ID: 1195574991

View in Genome Browser
Species Human (GRCh38)
Location X:106439502-106439524
Sequence CTTGTGACAAGTAAAGGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195574991_1195575001 28 Left 1195574991 X:106439502-106439524 CCAACACCTTTACTTGTCACAAG No data
Right 1195575001 X:106439553-106439575 ACACACTGGCTATAGATGGCAGG No data
1195574991_1195574995 -2 Left 1195574991 X:106439502-106439524 CCAACACCTTTACTTGTCACAAG No data
Right 1195574995 X:106439523-106439545 AGAATTCCTGGAATGAGGTGAGG No data
1195574991_1195574994 -7 Left 1195574991 X:106439502-106439524 CCAACACCTTTACTTGTCACAAG No data
Right 1195574994 X:106439518-106439540 TCACAAGAATTCCTGGAATGAGG No data
1195574991_1195574997 14 Left 1195574991 X:106439502-106439524 CCAACACCTTTACTTGTCACAAG No data
Right 1195574997 X:106439539-106439561 GGTGAGGCCACCTTACACACTGG No data
1195574991_1195575000 24 Left 1195574991 X:106439502-106439524 CCAACACCTTTACTTGTCACAAG No data
Right 1195575000 X:106439549-106439571 CCTTACACACTGGCTATAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195574991 Original CRISPR CTTGTGACAAGTAAAGGTGT TGG (reversed) Intergenic