ID: 1195558720

View in Genome Browser
Species Human (GRCh38)
Location X:106258133-106258155
Sequence ATGCCCGTCTAGAATAGCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195558717_1195558720 7 Left 1195558717 X:106258103-106258125 CCAAACCATGGAAAAAGGACCTA 0: 14
1: 15
2: 18
3: 7
4: 111
Right 1195558720 X:106258133-106258155 ATGCCCGTCTAGAATAGCGAAGG No data
1195558718_1195558720 2 Left 1195558718 X:106258108-106258130 CCATGGAAAAAGGACCTAATGAA No data
Right 1195558720 X:106258133-106258155 ATGCCCGTCTAGAATAGCGAAGG No data
1195558715_1195558720 18 Left 1195558715 X:106258092-106258114 CCTCTTTTACTCCAAACCATGGA No data
Right 1195558720 X:106258133-106258155 ATGCCCGTCTAGAATAGCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195558720 Original CRISPR ATGCCCGTCTAGAATAGCGA AGG Intergenic
No off target data available for this crispr