ID: 1195574945

View in Genome Browser
Species Human (GRCh38)
Location X:106439029-106439051
Sequence CTGCCCCAGATTCCACAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195574945_1195574947 -3 Left 1195574945 X:106439029-106439051 CCAATCTGTGGAATCTGGGGCAG No data
Right 1195574947 X:106439049-106439071 CAGGATAAGAAAAGAAAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195574945 Original CRISPR CTGCCCCAGATTCCACAGAT TGG (reversed) Intergenic
No off target data available for this crispr