ID: 1195574933

View in Genome Browser
Species Human (GRCh38)
Location X:106439009-106439031
Sequence TGGGGAGGGAAGAGGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195574933_1195574942 -6 Left 1195574933 X:106439009-106439031 CCTTCTCCCCTCTTCCCTCCCCA No data
Right 1195574942 X:106439026-106439048 TCCCCAATCTGTGGAATCTGGGG No data
1195574933_1195574947 17 Left 1195574933 X:106439009-106439031 CCTTCTCCCCTCTTCCCTCCCCA No data
Right 1195574947 X:106439049-106439071 CAGGATAAGAAAAGAAAACTAGG No data
1195574933_1195574940 -8 Left 1195574933 X:106439009-106439031 CCTTCTCCCCTCTTCCCTCCCCA No data
Right 1195574940 X:106439024-106439046 CCTCCCCAATCTGTGGAATCTGG No data
1195574933_1195574941 -7 Left 1195574933 X:106439009-106439031 CCTTCTCCCCTCTTCCCTCCCCA No data
Right 1195574941 X:106439025-106439047 CTCCCCAATCTGTGGAATCTGGG No data
1195574933_1195574946 -2 Left 1195574933 X:106439009-106439031 CCTTCTCCCCTCTTCCCTCCCCA No data
Right 1195574946 X:106439030-106439052 CAATCTGTGGAATCTGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195574933 Original CRISPR TGGGGAGGGAAGAGGGGAGA AGG (reversed) Intergenic
No off target data available for this crispr