ID: 1195574931

View in Genome Browser
Species Human (GRCh38)
Location X:106439003-106439025
Sequence GGGAAGAGGGGAGAAGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195574931_1195574947 23 Left 1195574931 X:106439003-106439025 CCATTCCCTTCTCCCCTCTTCCC No data
Right 1195574947 X:106439049-106439071 CAGGATAAGAAAAGAAAACTAGG No data
1195574931_1195574941 -1 Left 1195574931 X:106439003-106439025 CCATTCCCTTCTCCCCTCTTCCC No data
Right 1195574941 X:106439025-106439047 CTCCCCAATCTGTGGAATCTGGG No data
1195574931_1195574940 -2 Left 1195574931 X:106439003-106439025 CCATTCCCTTCTCCCCTCTTCCC No data
Right 1195574940 X:106439024-106439046 CCTCCCCAATCTGTGGAATCTGG No data
1195574931_1195574942 0 Left 1195574931 X:106439003-106439025 CCATTCCCTTCTCCCCTCTTCCC No data
Right 1195574942 X:106439026-106439048 TCCCCAATCTGTGGAATCTGGGG No data
1195574931_1195574946 4 Left 1195574931 X:106439003-106439025 CCATTCCCTTCTCCCCTCTTCCC No data
Right 1195574946 X:106439030-106439052 CAATCTGTGGAATCTGGGGCAGG No data
1195574931_1195574937 -9 Left 1195574931 X:106439003-106439025 CCATTCCCTTCTCCCCTCTTCCC No data
Right 1195574937 X:106439017-106439039 CCTCTTCCCTCCCCAATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195574931 Original CRISPR GGGAAGAGGGGAGAAGGGAA TGG (reversed) Intergenic
No off target data available for this crispr