ID: 1195574934

View in Genome Browser
Species Human (GRCh38)
Location X:106439015-106439037
Sequence ACAGATTGGGGAGGGAAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195574934_1195574946 -8 Left 1195574934 X:106439015-106439037 CCCCTCTTCCCTCCCCAATCTGT No data
Right 1195574946 X:106439030-106439052 CAATCTGTGGAATCTGGGGCAGG No data
1195574934_1195574947 11 Left 1195574934 X:106439015-106439037 CCCCTCTTCCCTCCCCAATCTGT No data
Right 1195574947 X:106439049-106439071 CAGGATAAGAAAAGAAAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195574934 Original CRISPR ACAGATTGGGGAGGGAAGAG GGG (reversed) Intergenic
No off target data available for this crispr