ID: 1195554887

View in Genome Browser
Species Human (GRCh38)
Location X:106210600-106210622
Sequence CCCCATGAGGTGTGCAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195554887_1195554896 15 Left 1195554887 X:106210600-106210622 CCAGCACTGCACACCTCATGGGG No data
Right 1195554896 X:106210638-106210660 CAGCACGGAGACCCTGGGCCTGG 0: 3
1: 41
2: 263
3: 497
4: 792
1195554887_1195554892 0 Left 1195554887 X:106210600-106210622 CCAGCACTGCACACCTCATGGGG No data
Right 1195554892 X:106210623-106210645 ATCCTGGGCTGCACACAGCACGG No data
1195554887_1195554895 10 Left 1195554887 X:106210600-106210622 CCAGCACTGCACACCTCATGGGG No data
Right 1195554895 X:106210633-106210655 GCACACAGCACGGAGACCCTGGG 0: 7
1: 88
2: 526
3: 804
4: 885
1195554887_1195554894 9 Left 1195554887 X:106210600-106210622 CCAGCACTGCACACCTCATGGGG No data
Right 1195554894 X:106210632-106210654 TGCACACAGCACGGAGACCCTGG 0: 7
1: 97
2: 567
3: 880
4: 1061

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195554887 Original CRISPR CCCCATGAGGTGTGCAGTGC TGG (reversed) Intergenic
No off target data available for this crispr