ID: 1195578964

View in Genome Browser
Species Human (GRCh38)
Location X:106480335-106480357
Sequence CACTTCACTCAGATGGACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195578960_1195578964 7 Left 1195578960 X:106480305-106480327 CCTCAATGTGAGTTAGTCAGCTG No data
Right 1195578964 X:106480335-106480357 CACTTCACTCAGATGGACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195578964 Original CRISPR CACTTCACTCAGATGGACCA TGG Intergenic
No off target data available for this crispr