ID: 1195555078

View in Genome Browser
Species Human (GRCh38)
Location X:106212311-106212333
Sequence TTTCCTTAACCCAGTGGGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195555078_1195555083 1 Left 1195555078 X:106212311-106212333 CCTAACCCACTGGGTTAAGGAAA No data
Right 1195555083 X:106212335-106212357 CCTCATCTTTTCTAGTCATAAGG No data
1195555078_1195555084 20 Left 1195555078 X:106212311-106212333 CCTAACCCACTGGGTTAAGGAAA No data
Right 1195555084 X:106212354-106212376 AAGGCAGACTTCTGAATATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195555078 Original CRISPR TTTCCTTAACCCAGTGGGTT AGG (reversed) Intergenic
No off target data available for this crispr