ID: 1195574939

View in Genome Browser
Species Human (GRCh38)
Location X:106439024-106439046
Sequence CCAGATTCCACAGATTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195574939_1195574947 2 Left 1195574939 X:106439024-106439046 CCTCCCCAATCTGTGGAATCTGG No data
Right 1195574947 X:106439049-106439071 CAGGATAAGAAAAGAAAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195574939 Original CRISPR CCAGATTCCACAGATTGGGG AGG (reversed) Intergenic
No off target data available for this crispr