ID: 1195574946

View in Genome Browser
Species Human (GRCh38)
Location X:106439030-106439052
Sequence CAATCTGTGGAATCTGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195574929_1195574946 15 Left 1195574929 X:106438992-106439014 CCCTTTTGACTCCATTCCCTTCT No data
Right 1195574946 X:106439030-106439052 CAATCTGTGGAATCTGGGGCAGG No data
1195574933_1195574946 -2 Left 1195574933 X:106439009-106439031 CCTTCTCCCCTCTTCCCTCCCCA No data
Right 1195574946 X:106439030-106439052 CAATCTGTGGAATCTGGGGCAGG No data
1195574935_1195574946 -9 Left 1195574935 X:106439016-106439038 CCCTCTTCCCTCCCCAATCTGTG No data
Right 1195574946 X:106439030-106439052 CAATCTGTGGAATCTGGGGCAGG No data
1195574936_1195574946 -10 Left 1195574936 X:106439017-106439039 CCTCTTCCCTCCCCAATCTGTGG No data
Right 1195574946 X:106439030-106439052 CAATCTGTGGAATCTGGGGCAGG No data
1195574931_1195574946 4 Left 1195574931 X:106439003-106439025 CCATTCCCTTCTCCCCTCTTCCC No data
Right 1195574946 X:106439030-106439052 CAATCTGTGGAATCTGGGGCAGG No data
1195574934_1195574946 -8 Left 1195574934 X:106439015-106439037 CCCCTCTTCCCTCCCCAATCTGT No data
Right 1195574946 X:106439030-106439052 CAATCTGTGGAATCTGGGGCAGG No data
1195574932_1195574946 -1 Left 1195574932 X:106439008-106439030 CCCTTCTCCCCTCTTCCCTCCCC No data
Right 1195574946 X:106439030-106439052 CAATCTGTGGAATCTGGGGCAGG No data
1195574930_1195574946 14 Left 1195574930 X:106438993-106439015 CCTTTTGACTCCATTCCCTTCTC No data
Right 1195574946 X:106439030-106439052 CAATCTGTGGAATCTGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195574946 Original CRISPR CAATCTGTGGAATCTGGGGC AGG Intergenic
No off target data available for this crispr