ID: 1195574996

View in Genome Browser
Species Human (GRCh38)
Location X:106439529-106439551
Sequence AGGTGGCCTCACCTCATTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195574996_1195575001 1 Left 1195574996 X:106439529-106439551 CCTGGAATGAGGTGAGGCCACCT No data
Right 1195575001 X:106439553-106439575 ACACACTGGCTATAGATGGCAGG No data
1195574996_1195575000 -3 Left 1195574996 X:106439529-106439551 CCTGGAATGAGGTGAGGCCACCT No data
Right 1195575000 X:106439549-106439571 CCTTACACACTGGCTATAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195574996 Original CRISPR AGGTGGCCTCACCTCATTCC AGG (reversed) Intergenic