ID: 1195574947

View in Genome Browser
Species Human (GRCh38)
Location X:106439049-106439071
Sequence CAGGATAAGAAAAGAAAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195574934_1195574947 11 Left 1195574934 X:106439015-106439037 CCCCTCTTCCCTCCCCAATCTGT No data
Right 1195574947 X:106439049-106439071 CAGGATAAGAAAAGAAAACTAGG No data
1195574932_1195574947 18 Left 1195574932 X:106439008-106439030 CCCTTCTCCCCTCTTCCCTCCCC No data
Right 1195574947 X:106439049-106439071 CAGGATAAGAAAAGAAAACTAGG No data
1195574944_1195574947 -2 Left 1195574944 X:106439028-106439050 CCCAATCTGTGGAATCTGGGGCA No data
Right 1195574947 X:106439049-106439071 CAGGATAAGAAAAGAAAACTAGG No data
1195574933_1195574947 17 Left 1195574933 X:106439009-106439031 CCTTCTCCCCTCTTCCCTCCCCA No data
Right 1195574947 X:106439049-106439071 CAGGATAAGAAAAGAAAACTAGG No data
1195574945_1195574947 -3 Left 1195574945 X:106439029-106439051 CCAATCTGTGGAATCTGGGGCAG No data
Right 1195574947 X:106439049-106439071 CAGGATAAGAAAAGAAAACTAGG No data
1195574936_1195574947 9 Left 1195574936 X:106439017-106439039 CCTCTTCCCTCCCCAATCTGTGG No data
Right 1195574947 X:106439049-106439071 CAGGATAAGAAAAGAAAACTAGG No data
1195574943_1195574947 -1 Left 1195574943 X:106439027-106439049 CCCCAATCTGTGGAATCTGGGGC No data
Right 1195574947 X:106439049-106439071 CAGGATAAGAAAAGAAAACTAGG No data
1195574938_1195574947 3 Left 1195574938 X:106439023-106439045 CCCTCCCCAATCTGTGGAATCTG No data
Right 1195574947 X:106439049-106439071 CAGGATAAGAAAAGAAAACTAGG No data
1195574939_1195574947 2 Left 1195574939 X:106439024-106439046 CCTCCCCAATCTGTGGAATCTGG No data
Right 1195574947 X:106439049-106439071 CAGGATAAGAAAAGAAAACTAGG No data
1195574931_1195574947 23 Left 1195574931 X:106439003-106439025 CCATTCCCTTCTCCCCTCTTCCC No data
Right 1195574947 X:106439049-106439071 CAGGATAAGAAAAGAAAACTAGG No data
1195574935_1195574947 10 Left 1195574935 X:106439016-106439038 CCCTCTTCCCTCCCCAATCTGTG No data
Right 1195574947 X:106439049-106439071 CAGGATAAGAAAAGAAAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195574947 Original CRISPR CAGGATAAGAAAAGAAAACT AGG Intergenic
No off target data available for this crispr