ID: 1195557814

View in Genome Browser
Species Human (GRCh38)
Location X:106247289-106247311
Sequence TTCTCCAAGAAAATAACTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195557814_1195557821 29 Left 1195557814 X:106247289-106247311 CCATGAGTTATTTTCTTGGAGAA No data
Right 1195557821 X:106247341-106247363 GAAACTGCCAGCTACTCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195557814 Original CRISPR TTCTCCAAGAAAATAACTCA TGG (reversed) Intergenic
No off target data available for this crispr