ID: 1195558715

View in Genome Browser
Species Human (GRCh38)
Location X:106258092-106258114
Sequence TCCATGGTTTGGAGTAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195558715_1195558720 18 Left 1195558715 X:106258092-106258114 CCTCTTTTACTCCAAACCATGGA No data
Right 1195558720 X:106258133-106258155 ATGCCCGTCTAGAATAGCGAAGG No data
1195558715_1195558723 26 Left 1195558715 X:106258092-106258114 CCTCTTTTACTCCAAACCATGGA No data
Right 1195558723 X:106258141-106258163 CTAGAATAGCGAAGGCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195558715 Original CRISPR TCCATGGTTTGGAGTAAAAG AGG (reversed) Intergenic
No off target data available for this crispr