ID: 1195574937

View in Genome Browser
Species Human (GRCh38)
Location X:106439017-106439039
Sequence CCTCTTCCCTCCCCAATCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195574929_1195574937 2 Left 1195574929 X:106438992-106439014 CCCTTTTGACTCCATTCCCTTCT No data
Right 1195574937 X:106439017-106439039 CCTCTTCCCTCCCCAATCTGTGG No data
1195574927_1195574937 26 Left 1195574927 X:106438968-106438990 CCCGAATGAAACTTGATGGTTTT No data
Right 1195574937 X:106439017-106439039 CCTCTTCCCTCCCCAATCTGTGG No data
1195574928_1195574937 25 Left 1195574928 X:106438969-106438991 CCGAATGAAACTTGATGGTTTTA No data
Right 1195574937 X:106439017-106439039 CCTCTTCCCTCCCCAATCTGTGG No data
1195574931_1195574937 -9 Left 1195574931 X:106439003-106439025 CCATTCCCTTCTCCCCTCTTCCC No data
Right 1195574937 X:106439017-106439039 CCTCTTCCCTCCCCAATCTGTGG No data
1195574930_1195574937 1 Left 1195574930 X:106438993-106439015 CCTTTTGACTCCATTCCCTTCTC No data
Right 1195574937 X:106439017-106439039 CCTCTTCCCTCCCCAATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195574937 Original CRISPR CCTCTTCCCTCCCCAATCTG TGG Intergenic
No off target data available for this crispr