ID: 1195558718 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:106258108-106258130 |
| Sequence | TTCATTAGGTCCTTTTTCCA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1195558718_1195558720 | 2 | Left | 1195558718 | X:106258108-106258130 | CCATGGAAAAAGGACCTAATGAA | No data | ||
| Right | 1195558720 | X:106258133-106258155 | ATGCCCGTCTAGAATAGCGAAGG | No data | ||||
| 1195558718_1195558723 | 10 | Left | 1195558718 | X:106258108-106258130 | CCATGGAAAAAGGACCTAATGAA | No data | ||
| Right | 1195558723 | X:106258141-106258163 | CTAGAATAGCGAAGGCCTCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1195558718 | Original CRISPR | TTCATTAGGTCCTTTTTCCA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||