ID: 1195558718

View in Genome Browser
Species Human (GRCh38)
Location X:106258108-106258130
Sequence TTCATTAGGTCCTTTTTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195558718_1195558720 2 Left 1195558718 X:106258108-106258130 CCATGGAAAAAGGACCTAATGAA No data
Right 1195558720 X:106258133-106258155 ATGCCCGTCTAGAATAGCGAAGG No data
1195558718_1195558723 10 Left 1195558718 X:106258108-106258130 CCATGGAAAAAGGACCTAATGAA No data
Right 1195558723 X:106258141-106258163 CTAGAATAGCGAAGGCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195558718 Original CRISPR TTCATTAGGTCCTTTTTCCA TGG (reversed) Intergenic
No off target data available for this crispr