ID: 1195575000

View in Genome Browser
Species Human (GRCh38)
Location X:106439549-106439571
Sequence CCTTACACACTGGCTATAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195574996_1195575000 -3 Left 1195574996 X:106439529-106439551 CCTGGAATGAGGTGAGGCCACCT No data
Right 1195575000 X:106439549-106439571 CCTTACACACTGGCTATAGATGG No data
1195574991_1195575000 24 Left 1195574991 X:106439502-106439524 CCAACACCTTTACTTGTCACAAG No data
Right 1195575000 X:106439549-106439571 CCTTACACACTGGCTATAGATGG No data
1195574992_1195575000 18 Left 1195574992 X:106439508-106439530 CCTTTACTTGTCACAAGAATTCC No data
Right 1195575000 X:106439549-106439571 CCTTACACACTGGCTATAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195575000 Original CRISPR CCTTACACACTGGCTATAGA TGG Intergenic