ID: 1195557687

View in Genome Browser
Species Human (GRCh38)
Location X:106245867-106245889
Sequence CTGTGGGATACATCCCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195557680_1195557687 29 Left 1195557680 X:106245815-106245837 CCTTGATCGCTAATGTTGTTGTG No data
Right 1195557687 X:106245867-106245889 CTGTGGGATACATCCCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195557687 Original CRISPR CTGTGGGATACATCCCTGGC TGG Intergenic
No off target data available for this crispr