Intronic
1022342626 7:29483109-29483131 AAAAAAGTGCAGGCCGGGCGCGG - Intronic
1022481515 7:30746479-30746501 AGAGTGTTGCCGGCCAGGCGCGG + Intronic
1023307235 7:38843390-38843412 ACTGAATGACTGGCCGGGCGCGG + Intronic
1023331680 7:39124333-39124355 ATAGAATTGCCAGCTGGGTGCGG - Intronic
1023822805 7:43989292-43989314 AGAGAAGTGGAGGCCGGGCGCGG + Intergenic
1024201325 7:47109596-47109618 AAATAATTTCAGGCCGGGCGCGG + Intergenic
1024479029 7:49844971-49844993 AGTGAATTGCCGGCCGGGTGCGG - Intronic
1024515810 7:50254528-50254550 AAAGGATTCCTGGCCGGGCGCGG + Intergenic
1024813666 7:53242997-53243019 ACAAAAGTGGAGGCCGGGCGCGG - Intergenic
1025148513 7:56526161-56526183 AAAGATTTTCCGGCCGGGCGCGG + Intergenic
1025166242 7:56714827-56714849 AAAGCATTGCCAGCCGGGTGTGG - Intergenic
1025193790 7:56916952-56916974 ACAGGAGTGTAGGCCGGGCGTGG + Intergenic
1025624512 7:63208288-63208310 AAAAAAATGCTGGCCGGGCGCGG + Intergenic
1025702363 7:63831939-63831961 ACAAAATTAGCGGCCGGGCGCGG + Intergenic
1025938868 7:66059134-66059156 AAAAAATTGCTGGCTGGGCGTGG + Intergenic
1025977825 7:66383239-66383261 ACAGAATAATAGGCCGGGCGCGG - Intronic
1026017162 7:66680654-66680676 ACAGAAATTAGGGCCGGGCGCGG + Intronic
1026119114 7:67521202-67521224 ATGGAGTTGCTGGCCGGGCGAGG - Intergenic
1026418803 7:70211357-70211379 AAAGACTTTCTGGCCGGGCGCGG + Intronic
1026510493 7:71023394-71023416 AAAACAATGCCGGCCGGGCGTGG - Intergenic
1026815380 7:73507166-73507188 AAAGACTTGCAGGCCGGGCGTGG - Intronic
1026819035 7:73534411-73534433 ACAAAAATGTAGGCCGGGCGTGG - Intergenic
1026840331 7:73667419-73667441 GCTGACTTGCTGGCCGGGCGCGG - Intergenic
1026908190 7:74076029-74076051 AAACAATTCCAGGCCGGGCGCGG + Intergenic
1027024924 7:74844299-74844321 AAAGAATTTTCGGCCAGGCGTGG - Intronic
1027062840 7:75099820-75099842 AAAGAATTTTCGGCCAGGCGTGG + Intronic
1027651337 7:80872511-80872533 GCTGAATTCTCGGCCGGGCGTGG + Intronic
1027663659 7:81017720-81017742 ACCAAATTGCAGGCCGGGCACGG - Intergenic
1028179476 7:87701851-87701873 ACAGAGATACTGGCCGGGCGCGG + Intronic
1028209150 7:88052205-88052227 AAAAAATTCCCGGCCGGACGCGG + Intronic
1028522686 7:91749087-91749109 TAAGAATTCTCGGCCGGGCGCGG - Intronic
1028746171 7:94329021-94329043 AAAGAAATACAGGCCGGGCGCGG + Intergenic
1029060438 7:97792175-97792197 ACAGAAGTGCGGGCTGGGTGCGG - Intergenic
1029512926 7:101008092-101008114 ATAGAGCTACCGGCCGGGCGCGG - Intronic
1029588653 7:101492404-101492426 ATAGAGTTGCAGGCCGGGCGCGG + Intronic
1029687938 7:102161896-102161918 ATGGAATTTCCGGCTGGGCGCGG - Intronic
1029751069 7:102542707-102542729 AGAGAAGTGGAGGCCGGGCGCGG + Intronic
1029769022 7:102641818-102641840 AGAGAAGTGGAGGCCGGGCGCGG + Intronic
1029995695 7:105005934-105005956 ACAGAACTTTTGGCCGGGCGCGG + Intergenic
1030001742 7:105071745-105071767 TCAAAACTGCAGGCCGGGCGTGG - Intronic
1030042040 7:105460226-105460248 AAAGAATTGTCGGCTGGGCACGG - Intronic
1030052377 7:105549637-105549659 AAAAAATTGCTGGCCAGGCGTGG - Intronic
1030427512 7:109397975-109397997 ACATCTTTGCTGGCCGGGCGCGG + Intergenic
1030507382 7:110442049-110442071 AAAGAACTGCTGGCCGGGCGCGG - Intergenic
1030838114 7:114313453-114313475 AAAATATTGTCGGCCGGGCGCGG + Intronic
1031200083 7:118670918-118670940 ATAAAATTCCCGGCCCGGCGCGG - Intergenic
1031294116 7:119981351-119981373 AAAGAAATGGAGGCCGGGCGCGG + Intergenic
1031525852 7:122820847-122820869 ACAGTAAGGTCGGCCGGGCGCGG - Intronic
1031602742 7:123732035-123732057 ACAGAAAAGGCGGCCAGGCGCGG + Intronic
1032031749 7:128489916-128489938 AAGAAATTGCCGGCCGGGCGCGG - Intronic
1032353163 7:131184814-131184836 AAAGTATTGCTGGCCGGGCATGG - Intronic
1032834988 7:135663932-135663954 ACAGCATTTGGGGCCGGGCGCGG - Intronic
1033052617 7:138020149-138020171 TCAAAAATGTCGGCCGGGCGTGG - Intronic
1033162084 7:139006670-139006692 ATGGAGTTGCAGGCCGGGCGCGG - Intergenic
1033310311 7:140256460-140256482 ACAGAAATTGGGGCCGGGCGTGG - Intergenic
1033386356 7:140880020-140880042 AAGAAATTGCCGGCCGGGCACGG - Intronic
1033437209 7:141343837-141343859 AAAGAGTTCCCGGCTGGGCGCGG - Intronic
1033715287 7:143995722-143995744 AATCAATTGCCGGCCGGGCGCGG - Intergenic
1034157358 7:148966679-148966701 ATAGCATTGCCGGCTGGGCGCGG - Intergenic
1034531987 7:151701551-151701573 TAAGGATTGCCGGCCGGGCGTGG + Intronic
1035161766 7:156955898-156955920 ACATATTTGCCGGCCGGGCGCGG + Intronic
1035204044 7:157283047-157283069 ACAGATCTGGAGGCCGGGCGCGG + Intergenic
1035418982 7:158711451-158711473 AAAAAATTCACGGCCGGGCGCGG + Intergenic
1036039361 8:5057741-5057763 AGAGAATACCAGGCCGGGCGCGG - Intergenic
1036118293 8:5985830-5985852 ACACAACTGAGGGCCGGGCGCGG + Intergenic
1036167287 8:6447837-6447859 ACAAAATTGTTGGCCGGGCGCGG - Intronic
1036400291 8:8401778-8401800 AAACAACTGCTGGCCGGGCGCGG + Intergenic
1036465406 8:8992755-8992777 AAAGAATAGTCAGCCGGGCGTGG + Intergenic
1036589084 8:10151351-10151373 AGAGAACAGCAGGCCGGGCGTGG + Intronic
1036662775 8:10718563-10718585 GAGGAATTGCTGGCCGGGCGCGG - Intergenic
1036936651 8:13009016-13009038 AAAAAATTACCGGCCGGGCGCGG - Intronic
1037298169 8:17423160-17423182 ACTCAATGACCGGCCGGGCGCGG + Intergenic
1037964732 8:23125268-23125290 AAACAAGAGCCGGCCGGGCGCGG - Intergenic
1038138067 8:24812426-24812448 ATAAAAGTGCTGGCCGGGCGTGG + Intergenic
1038469735 8:27804990-27805012 AGAGGCTTCCCGGCCGGGCGCGG + Exonic
1039544341 8:38397847-38397869 AAAGACTTGAAGGCCGGGCGTGG + Intronic
1039738882 8:40361452-40361474 AAATTATTGCCAGCCGGGCGCGG - Intergenic
1039815980 8:41094839-41094861 ATAAAAATGCTGGCCGGGCGCGG - Intergenic
1040000631 8:42573419-42573441 AGAGACTTTCCAGCCGGGCGCGG + Intergenic
1040651946 8:49458600-49458622 AAATATTTTCCGGCCGGGCGCGG - Intergenic
1040824714 8:51608545-51608567 AAAGTATTGCAGGCCGGGCGCGG + Intronic
1040969193 8:53115209-53115231 CAAGAATTGCTGGCCGGGGGCGG - Intergenic
1041098387 8:54372438-54372460 ACAGACATGCAGGCTGGGCGTGG + Intergenic
1041443055 8:57919222-57919244 ACTTATTTTCCGGCCGGGCGCGG + Intergenic
1041689463 8:60675030-60675052 AAAAAATTACAGGCCGGGCGCGG + Intergenic
1041912069 8:63099517-63099539 ACAAAAATGAGGGCCGGGCGTGG + Intergenic
1041969325 8:63719164-63719186 ACATGATTGCCAGCCAGGCGCGG - Intergenic
1042031154 8:64477433-64477455 GCAAAGTTGCCGGCCGGGCGTGG + Intergenic
1043786982 8:84415526-84415548 ACAAGAGTGTCGGCCGGGCGCGG - Intronic
1044112035 8:88286859-88286881 AAAGAGTTCCAGGCCGGGCGTGG - Intronic
1044213746 8:89582237-89582259 AAAGATTTACAGGCCGGGCGCGG - Intergenic
1045113464 8:98955485-98955507 AAAGTATTGGCGGCCGGGCGCGG + Intergenic
1045482866 8:102606643-102606665 AAAGAATTCCCAGCCAGGCGTGG - Intergenic
1045841875 8:106590574-106590596 ACCGTATTGCTGGCCGGGCACGG - Intronic
1045864713 8:106851946-106851968 AAAAAATTACCGGCCGGGCATGG - Intergenic
1046013498 8:108577917-108577939 AGAATATTGTCGGCCGGGCGTGG - Intergenic
1046230405 8:111348201-111348223 ATAAAATTGCAGGCCGGGCCTGG - Intergenic
1046374671 8:113360861-113360883 ACTGAAGTCACGGCCGGGCGCGG - Intronic
1046575760 8:116027009-116027031 ACATAACTACCGGCTGGGCGTGG + Intergenic
1047207577 8:122815795-122815817 TAAAAATTGCCGGCCGGGCGTGG + Intronic
1047239676 8:123074308-123074330 ACTGATTTGTCGGCCAGGCGCGG - Intronic
1047593247 8:126349646-126349668 AAAGAATAGTCGGCCAGGCGCGG + Intergenic
1048605059 8:135959706-135959728 AAGAAATTGCCGGCCGGGCGCGG + Intergenic
1048627543 8:136202257-136202279 AAAAAATTGTCAGCCGGGCGTGG + Intergenic
1049073601 8:140376264-140376286 ACAGTGTTGGAGGCCGGGCGCGG + Intronic
1049152236 8:141042511-141042533 CAAGAATTTCAGGCCGGGCGCGG - Intergenic
1049690253 8:143955184-143955206 ACAGAATTTCAGGCCGGGCACGG + Intronic
1049719383 8:144108576-144108598 TCAGAATTGCCAGCCCCGCGGGG - Exonic
1049759303 8:144324775-144324797 TCTCAATTCCCGGCCGGGCGCGG + Intronic
1049977049 9:870105-870127 AAAGAATAGCTTGCCGGGCGCGG + Intronic
1050336460 9:4594500-4594522 ACACAATTCCCCGCTGGGCGCGG - Intronic
1050374482 9:4956797-4956819 AGAGAATTTGCGGCCGGGCGCGG + Intergenic
1050533142 9:6608121-6608143 AAACAATTGAGGGCCGGGCGGGG + Intronic
1050562399 9:6847678-6847700 AGAGAAGATCCGGCCGGGCGCGG - Intronic
1050604909 9:7290776-7290798 AAAAAAATGACGGCCGGGCGCGG + Intergenic
1050887775 9:10787003-10787025 AAAGAATGTCAGGCCGGGCGCGG - Intergenic
1051191020 9:14513337-14513359 ACAGAAATGAAGGCCGGGTGTGG + Intergenic
1051271173 9:15356295-15356317 AAAGAATTGTGGGCTGGGCGCGG - Intergenic
1051656649 9:19388385-19388407 ATATAATTCACGGCCGGGCGTGG + Intergenic
1051823889 9:21197678-21197700 AATGAAATGTCGGCCGGGCGCGG + Intergenic
1052462530 9:28784661-28784683 AATGAATTGCAGGTCGGGCGCGG + Intergenic
1052959165 9:34279992-34280014 AGAACAGTGCCGGCCGGGCGCGG + Intronic
1053035319 9:34822904-34822926 AAAGATTGTCCGGCCGGGCGCGG + Intergenic
1053162749 9:35824969-35824991 ACAGAAGGGTCGGCTGGGCGCGG - Intronic
1053247390 9:36545788-36545810 AAAGAATAGGCGGCCGGGTGCGG + Intergenic
1053837238 9:42152721-42152743 ACTAAAGTGCAGGCCGGGCGCGG + Intergenic
1055196388 9:73599564-73599586 AAACCATTGCTGGCCGGGCGCGG - Intergenic
1055340876 9:75281319-75281341 AAAGAATTGTTGGCCGGGCGCGG - Intergenic
1056599183 9:88032815-88032837 ACAGAACCCCAGGCCGGGCGCGG - Intergenic
1056743294 9:89278799-89278821 ACACCACTGCAGGCCGGGCGTGG + Intergenic
1056811624 9:89769469-89769491 AAAGAATAGGAGGCCGGGCGCGG - Intergenic
1056980745 9:91309119-91309141 TAAGAATTGCTGGCCAGGCGTGG + Intronic
1056991262 9:91413539-91413561 ATAGTATTGTTGGCCGGGCGTGG - Intronic
1057148887 9:92778523-92778545 AGGGAATTGCTGGCCGGGCACGG + Intergenic
1057586493 9:96333304-96333326 ATGGAATTGTAGGCCGGGCGTGG + Intronic
1057901014 9:98948306-98948328 ACACACTTGTCGGCCGGGCGCGG + Intronic
1058021472 9:100094365-100094387 AAAGTATTCCAGGCCGGGCGTGG + Intronic
1058221860 9:102313309-102313331 AAAAAAAAGCCGGCCGGGCGCGG + Intergenic
1058339598 9:103878219-103878241 TCAGAATTATTGGCCGGGCGCGG - Intergenic
1058457346 9:105149665-105149687 AGAGAATTACCGGCCAGGTGTGG - Intergenic
1058715687 9:107720201-107720223 TCAGAATAGCAGGCCGGGTGCGG - Intergenic
1059011463 9:110466466-110466488 AAAGAACTGGCGGCCGGGCACGG + Intronic
1059108283 9:111530636-111530658 ACAGAACTGCCTGCTGGGTGTGG + Intronic
1059122230 9:111651594-111651616 ACAGAATTGCAGGCTAGGTGCGG + Intronic
1059355027 9:113692120-113692142 ACAGAAATGCAGGCCGGGCGTGG - Intergenic
1059562354 9:115347697-115347719 ATTTGATTGCCGGCCGGGCGCGG - Intronic
1059737372 9:117115733-117115755 AGACAATTGCTGGCCGGGCGCGG + Intronic
1060577151 9:124706804-124706826 ACAAAATTGTTGGCCGGGCGAGG - Intronic
1060633040 9:125177082-125177104 AGAGAATTCCCGGCCGGGCGCGG + Intronic
1060907202 9:127317432-127317454 ACCAAATTCCCAGCCGGGCGTGG + Intronic
1061009601 9:127947115-127947137 ACAGAGTGCCCAGCCGGGCGCGG + Intronic
1061047303 9:128173433-128173455 AAAAATTAGCCGGCCGGGCGCGG - Intronic
1061436940 9:130569753-130569775 AAACAATTTCTGGCCGGGCGCGG + Intergenic
1061534400 9:131238762-131238784 AGAGAATCTCCGGCCGGCCGGGG - Intergenic
1061891261 9:133621703-133621725 ACAGAAATCTTGGCCGGGCGCGG - Intergenic
1062094630 9:134696465-134696487 AAATAATTGCAGGCTGGGCGAGG - Intronic
1062239593 9:135528811-135528833 ACAGAATTCTCGGCTGGACGTGG + Intergenic
1062752757 9:138268072-138268094 AAAGAAATGGAGGCCGGGCGTGG - Intergenic
1203575275 Un_KI270745v1:2847-2869 AAAGAAATGGAGGCCGGGCGTGG - Intergenic
1185562776 X:1072503-1072525 AAAGACATCCCGGCCGGGCGCGG - Intergenic
1185596529 X:1310376-1310398 AAAAAATTGATGGCCGGGCGCGG + Intronic
1185614832 X:1414426-1414448 TTAGCATTTCCGGCCGGGCGGGG + Intronic
1185623963 X:1469599-1469621 ACAGCTTTGCCAGCCGGGCACGG + Intronic
1186244806 X:7608655-7608677 ACAGAGCGGCTGGCCGGGCGGGG + Intergenic
1186407350 X:9315849-9315871 AAAGAATGGGCGGCCGGGCACGG - Intergenic
1186493017 X:9989697-9989719 ACTATATTGCAGGCCGGGCGAGG - Intergenic
1187353163 X:18540975-18540997 AAAGAACTGTCGGCCGGGCGTGG - Intronic
1187679491 X:21752805-21752827 ACAGCATAGTAGGCCGGGCGCGG - Intronic
1187774392 X:22739189-22739211 AAAGAACTCCTGGCCGGGCGTGG - Intergenic
1187886510 X:23893860-23893882 AAAGGATTGCTGGCCGGGCATGG - Intronic
1188499558 X:30810456-30810478 AAAAAATTCACGGCCGGGCGCGG - Intergenic
1188563690 X:31499781-31499803 ACTGAATTCCCGGCTGGGTGTGG - Intronic
1188912243 X:35864405-35864427 AAAGAGTTTCCAGCCGGGCGCGG + Intergenic
1189022406 X:37354681-37354703 AAAGCACTACCGGCCGGGCGTGG - Intronic
1189116898 X:38352049-38352071 AAATAATTGCTGGCCGGGCACGG - Intronic
1189399976 X:40658380-40658402 ACTGAAGTGCAGGCCGGGTGCGG - Intronic
1189810121 X:44773914-44773936 TAAGAATTTCCAGCCGGGCGCGG - Intergenic
1190278827 X:48916556-48916578 ACAAAATTAGAGGCCGGGCGCGG + Intronic
1190294935 X:49020751-49020773 AAAGAGCTCCCGGCCGGGCGCGG + Intergenic
1190370218 X:49733234-49733256 AAAAAATTGCTGGCCGGGCATGG + Intergenic
1190749807 X:53352022-53352044 AAAGAATTACTGGCTGGGCGTGG - Intergenic
1190841286 X:54147023-54147045 AAAGAAAAGCAGGCCGGGCGTGG + Intronic
1192311814 X:70022624-70022646 AAAGAAATGTCGGCCGGGGGTGG - Intronic
1192746931 X:73948442-73948464 ACATGCTTCCCGGCCGGGCGCGG - Intergenic
1192774508 X:74228377-74228399 ACAGAATTGAAGGCCGAGCACGG + Intergenic
1192783215 X:74314768-74314790 ACACAATTGTCGGCCGGGCGCGG - Intergenic
1192815240 X:74583755-74583777 AAACAATTTGCGGCCGGGCGTGG + Intergenic
1193232614 X:79066110-79066132 ACAGAATTTCTGGCCTGGCCTGG - Intergenic
1193362266 X:80591360-80591382 ACAGGGTGGCTGGCCGGGCGGGG - Intergenic
1193426905 X:81350292-81350314 ACTGTAATGTCGGCCGGGCGCGG - Intergenic
1193454714 X:81716388-81716410 ACATAACTGTTGGCCGGGCGCGG - Intergenic
1193753108 X:85372052-85372074 AAAGAATTTGGGGCCGGGCGTGG + Intronic
1193889790 X:87031151-87031173 ACAGAATTTCCAGCCAGGTGCGG - Intergenic
1194222728 X:91215299-91215321 TAAGAAGTGTCGGCCGGGCGCGG - Intergenic
1194392523 X:93337963-93337985 GTATAATTGCTGGCCGGGCGTGG + Intergenic
1194703780 X:97149439-97149461 ATAGGATTTCAGGCCGGGCGCGG + Intronic
1195207190 X:102612957-102612979 ACAAAATTTCAGGCTGGGCGTGG - Intergenic
1195554005 X:106200756-106200778 ACAGAATTGCCGGCCGGGCGCGG + Intronic
1196733759 X:118966577-118966599 AAACAATTGCTGGCCGGGCGCGG - Intergenic
1196796789 X:119508298-119508320 TAAGAATTCCCGGCCGGGTGTGG - Intergenic
1196797996 X:119517785-119517807 ACTGTATTGCTGGCCGGGCGTGG - Intergenic
1197205428 X:123785525-123785547 ACATAATTGATAGCCGGGCGTGG + Intergenic
1197939393 X:131773853-131773875 ATAAAGATGCCGGCCGGGCGCGG - Intergenic
1198185263 X:134248451-134248473 ACAGAATTATAGGCCGGGCATGG - Intergenic
1198550710 X:137742480-137742502 AAGAAATTTCCGGCCGGGCGCGG + Intergenic
1198690859 X:139282757-139282779 AAAGAACTGGAGGCCGGGCGCGG - Intergenic
1198727360 X:139691821-139691843 AAAGAAAAGCCGGCCGGGCTGGG + Intronic
1198777759 X:140198896-140198918 AAAGGAGTGCAGGCCGGGCGTGG - Intergenic
1198780818 X:140233578-140233600 AAAGAAATACAGGCCGGGCGCGG - Intergenic
1199199628 X:145071728-145071750 AAAGAAATCCTGGCCGGGCGCGG - Intergenic
1199288936 X:146084867-146084889 ACATAAATGTCGGCCGGGCGCGG + Intergenic
1199321498 X:146444991-146445013 AGAAAATTTCAGGCCGGGCGTGG + Intergenic
1199353944 X:146838064-146838086 ATAGAATTCCTGGCCGGACGTGG - Intergenic
1199856410 X:151762349-151762371 ACACAGATGCCGGCCGGGCGCGG + Intergenic
1200109109 X:153730210-153730232 ACAGGAATGCAGGCCGGGCGCGG - Intronic
1200379038 X:155815001-155815023 AAAGAATTACTGGCCAGGCGTGG + Intergenic
1201507710 Y:14722575-14722597 ATAGCATTTCCGGCCGGGCGCGG + Intronic
1202037912 Y:20654182-20654204 AAAGAAGTGGCGGCCGGGCGCGG + Intergenic
1202360981 Y:24110175-24110197 TGAGAAATGTCGGCCGGGCGCGG + Intergenic
1202509797 Y:25559943-25559965 TGAGAAATGTCGGCCGGGCGCGG - Intergenic
1202581369 Y:26384652-26384674 ACAGAAATCCAGGCCAGGCGCGG + Intergenic