ID: 1195574942

View in Genome Browser
Species Human (GRCh38)
Location X:106439026-106439048
Sequence TCCCCAATCTGTGGAATCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195574933_1195574942 -6 Left 1195574933 X:106439009-106439031 CCTTCTCCCCTCTTCCCTCCCCA No data
Right 1195574942 X:106439026-106439048 TCCCCAATCTGTGGAATCTGGGG No data
1195574930_1195574942 10 Left 1195574930 X:106438993-106439015 CCTTTTGACTCCATTCCCTTCTC No data
Right 1195574942 X:106439026-106439048 TCCCCAATCTGTGGAATCTGGGG No data
1195574932_1195574942 -5 Left 1195574932 X:106439008-106439030 CCCTTCTCCCCTCTTCCCTCCCC No data
Right 1195574942 X:106439026-106439048 TCCCCAATCTGTGGAATCTGGGG No data
1195574931_1195574942 0 Left 1195574931 X:106439003-106439025 CCATTCCCTTCTCCCCTCTTCCC No data
Right 1195574942 X:106439026-106439048 TCCCCAATCTGTGGAATCTGGGG No data
1195574929_1195574942 11 Left 1195574929 X:106438992-106439014 CCCTTTTGACTCCATTCCCTTCT No data
Right 1195574942 X:106439026-106439048 TCCCCAATCTGTGGAATCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195574942 Original CRISPR TCCCCAATCTGTGGAATCTG GGG Intergenic
No off target data available for this crispr