ID: 1195574936

View in Genome Browser
Species Human (GRCh38)
Location X:106439017-106439039
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195574936_1195574947 9 Left 1195574936 X:106439017-106439039 CCTCTTCCCTCCCCAATCTGTGG No data
Right 1195574947 X:106439049-106439071 CAGGATAAGAAAAGAAAACTAGG No data
1195574936_1195574946 -10 Left 1195574936 X:106439017-106439039 CCTCTTCCCTCCCCAATCTGTGG No data
Right 1195574946 X:106439030-106439052 CAATCTGTGGAATCTGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195574936 Original CRISPR CCACAGATTGGGGAGGGAAG AGG (reversed) Intergenic
No off target data available for this crispr