ID: 1195584602

View in Genome Browser
Species Human (GRCh38)
Location X:106551389-106551411
Sequence CAGCAAACAGCAGTGGTGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195584602_1195584607 13 Left 1195584602 X:106551389-106551411 CCGACCACCACTGCTGTTTGCTG No data
Right 1195584607 X:106551425-106551447 GCCGCTGACTTCCATCCCTCTGG 0: 22
1: 88
2: 109
3: 75
4: 146
1195584602_1195584612 24 Left 1195584602 X:106551389-106551411 CCGACCACCACTGCTGTTTGCTG No data
Right 1195584612 X:106551436-106551458 CCATCCCTCTGGATCTGGCAGGG 0: 13
1: 43
2: 96
3: 162
4: 295
1195584602_1195584610 23 Left 1195584602 X:106551389-106551411 CCGACCACCACTGCTGTTTGCTG No data
Right 1195584610 X:106551435-106551457 TCCATCCCTCTGGATCTGGCAGG No data
1195584602_1195584609 19 Left 1195584602 X:106551389-106551411 CCGACCACCACTGCTGTTTGCTG No data
Right 1195584609 X:106551431-106551453 GACTTCCATCCCTCTGGATCTGG 0: 25
1: 61
2: 115
3: 90
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195584602 Original CRISPR CAGCAAACAGCAGTGGTGGT CGG (reversed) Intergenic
No off target data available for this crispr