ID: 1195574992

View in Genome Browser
Species Human (GRCh38)
Location X:106439508-106439530
Sequence GGAATTCTTGTGACAAGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195574992_1195574997 8 Left 1195574992 X:106439508-106439530 CCTTTACTTGTCACAAGAATTCC No data
Right 1195574997 X:106439539-106439561 GGTGAGGCCACCTTACACACTGG No data
1195574992_1195575001 22 Left 1195574992 X:106439508-106439530 CCTTTACTTGTCACAAGAATTCC No data
Right 1195575001 X:106439553-106439575 ACACACTGGCTATAGATGGCAGG No data
1195574992_1195575000 18 Left 1195574992 X:106439508-106439530 CCTTTACTTGTCACAAGAATTCC No data
Right 1195575000 X:106439549-106439571 CCTTACACACTGGCTATAGATGG No data
1195574992_1195574995 -8 Left 1195574992 X:106439508-106439530 CCTTTACTTGTCACAAGAATTCC No data
Right 1195574995 X:106439523-106439545 AGAATTCCTGGAATGAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195574992 Original CRISPR GGAATTCTTGTGACAAGTAA AGG (reversed) Intergenic