ID: 1195592454

View in Genome Browser
Species Human (GRCh38)
Location X:106646159-106646181
Sequence GAAAATAAAAGGATGGTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1294
Summary {0: 1, 1: 5, 2: 33, 3: 156, 4: 1099}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195592454_1195592457 -1 Left 1195592454 X:106646159-106646181 CCTTTTACCATCCTTTTATTTTC 0: 1
1: 5
2: 33
3: 156
4: 1099
Right 1195592457 X:106646181-106646203 CAGTTTACATGTATCTTTATAGG 0: 1
1: 8
2: 50
3: 200
4: 782

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195592454 Original CRISPR GAAAATAAAAGGATGGTAAA AGG (reversed) Intronic
900501999 1:3010728-3010750 GAAAAGAAAAGGAGGTTTAATGG + Intergenic
901611925 1:10505471-10505493 CAAAGGAAAAGTATGGTAAAGGG - Intronic
902109997 1:14070232-14070254 GAAAATTAAAGGGAGGTGAAGGG + Intergenic
902316997 1:15628989-15629011 TAAAATGAAAGGAAGATAAAAGG - Intronic
903609066 1:24596864-24596886 GAAAATCAATTGATGGTATAAGG + Intronic
903876380 1:26476900-26476922 GAAAGTAAATGGCTGGTAACTGG - Intergenic
904822979 1:33257013-33257035 GCAAATAAACGGATTGCAAACGG + Intronic
905082965 1:35341421-35341443 GAAAATAAAATGTTAGTGAATGG - Intronic
906053768 1:42898129-42898151 TAAAGTAAAAGGGTGGAAAAGGG - Intergenic
906076337 1:43054933-43054955 GAAAAAAAAAGGAGCTTAAAGGG + Intergenic
906352509 1:45075559-45075581 GAAAATTAAGGGATTGAAAAAGG - Intronic
906576053 1:46891502-46891524 GATAATAAAAGGATTATAAGAGG + Intergenic
906595867 1:47076084-47076106 GATAATAAAAGGATTATAAGAGG - Intronic
906876976 1:49550137-49550159 AAACTTAAAAGGATGGAAAAAGG - Intronic
907006139 1:50915900-50915922 GAAAAAAAAAGGATTTTTAAAGG - Intronic
907111308 1:51928860-51928882 GAGAACAAAAGGATGAGAAAAGG - Intronic
907143720 1:52213216-52213238 GAAAAATAAAGGAAGGGAAAGGG - Intronic
907236016 1:53048364-53048386 GCAAATAAATGGAATGTAAAAGG - Intronic
907349357 1:53813415-53813437 TAAAGTAAAAGGGTGGAAAAAGG + Intronic
907790639 1:57660168-57660190 GCAAATAAAATGAAGGGAAAAGG + Intronic
907915812 1:58868815-58868837 AAAAAAAAAAGGATGAGAAATGG - Intergenic
907946173 1:59138583-59138605 GAAAAGAAAAGGAAGTAAAAGGG - Intergenic
908317774 1:62950248-62950270 TGAAATAAAAGCATGGTAATAGG + Intergenic
908589981 1:65620553-65620575 GAAAACAAAAGCAAGATAAAGGG + Intronic
908625829 1:66040586-66040608 GAAAATAAAAGATGGGTAAGAGG + Intronic
909194762 1:72604610-72604632 GACAATACAAGGATTTTAAATGG + Intergenic
909324112 1:74327188-74327210 GTAAATAAAAATATTGTAAAGGG + Intronic
909469479 1:76011103-76011125 GAAGATGAATGGATGGAAAAAGG - Intergenic
909486507 1:76179979-76180001 GAAAAGTAAAGCATGGTAAGGGG - Intronic
909524313 1:76605880-76605902 AAAAAAAAAAGGATGGGCAAAGG + Intronic
909691492 1:78412072-78412094 GGAAATTACATGATGGTAAAGGG + Intronic
909756470 1:79231821-79231843 GAAACTTAAATGATGGTATATGG + Intergenic
909894905 1:81056271-81056293 TAAAGTAAAAGTATAGTAAAAGG + Intergenic
910219063 1:84871936-84871958 GAAAAATAAAGCAGGGTAAATGG - Intronic
910295837 1:85644131-85644153 CAAAATAAAAGGATGGAGGAAGG + Intergenic
910801074 1:91146922-91146944 GAAAATAAAGGGCTGGAGAAAGG - Intergenic
911196430 1:94999748-94999770 TAAAATAATAAGATTGTAAATGG - Intronic
911254658 1:95620254-95620276 GAAAAAAAAATGATGACAAAGGG + Intergenic
911567762 1:99483655-99483677 AAAAAAAAAAGAATGCTAAAAGG + Intergenic
911716289 1:101137161-101137183 GAAAATAAACAGATATTAAAAGG - Intergenic
911736883 1:101346665-101346687 GAAAAAAAAAGGGTAATAAAAGG - Intergenic
911790664 1:102012088-102012110 GAAAATAAATTGAAGGTAGAAGG - Intergenic
912600380 1:110925652-110925674 TAAGATAAAAGGATGAGAAAGGG + Intergenic
913029568 1:114886014-114886036 GAAAATATGAGGGTGGGAAAGGG + Intronic
913092368 1:115486122-115486144 AAAAATAAAGGGATGGAGAATGG + Intergenic
913566925 1:120081564-120081586 GAAACTAAATGGAAGGCAAATGG - Intergenic
913631204 1:120711985-120712007 GAAACTAAATGGAAGGCAAATGG + Intergenic
914287679 1:146242271-146242293 GAAACTAAATGGAAGGCAAATGG - Intergenic
914346264 1:146801288-146801310 TAAAGTAAAAGGGTGGAAAAAGG + Intergenic
914548710 1:148693014-148693036 GAAACTAAATGGAAGGCAAATGG - Intergenic
914617970 1:149378697-149378719 GAAACTAAAGGGAAGGCAAATGG + Intergenic
916066110 1:161136984-161137006 GAAAAAAAAAAGGTGTTAAAGGG + Intergenic
916127038 1:161580927-161580949 GAAAATTAAATGATGGTAGGTGG + Intergenic
916136958 1:161662731-161662753 GAAAATTAAATGATGGTAGGTGG + Intronic
916208493 1:162338628-162338650 GAAAATAAAATCATGGTCTATGG + Intronic
917179864 1:172284438-172284460 AGAAAAAAAAGGATGGTAAATGG - Intronic
917841138 1:178979288-178979310 GAAAGCAAAGGGATGGAAAAAGG + Intergenic
917933628 1:179842206-179842228 AAAAAAAAAAGGCTGTTAAAGGG + Exonic
918292931 1:183126494-183126516 AAAAATAAAAGATTGGAAAAAGG - Intronic
918408858 1:184237648-184237670 GAAAAATAAAGCAGGGTAAAGGG + Intergenic
918484905 1:185018594-185018616 AAAAAAAAAAGGAAGGAAAAAGG + Intergenic
918501154 1:185197805-185197827 GACAATAAAAAAATGATAAAGGG - Intronic
918550776 1:185739806-185739828 GAAAATAAAAAGCAGGAAAAGGG + Intronic
918873680 1:190010176-190010198 TAAAATAAAGGGGTGGAAAAAGG + Intergenic
919140745 1:193568320-193568342 AAAAATGAAATGATGGAAAATGG - Intergenic
919288050 1:195590918-195590940 GAAAATAGAAGGATGATTATCGG + Intergenic
919361800 1:196605788-196605810 GAGAAAAAAAGGATTGCAAAGGG + Intronic
919481441 1:198094945-198094967 AAAAACAAAAGGCTGATAAATGG + Intergenic
919579433 1:199352919-199352941 CAAATTTAAAAGATGGTAAATGG - Intergenic
919663064 1:200266825-200266847 TTAAATAAAAGGATGTGAAATGG - Intergenic
920717183 1:208351063-208351085 AAAAAAAAAAGAATCGTAAAAGG + Intergenic
920917672 1:210271115-210271137 AAAAAAAAAAGGTTGGGAAACGG - Intergenic
921151140 1:212404085-212404107 AAAAATAAAAGGATTGGAACAGG - Intronic
921208461 1:212870737-212870759 GAAAGAAAAAAGAAGGTAAATGG - Intronic
921511250 1:216033529-216033551 GAGAATAAAAGAATGATATAAGG + Intronic
921620630 1:217322476-217322498 GAAAATGAAAAGATGGAAAATGG + Intergenic
921631018 1:217433746-217433768 AAAAATAAAATAATAGTAAAAGG + Intronic
921701030 1:218269362-218269384 GAAAATAAAAGGAAGGGAAAAGG + Intergenic
921737651 1:218646734-218646756 GAAATTAATAGGATTCTAAAAGG + Intergenic
921860461 1:220037521-220037543 AAAAATAGAAAGATGGAAAATGG + Intronic
921989962 1:221355038-221355060 GAAAATTGAAGTTTGGTAAATGG + Intergenic
922435223 1:225598686-225598708 AAAAATAAAAGAATGGGAAAAGG + Intronic
923309790 1:232725238-232725260 AAAAAAAAAAGGAAGGGAAAGGG + Intergenic
923394047 1:233543301-233543323 GACAAAATAAGGATGGGAAAGGG - Intergenic
923750509 1:236742172-236742194 GAAAAAAAAAGCAGGGTCAAGGG - Intronic
924812136 1:247412457-247412479 GGAAATAAAATGACGGTCAAAGG - Intergenic
1062943694 10:1444250-1444272 GGAAATAGATGGATGGTGAATGG - Intronic
1062982040 10:1732873-1732895 GCAAATAAAAAGTTGGCAAAAGG - Intronic
1063303000 10:4869330-4869352 GAAATAAACAGGATGGTAATGGG - Intergenic
1063741338 10:8823972-8823994 GAAAATAACTGAATAGTAAAGGG - Intergenic
1064748014 10:18496844-18496866 GAAAAAAAAAGTAGGTTAAAAGG + Intronic
1064938868 10:20710901-20710923 GAAGATTTAAGGATGGAAAAAGG + Intergenic
1064953593 10:20881858-20881880 AATACTAAAAGGATGTTAAATGG + Intronic
1064981290 10:21170148-21170170 AAAAATAAAAGGACAGAAAAAGG - Intronic
1065467522 10:26041244-26041266 GAAAATAAAGGAATGGAAAGAGG - Intronic
1065497201 10:26341748-26341770 GAAAAGAAAAGGAAAGAAAAGGG + Intergenic
1065784838 10:29203595-29203617 GAAAAAAGAAGGAAGGGAAAAGG + Intergenic
1066197971 10:33119871-33119893 CAAAGTAAAAGGAAGATAAAAGG + Intergenic
1066201935 10:33150360-33150382 AAAAATAAAACGATGGCAAAAGG - Intergenic
1066236102 10:33486179-33486201 AAAAAAAAAAGAATGCTAAAAGG + Intergenic
1066424975 10:35299609-35299631 AAAAGTAAAAGGATGAAAAAAGG - Intronic
1066571421 10:36777133-36777155 AAAAAAAAAAGGAAGGGAAAGGG - Intergenic
1067287883 10:44920771-44920793 GAAAATAAAAACATGCAAAATGG - Intronic
1067470054 10:46529795-46529817 CAAAATAAAATGCTGGTAAGAGG - Intergenic
1068127335 10:52856676-52856698 AAAAATAAAGGGATGATATATGG - Intergenic
1068220731 10:54042385-54042407 GAAAATTTAATGTTGGTAAAGGG + Intronic
1068259012 10:54554128-54554150 GAAAATAAAAAGTAGGGAAAAGG - Intronic
1068400823 10:56525821-56525843 GAAAAAAAAAAAGTGGTAAAGGG - Intergenic
1068663109 10:59644542-59644564 GAAAGTGAAGGGATGGAAAATGG - Intergenic
1068671436 10:59727570-59727592 GAAATTAAAAAAATGATAAATGG - Intronic
1068833209 10:61521520-61521542 GAAAAAAAAAAGAAAGTAAAAGG - Intergenic
1069588313 10:69625310-69625332 GAAAGTAAAATGATGGAAAAAGG + Intergenic
1069969891 10:72157943-72157965 GAAACCATAAGGATGGTATAGGG - Intronic
1070953428 10:80448895-80448917 GAAAAGAAAAGGATCCTAATTGG - Intergenic
1071001721 10:80838600-80838622 CACAATAAAAAAATGGTAAAAGG - Intergenic
1071161400 10:82749794-82749816 AAAAAAAAAAAGATGGAAAATGG + Intronic
1071172841 10:82887641-82887663 GACAATTAAAGGAAGGTAAAGGG + Intronic
1071556372 10:86605640-86605662 GAAAGTAAAAGAATAGAAAAAGG - Intergenic
1071586456 10:86827209-86827231 AAAAAAAAAAGTATGTTAAAGGG - Intronic
1071589650 10:86860774-86860796 AAAAAAAAAAAGATGCTAAAAGG + Intronic
1071919783 10:90336453-90336475 GGAAATAGGAGGATGGTAAGAGG + Intergenic
1071973628 10:90933002-90933024 GAAAATAAAGGGATAGACAAAGG + Intergenic
1072235751 10:93452170-93452192 GAAAAAAAAAGGCTGTTAGAAGG + Intronic
1072632886 10:97158882-97158904 GAAAAAAAAAGCATGTCAAATGG + Intronic
1072852292 10:98908699-98908721 AAAAAAAAAAAGATGGTATATGG + Intronic
1072877965 10:99193571-99193593 GAAAATAAAGGGATAGTAAAAGG + Intronic
1072987982 10:100159082-100159104 GAAAGTAAAAGAATGGGAAAAGG + Intronic
1073015270 10:100393930-100393952 GAAAATTAAAGTATGATAACAGG - Intergenic
1073084357 10:100878892-100878914 GAAAAAAAATGGATGCTTAAGGG + Intergenic
1073304218 10:102490245-102490267 AAAAAAAAAAAGATGGTAGATGG + Intronic
1073556119 10:104453444-104453466 GAAAAACAAAAGAAGGTAAAAGG - Intronic
1073616725 10:105003969-105003991 GAGAAAAAAAGGAGGGGAAAGGG - Intronic
1074652656 10:115541661-115541683 GAAAATAAAACGATTGCCAAAGG + Intronic
1074655714 10:115585611-115585633 CAAAATAAAAGGATGGAGGAAGG - Intronic
1075861552 10:125681131-125681153 GGAAATAAGAGGAAGGTCAAAGG - Intronic
1075967224 10:126623460-126623482 GAAAATAAAATGATGTGAGAGGG - Intronic
1076019359 10:127058364-127058386 GAAAATAAAAGGATGGAAATAGG - Intronic
1076186410 10:128453051-128453073 GAAAAAGAATGGATGGAAAAAGG + Intergenic
1076918109 10:133435357-133435379 TAAAGTAAAATAATGGTAAAAGG - Intergenic
1076938106 10:133579434-133579456 TAAAGTAAAATAATGGTAAAAGG - Intergenic
1077766824 11:5166798-5166820 AAAAGTAATAGAATGGTAAATGG - Intronic
1077781876 11:5339096-5339118 GAAAAAGAAAGGATGGTATTTGG + Intronic
1077788336 11:5410180-5410202 GAAATTAAAAGCATCGGAAAAGG + Intronic
1078158783 11:8822033-8822055 GAAAATAAATGTATGTTGAATGG - Intronic
1078201231 11:9185206-9185228 GAAAATAAAAGATTGATAATTGG - Intronic
1078801970 11:14655142-14655164 GGAAATAAAAGAATGGAAAAAGG + Intronic
1078820381 11:14874236-14874258 AAAAATAAAAGGATGGTTAAAGG - Intergenic
1079169843 11:18082560-18082582 GAAAATACAAATATGGAAAAGGG + Intronic
1079273461 11:19011408-19011430 TAAAGTAAAAGGGTGGAAAAAGG - Intergenic
1079442304 11:20527138-20527160 GGAAAAAAAAGGATGGGCAAGGG + Intergenic
1079669521 11:23149847-23149869 GCAAATCAAAGCATGGTAAAAGG - Intergenic
1079699870 11:23531617-23531639 GAAAGTGAAAGGATGGGAAAAGG - Intergenic
1079702823 11:23570320-23570342 GAAAAATAAAGCATGATAAATGG + Intergenic
1079924878 11:26481471-26481493 GAAATTAAAAAGATGATGAAGGG + Intronic
1080083620 11:28252235-28252257 GAAAATATAAAGAAGGGAAAGGG + Intronic
1080649791 11:34212924-34212946 GGAGATAAAAGGCTGGCAAAGGG + Intronic
1080782881 11:35447501-35447523 CAAAATAAAAGGATGGAGGAAGG - Intronic
1080787409 11:35488186-35488208 AAAAAAAAAAAGATGGGAAAGGG - Intronic
1081091254 11:38868475-38868497 GAAAAAAAAAGAATGATACAAGG - Intergenic
1081133663 11:39410825-39410847 TAAAATAAAAGGTTGTTTAATGG + Intergenic
1081272600 11:41104157-41104179 GAAAATGAAAGGTTGGCAACAGG + Intronic
1081738390 11:45421229-45421251 GAAAAGAATAGGAGGGTACATGG - Intergenic
1082224265 11:49683933-49683955 AAAAATAAAAGGAATGTATAAGG - Intergenic
1082294550 11:50423303-50423325 TAAAATAAAAGGATGAGGAAAGG + Intergenic
1082625736 11:55482794-55482816 GAAAATAAGATGTTGGTCAAAGG - Intergenic
1082930886 11:58603797-58603819 GAAAATAGAAGGGGGGAAAAAGG - Intronic
1082983667 11:59147020-59147042 TAAAATAAAAGGATGGTGTAAGG + Intronic
1083231139 11:61320522-61320544 GAAAAAAAAAGTATGGGAAAAGG - Intronic
1083939377 11:65887454-65887476 AAAAAAAAAAGGAGGGGAAAGGG + Intronic
1084252764 11:67913999-67914021 GAAATAAAAAGGATGATTAAAGG + Intergenic
1084300053 11:68243284-68243306 GACAATAAAAGAGTGGTAAGGGG + Intergenic
1084525037 11:69691810-69691832 GAAAACAAAGGGAAGGTTAAAGG - Intergenic
1084715999 11:70873732-70873754 AAAAAAAAAAAAATGGTAAATGG - Intronic
1084855191 11:71979957-71979979 GAAACTAAAAGGGTGGCATATGG - Intronic
1085066992 11:73505571-73505593 AAAAATAAAAGAAGGGCAAAGGG + Intronic
1085246147 11:75102699-75102721 GGAAATAAAAGGAGGATAAAAGG + Intronic
1085981242 11:81729177-81729199 GAACATTATATGATGGTAAAAGG - Intergenic
1086287466 11:85265920-85265942 TCAAATCAAAGGATGGTGAATGG - Intronic
1086624781 11:88935262-88935284 AAAAATAAAAGGAATGTATAAGG + Intronic
1086802512 11:91194552-91194574 GAAAATGAAAGCAAGGGAAATGG + Intergenic
1087024537 11:93636684-93636706 AATAATAAAAGAATGGAAAATGG + Intergenic
1087646099 11:100810204-100810226 AAAAATATAAAGATAGTAAAGGG + Intronic
1087733444 11:101804758-101804780 GCAAATAAAAGTATGCTAACTGG + Intronic
1087892815 11:103554118-103554140 GAAAAGAAAAGGATTTTAAATGG + Intergenic
1088206632 11:107399358-107399380 TAAAATAAAGGGATGGAAAAAGG + Intronic
1088386439 11:109262949-109262971 AAAAACAAAAGAATGCTAAAAGG - Intergenic
1088413314 11:109560972-109560994 CAAGGTAAAAGGATGGAAAAAGG - Intergenic
1088573818 11:111250272-111250294 GAAACTGAGAGGATGGGAAATGG - Intergenic
1088835116 11:113571291-113571313 GACAGTAAAAGGATGAAAAAAGG + Intergenic
1088929437 11:114335592-114335614 GAAAGTAAATGGATGGAGAAAGG + Intergenic
1088998250 11:115023502-115023524 GAAAGTGAAAGGATGGAAAAAGG + Intergenic
1089445335 11:118547722-118547744 GAAAAGAAAAGAAAAGTAAAAGG - Intronic
1089719064 11:120395322-120395344 GTAAGTAAATGGATGGTAAATGG + Intronic
1089750931 11:120650567-120650589 GAAAAGAACAGGATGGTTCAGGG - Intronic
1089798166 11:121000128-121000150 GAAAATAAAAGCAGATTAAAAGG + Intergenic
1090108528 11:123878348-123878370 AAAAATAAAAGAATAGAAAAGGG + Intergenic
1090730156 11:129565864-129565886 AAAAGTAAAAGGAGGGTAAGTGG + Intergenic
1091182157 11:133615445-133615467 GAAAATAAAAGAATGTAAAAAGG - Intergenic
1091738606 12:2943734-2943756 GAAAAAAAAAGAATGTAAAAGGG - Intergenic
1091923472 12:4324311-4324333 AAAAAAAAAAGGAAGTTAAATGG - Intronic
1093054583 12:14543131-14543153 ACAAATAAAGGGATAGTAAATGG - Intronic
1093337464 12:17923538-17923560 GAAAATGAAAGGTTGGATAAAGG + Intergenic
1093488509 12:19679492-19679514 TAAAGTAAAGGGATGGAAAAAGG - Intronic
1093720775 12:22439245-22439267 TAAAATAAAGGGGTGGAAAAAGG + Intergenic
1093753406 12:22827118-22827140 GGAAATAAAAGGGGGGGAAAAGG - Intergenic
1093890977 12:24520778-24520800 GAAAGTGAAAGGATGGGAAAAGG + Intergenic
1093995164 12:25632956-25632978 TAAAGTAAAAGGGTGGAAAAAGG + Intronic
1094113667 12:26886932-26886954 GAAAATAAAAGTATTTTTAAAGG + Intergenic
1094123274 12:26996420-26996442 AAAAATAAAAGGATGTTTCAGGG + Intronic
1094387170 12:29907543-29907565 GAAAAAAAGATGATGGCAAAGGG + Intergenic
1094394198 12:29987876-29987898 GAAAGTAAAATGATGGATAAGGG + Intergenic
1094420029 12:30261014-30261036 GAAAATAATGAGATGGAAAAAGG + Intergenic
1094516682 12:31135497-31135519 GACAATATAAGGAAAGTAAATGG + Intergenic
1094762085 12:33545631-33545653 GAAAAAAAAAGGAGGGAATAAGG - Intergenic
1095139868 12:38648348-38648370 GAAAATAAATGAAAGATAAAAGG + Intronic
1095252191 12:39991699-39991721 AAAAATAATAGGATGGTGAGTGG - Intronic
1095424626 12:42062230-42062252 GAAAAAAAATGGAAGGAAAAGGG - Intergenic
1095500841 12:42837159-42837181 GAACATGATAGGATGATAAAAGG - Intergenic
1095872440 12:47044687-47044709 CAAAACAAAAAGATAGTAAATGG - Intergenic
1095886952 12:47198593-47198615 AAAAAAAAAAGCAAGGTAAACGG + Intronic
1096332022 12:50721859-50721881 GAAAATAAAAGAATGGAGAAAGG + Intronic
1096332141 12:50722859-50722881 GAAAATAAAAGAATGGAGAAAGG - Intronic
1096819327 12:54221538-54221560 GAAAATAAAAGGCAGTAAAAAGG - Intergenic
1096855395 12:54478297-54478319 AAAAAGAAAAAGATGGTAGAAGG + Intergenic
1096957036 12:55536642-55536664 TAAAGTAAAAGGGTGGAAAAAGG + Intergenic
1097132394 12:56822071-56822093 GAAAAGAAAAGGAAAGGAAAAGG - Intergenic
1097201503 12:57282744-57282766 GAAAATAAAAGTGTGGATAAAGG + Intronic
1097300433 12:58012821-58012843 AAAAAAAAAAGGATGTTGAATGG + Intergenic
1097409790 12:59237379-59237401 GAAAAAAACAGGAAAGTAAAAGG - Intergenic
1097423583 12:59413208-59413230 GAACATAAAAGGAGAGAAAAGGG - Intergenic
1097579611 12:61438693-61438715 GAAAAAAAAAAGAGGGAAAAAGG - Intergenic
1097582456 12:61474442-61474464 CAAAATAAAAGGATGGAGGAAGG + Intergenic
1097716648 12:62973172-62973194 GAAAAAAAAAGAATGATAGATGG - Intergenic
1097869709 12:64591041-64591063 GAAGATGAAAGGATGCTAAGAGG + Intergenic
1098047831 12:66420171-66420193 GAAAATAAAAAGAAAGTTAATGG + Intronic
1098840834 12:75476070-75476092 GAAAAGAAAAGGAGGTTTAATGG + Intergenic
1098913197 12:76231590-76231612 GAAAGTGAAAGGATGGAAAAAGG - Intergenic
1098957076 12:76698641-76698663 GAAAAATAAAGGAAGGTAAAGGG - Intergenic
1099049527 12:77766582-77766604 AAAAATAAAAGGATAGTTACAGG + Intergenic
1099287084 12:80726676-80726698 GAAAAAAAAAGAATAGTAATTGG - Intergenic
1099406125 12:82265490-82265512 GAAAATTAAAGCATGTTAAGGGG + Intronic
1099506887 12:83488975-83488997 GAAAATAAAAGCAGAATAAAAGG - Intergenic
1099523542 12:83692707-83692729 GAAAATAAAGGAATGGAAAGAGG + Intergenic
1099587794 12:84543835-84543857 GAAAGTAAAGGGATGGAAAAAGG - Intergenic
1099603023 12:84765591-84765613 GAAAATAAAAAGCTATTAAAAGG + Intergenic
1099938671 12:89159142-89159164 GAATAAAAAAGGATTTTAAAAGG + Intergenic
1100290798 12:93213102-93213124 TAAAATAAAGGGGTGGAAAAAGG - Intergenic
1100292238 12:93228031-93228053 GACAATAATAGCATGGAAAATGG - Intergenic
1100375263 12:94009185-94009207 GAAAATAAAATAATAGTAAAAGG - Intergenic
1100717088 12:97317346-97317368 TCAAATGAAAGTATGGTAAAGGG + Intergenic
1100769350 12:97904280-97904302 GAAAAGAAATGGATGATAAATGG - Intergenic
1100931447 12:99614440-99614462 GAAAAGAAAAGGAAGGGAAGAGG + Intronic
1101272211 12:103159663-103159685 GAAATTAAATGGATGGCAAATGG - Intronic
1101352881 12:103948869-103948891 GGAAACAAAAGGATGTTAAATGG + Intronic
1101553768 12:105787470-105787492 GAAAATTAAAGGAAGGTTAATGG - Intergenic
1101832430 12:108269659-108269681 GAGAAGGAAAAGATGGTAAAGGG + Intergenic
1101894103 12:108742048-108742070 GAAAGTAAAAGGATGGTGGCTGG - Intergenic
1102318274 12:111908042-111908064 GAAAACAAAGAGATGGAAAAAGG + Intergenic
1102434653 12:112911347-112911369 GGAAATAGAGGGATGGAAAAAGG + Intronic
1103102165 12:118187583-118187605 GAAAAAAAATGGAAGGGAAAAGG - Intronic
1103459394 12:121091511-121091533 GAAAAGAAAAGGGTGGACAAAGG + Intergenic
1104244037 12:127019996-127020018 GAAAATAAAAAGATTTAAAAAGG - Intergenic
1104613932 12:130253247-130253269 GAAAATAAAACAGGGGTAAAGGG + Intergenic
1105201000 13:18177613-18177635 GACAGTAAAAGGATGGTCAATGG - Intergenic
1105416201 13:20213831-20213853 AAAAGCAAAAGGATGGAAAAAGG + Intergenic
1105490844 13:20886758-20886780 GAAAATAAAAAGACATTAAAAGG + Intronic
1105841364 13:24256217-24256239 GATAACCAAAGGTTGGTAAATGG + Intronic
1105870404 13:24500016-24500038 GAAAATAATAGGATGAAAATAGG + Intronic
1106663631 13:31828223-31828245 GAAAATGAAAGGATGGGGATTGG + Intergenic
1106694864 13:32162552-32162574 GCAAATTAAAGAATGGGAAAGGG - Intronic
1107120400 13:36789454-36789476 AAAAATAAGAGGACGGGAAAAGG - Intergenic
1107160568 13:37222361-37222383 GAAAGTAAATGGATGGGGAAAGG - Intergenic
1107260960 13:38490574-38490596 GATAATAAAAGTATGTAAAAAGG - Intergenic
1107576184 13:41725198-41725220 GAAAAAAAAAGGCTGGGTAAAGG + Intronic
1107818484 13:44265614-44265636 AAAAGGAAAAGGATGGAAAAGGG + Intergenic
1108255703 13:48608820-48608842 GAAAATAGAGGGATGAAAAAAGG - Intergenic
1108758735 13:53536239-53536261 GAAAGAAAAAGGATTGAAAAAGG + Intergenic
1108995251 13:56723655-56723677 GAAATTAAAAGCATTGTAAATGG + Intergenic
1109240295 13:59878267-59878289 GAAAATAAAAGAATGGAGATGGG + Intronic
1109331019 13:60929798-60929820 GAAGGTAAAAGGAAAGTAAAAGG + Intergenic
1109517835 13:63467314-63467336 GAAAATGAAGGGATAGAAAAAGG + Intergenic
1109638369 13:65153227-65153249 ATAAATAAAAGGATGGAAAAAGG - Intergenic
1110377632 13:74812251-74812273 GAAATTAAAAGGATGATTAGTGG + Intergenic
1110627770 13:77670367-77670389 TAAAATAAAGGGGTGGAAAAAGG + Intergenic
1110662952 13:78079844-78079866 GAAAAAAAAAGAATGGACAAAGG - Intergenic
1110720637 13:78757649-78757671 AAAATTAAAAGTATGTTAAAGGG + Intergenic
1111183593 13:84699745-84699767 AAAAAAAAAAGAATGGTGAATGG + Intergenic
1111319068 13:86600978-86601000 GAAAATAAAAGGTAGGTTAGAGG - Intergenic
1111389027 13:87566690-87566712 TAAAATGAAAGGATGATATACGG + Intergenic
1111608707 13:90576131-90576153 GACAATGGAAGGATGGTGAAGGG - Intergenic
1111825018 13:93257001-93257023 GAAAAAAAAAGCATTGTTAATGG + Intronic
1111877523 13:93915776-93915798 AAAAATAAGAGGGTGGTCAAGGG - Intronic
1111947282 13:94679109-94679131 GAAAACCAAATGCTGGTAAATGG + Intergenic
1112381563 13:98895722-98895744 AAGAATAAAAGGATGAAAAAAGG - Intronic
1112516648 13:100059005-100059027 GAAAGAAAAAGGAAGGAAAAAGG + Intergenic
1112524994 13:100136709-100136731 GATATTAAAAGGATAATAAAAGG - Intronic
1112655657 13:101450091-101450113 AAAAAAAAAAGAATGCTAAAAGG + Intergenic
1112708445 13:102099220-102099242 GAAGATAAATGGATGGAAAAAGG + Intronic
1112945515 13:104921935-104921957 TAAAGTAAAGGGGTGGTAAAGGG + Intergenic
1113019942 13:105873703-105873725 GAAGATAATAAGATGGGAAATGG - Intergenic
1113122502 13:106939330-106939352 GAAAAGAAAATTATGGTAAAAGG - Intergenic
1113415636 13:110126389-110126411 GAAAAGAAAAGGAAAGAAAAAGG - Intergenic
1113444916 13:110357823-110357845 GAAAGTAAAAAGATGTAAAATGG + Intronic
1113514397 13:110881453-110881475 TAAAAAAAAAGGATGATTAATGG - Intronic
1113894618 13:113755625-113755647 GAAAAGAAAAGGAGGAAAAAGGG - Intergenic
1113971045 13:114189174-114189196 GATATTAAAAGGATAATAAAGGG + Intergenic
1114691980 14:24592127-24592149 TAAAGTAAAAGGGTGGAAAAAGG - Intergenic
1114958938 14:27858517-27858539 GAAAACAAAAGCATGAGAAACGG + Intergenic
1115122053 14:29949126-29949148 CTAAACAAAAGGATAGTAAAAGG + Intronic
1115352486 14:32410139-32410161 GAAAAAAAAAGGAGGGGAAGGGG - Intronic
1115372374 14:32632149-32632171 GAAAGGAAAAGTATAGTAAATGG - Intronic
1115457885 14:33625952-33625974 GAGAATGAAAGGATCTTAAATGG + Intronic
1115460924 14:33659853-33659875 AAAAATCAAAGGATGGTCAATGG + Intronic
1115498152 14:34027157-34027179 GAAAAGAAAAGGAGGGGAAGGGG + Intronic
1115867568 14:37764622-37764644 GAAAGTGAAAGGATGGGAAAAGG - Intronic
1115906920 14:38210850-38210872 GAAAATAGAAGGAGGGTCAGAGG - Exonic
1116434464 14:44880684-44880706 AAAAATAAATGGATAGAAAAAGG + Intergenic
1116844351 14:49851447-49851469 GCAGATAAAATGAAGGTAAAGGG - Intronic
1117096591 14:52304815-52304837 GAAATTCAAAGTATGATAAATGG + Intergenic
1117260419 14:54027244-54027266 GGCATTAAAAGGATAGTAAAGGG - Intergenic
1117405373 14:55397014-55397036 GACAAAAGAAGAATGGTAAATGG + Intronic
1117489389 14:56230884-56230906 GAAAATAAAGGGATGGAGGAAGG + Intronic
1117765201 14:59074904-59074926 GAAAAGAAAAGGAAGGGAAGGGG + Intergenic
1117915397 14:60672765-60672787 GACAGCAAAAGGATGGGAAAAGG - Intergenic
1117918153 14:60700288-60700310 GAAAATGAAGGAATGGGAAAAGG - Intergenic
1118073746 14:62275960-62275982 GAAAATAAAGGAATGGGCAAAGG - Intergenic
1118520571 14:66578838-66578860 TGAAAGAAAAGGATGGTAATTGG + Intronic
1118544380 14:66870109-66870131 GAAAATAAAAGGAAAATAGAAGG + Intronic
1118646080 14:67841677-67841699 GAAAATAAAAAAATGGGGAAAGG - Intronic
1118663637 14:68042615-68042637 GGAAACAAAAGCATGGGAAAGGG - Intronic
1119146639 14:72321490-72321512 GAAAATAGAAGGATGAGCAAAGG + Intronic
1120135944 14:80868787-80868809 AAAAATGAAGGGATGGAAAAAGG + Intronic
1120216761 14:81688837-81688859 GAAAATATTAGGATGGGAACAGG - Intergenic
1120307257 14:82786540-82786562 GAAAATCAAAGATTGGTAAAGGG + Intergenic
1120535813 14:85693233-85693255 GAAAAGAAAAGGAAAGGAAAAGG - Intergenic
1120577443 14:86200502-86200524 CACAATAAAAGAATGATAAAGGG - Intergenic
1120651297 14:87136310-87136332 GAAAAGAAAAAGAAGGAAAATGG - Intergenic
1121389236 14:93560115-93560137 GAAACTAAACGGAAGGTACAAGG + Intronic
1121611836 14:95286466-95286488 GGAGATAGAGGGATGGTAAATGG + Intronic
1122014943 14:98787355-98787377 GAAAAAAAAAAGATGGAGAAGGG - Intergenic
1122495391 14:102150590-102150612 GAACAAAAAAGGGTAGTAAAAGG - Intronic
1123969283 15:25490543-25490565 AAAAGTAAAATGATGGAAAAAGG + Intergenic
1123978409 15:25575251-25575273 AAAAAGGAAGGGATGGTAAATGG - Intergenic
1124040284 15:26095680-26095702 GAAAAACAAATGGTGGTAAATGG - Intergenic
1124123917 15:26918802-26918824 GAAAATGAAGGGATGGAAAAGGG - Intronic
1124228649 15:27920252-27920274 GAAAGGAAAAAGATGGAAAAAGG + Intronic
1124245152 15:28063261-28063283 GAAGGTAAAAGAATGGAAAAAGG - Intronic
1124557334 15:30738265-30738287 TAAAGTAAAAGGGTGGAAAAAGG + Intronic
1124879042 15:33624618-33624640 GAAAATAAAAGGGAGAGAAATGG + Intronic
1125157278 15:36602247-36602269 GAAAATAAAAGTTTGGTTATTGG - Intronic
1125268479 15:37912084-37912106 AAAAATAAAAGGAAAGGAAAAGG - Intergenic
1125473140 15:40024188-40024210 AAAAATAAAAGGATGGAGAAAGG - Intronic
1125584762 15:40812610-40812632 GAAAAGAAAAGGTTGAGAAATGG + Intronic
1126065448 15:44822835-44822857 GAAAAAAAAAGTTTGGTGAACGG + Intergenic
1126094385 15:45077757-45077779 GAAAAAAAAAGTTTGGTGAACGG - Intergenic
1126125230 15:45289535-45289557 GAGAATATAGGGATGGTAAAAGG - Intergenic
1126187570 15:45845546-45845568 TAAAATAAAATGATGATTAATGG - Intergenic
1126257252 15:46642562-46642584 GAAAAAAAAAGGATGGTTCGGGG - Intergenic
1126456505 15:48867989-48868011 GACAAGAAAAGCATTGTAAAAGG + Intronic
1126961760 15:54004179-54004201 GAAAGTAGAAGGATGGTTACTGG - Intergenic
1127124507 15:55799206-55799228 GAAGATAAAGGGAGGGAAAAGGG - Intergenic
1127132900 15:55885990-55886012 AAAAACAAAGGGATGGAAAAAGG + Intronic
1127173737 15:56330946-56330968 GAAAATAAAGAAATGGAAAAAGG + Intronic
1127323450 15:57869666-57869688 GAAATTAAAAGGATAGAGAAAGG + Intergenic
1127438750 15:58985408-58985430 GAAAATAAAGGGATGCGCAATGG - Intronic
1127635012 15:60860827-60860849 GAAAATAAAAGGAAGTTCCATGG - Intronic
1127750021 15:62028207-62028229 GAAAAGGAAATGATGGTAGAGGG + Intronic
1127828644 15:62729584-62729606 GAAAGTAAAAGAATGAAAAAAGG - Intronic
1128573299 15:68751677-68751699 GAAAAAAAAAGAAAGGAAAAAGG + Intergenic
1128820336 15:70646671-70646693 GAAAGAAAAAGGTTTGTAAAAGG + Intergenic
1128957730 15:71966207-71966229 GAAAGTAAAAAGATGGAGAAAGG - Intronic
1128999944 15:72323821-72323843 GAAAGTAAAAGGATAGAAAAAGG - Intronic
1129871183 15:78942754-78942776 GGAAATAAAAGGTCTGTAAATGG + Intronic
1130041273 15:80406825-80406847 GTAAAAGAAATGATGGTAAAAGG - Intronic
1130287817 15:82570391-82570413 GAAAATGAAAAGGTGGTAAGGGG - Intronic
1130398532 15:83527567-83527589 AAAAGTAAAGGGATGGAAAAAGG - Intronic
1130629211 15:85549023-85549045 GAAAATTAAAGAAAGGGAAATGG - Intronic
1131152182 15:90054104-90054126 GGAGATAAAAGGAGAGTAAAAGG + Intronic
1131623217 15:94089454-94089476 GAAAAGAAAAGGATGGAAGCAGG + Intergenic
1131632059 15:94187873-94187895 GAAATTAAAAGGATTATTAATGG + Intergenic
1131864974 15:96698485-96698507 GAAAACAAAATGATGGCACAAGG - Intergenic
1132265162 15:100463777-100463799 GCAAAGAAAAGGAAGGTACAAGG - Intronic
1133582285 16:7157360-7157382 GGCAATAAATGTATGGTAAATGG + Intronic
1133754043 16:8748866-8748888 GAAAGTAAAAAGATGGAGAAAGG - Intronic
1133789919 16:9001708-9001730 AAAAAAAAAAGATTGGTAAAGGG - Intergenic
1133848671 16:9481151-9481173 GAAAATAAAATCATGGGTAAAGG - Intergenic
1133855416 16:9544843-9544865 GAAAATTCAAGCATGGTAACTGG + Intergenic
1133988120 16:10683911-10683933 GTAAATAAATGTATGATAAAAGG + Intronic
1134326876 16:13215593-13215615 GACAACAAAAGGATGATATAAGG - Intronic
1135415021 16:22262600-22262622 GAAAAACAAAGGCTGGTTAAGGG - Intronic
1135823849 16:25708838-25708860 AAAAATGGAAGGATGGGAAAAGG - Intronic
1136130969 16:28221042-28221064 GAATTTAAAAGGAAGGGAAAGGG - Intergenic
1137003245 16:35250343-35250365 GAAAATAAAAAGCAGATAAATGG + Intergenic
1137028890 16:35503797-35503819 GAGGACAAAAGGAAGGTAAAGGG + Intergenic
1137032752 16:35539283-35539305 GAAAATAAAAAGCAGATAAATGG + Intergenic
1137219814 16:46437479-46437501 GAAGAAAAGAGAATGGTAAAAGG - Intergenic
1137224362 16:46489071-46489093 ACAAAAAAAAGAATGGTAAATGG + Intergenic
1137552587 16:49450285-49450307 AAAAGTAAAAGGATGGAAAAAGG - Intergenic
1137688878 16:50406373-50406395 AAAAAAAAAAGAATGATAAATGG - Intergenic
1137990823 16:53153254-53153276 GAAATTGAAAGGATAATAAATGG + Intronic
1138020602 16:53476823-53476845 GAAAATGAAAGGATGGAAAGAGG - Intronic
1138777866 16:59746324-59746346 GAAAATAAAACAATTTTAAAAGG - Intronic
1138806633 16:60097757-60097779 GAAAACAAAGGGATGGAAAAAGG - Intergenic
1138845166 16:60556135-60556157 ATAAATAACAGGATGGTATAGGG - Intergenic
1138858449 16:60724429-60724451 GAAAAAGAAAGGAAGGTATATGG - Intergenic
1139089060 16:63621419-63621441 GGAAATAATTCGATGGTAAAAGG - Intergenic
1139706168 16:68742273-68742295 AAAAAAAAAAGGAGGGGAAATGG - Intronic
1139987716 16:70913980-70914002 TAAAGTAAAAGGGTGGAAAAAGG - Intronic
1140340252 16:74151796-74151818 GAAAATAAAAGCATGGGAAATGG - Intergenic
1140459156 16:75124793-75124815 AAAAAAAAAAGCAAGGTAAAAGG + Intergenic
1140492594 16:75351698-75351720 GAAAATAAAAGGATATGAAAAGG + Intronic
1140621554 16:76740471-76740493 GAAAATATAAAGATACTAAATGG - Intergenic
1140723940 16:77795365-77795387 GAAAATAAAAGCGAAGTAAATGG + Intronic
1140903169 16:79389135-79389157 GAAAATAAAAGTTTGGCAAGAGG - Intergenic
1141217839 16:82041975-82041997 GAAAAGAAAAGAAAGGGAAAAGG - Intronic
1141921171 16:87136462-87136484 AAAAAAAAAAAGATGTTAAAAGG + Intronic
1142649367 17:1337221-1337243 GAAAATATAGAGATGGCAAATGG + Intergenic
1143763914 17:9125055-9125077 AAAAATAAAAGGTGGATAAAAGG - Intronic
1143991025 17:10961724-10961746 TAAAGTAAAGGGATGGAAAAAGG + Intergenic
1144064696 17:11614356-11614378 GAAGAAAAAAGGAGGTTAAAAGG + Intronic
1144309827 17:14002744-14002766 GATAATAAAAGTATAGAAAAAGG + Intergenic
1145342493 17:21967181-21967203 GAAATGAAAACGAAGGTAAATGG + Intergenic
1145894725 17:28448304-28448326 GAAAGTAAAAGGATGGAAAAAGG + Intergenic
1146759282 17:35462074-35462096 GAAAATAAAATGATGGAAAAAGG - Intergenic
1147204687 17:38828342-38828364 AAAAATAAAAGGAAGAAAAAAGG + Intergenic
1147268841 17:39252543-39252565 AAAAATATAAGGATGCCAAAAGG + Intergenic
1147451172 17:40505466-40505488 GAAAATAAAAGGGAGGCAAAGGG - Intergenic
1147720865 17:42538482-42538504 GCAGGTAAAAGGATGGAAAAGGG + Exonic
1148470647 17:47891007-47891029 GAAAATCATAGGAGGGGAAAAGG + Intergenic
1148828596 17:50413798-50413820 AAAATTAAAAAGATGATAAATGG - Intergenic
1148972553 17:51497092-51497114 GCAAATAGAAGAATAGTAAATGG - Intergenic
1149155385 17:53622976-53622998 GTAAATAAAAGGAAGAGAAATGG - Intergenic
1149186984 17:54009626-54009648 AAAAACAAAAGGAAGGTAAGAGG - Intergenic
1150554348 17:66240318-66240340 GAAAAAAAAAGGATGGAGGAAGG + Intronic
1150945280 17:69739362-69739384 TAAAGTAAAAGGGTGGAAAAAGG - Intergenic
1151014572 17:70539744-70539766 GGAAGTAAAAGGAATGTAAAAGG - Intergenic
1151490222 17:74428388-74428410 CAAAGAAAAAGGATGGTAAGAGG + Intronic
1152314102 17:79570155-79570177 GATAATAGATGGATGGTAGATGG + Intergenic
1203192878 17_KI270729v1_random:205755-205777 GAAAATAAAAAGATGATTGAAGG - Intergenic
1203202242 17_KI270730v1_random:5190-5212 GAAAATAAAAAGATGATTGAAGG - Intergenic
1153398942 18:4660653-4660675 AAAAATTAAAGGATTTTAAATGG + Intergenic
1153400671 18:4680905-4680927 TAAAGTAAAGGGATGGAAAAAGG + Intergenic
1153609528 18:6869241-6869263 AAAAAAAAAAGAATGGCAAAAGG - Intronic
1154100597 18:11469383-11469405 GAAAAAAAAAGGATAGGAAATGG + Intergenic
1154457991 18:14547529-14547551 GAAAGTAAAAGGAGGAAAAATGG - Intergenic
1155520220 18:26660426-26660448 GAAAAAAAAAGGAAGTTAGATGG - Intergenic
1155539480 18:26853206-26853228 GATAATAAAAAGATAGTATAAGG + Exonic
1155556644 18:27027217-27027239 GAGAATACAAGGATAGGAAAAGG + Intronic
1155687174 18:28569078-28569100 GGAAATAAAAGCAAGGTAATTGG + Intergenic
1155876403 18:31095303-31095325 GAAAACAAAAGGACAGTCAATGG + Intronic
1155884302 18:31188608-31188630 CAATATAAAAGGATTGGAAAAGG - Intergenic
1155963362 18:32014320-32014342 AAAAATAAAAGCATGGATAAAGG + Intergenic
1156011121 18:32499224-32499246 TAAAGTAAAGGGATGGAAAAAGG - Intergenic
1156017055 18:32558864-32558886 TAAAATAAAAGGATTGTTATAGG - Intergenic
1156060356 18:33066638-33066660 GAAAGTGAAGGGATGGAAAAAGG + Intronic
1156124289 18:33884202-33884224 GAAGATAAAAGGATGCAAAATGG - Intronic
1156149687 18:34226354-34226376 GAAAATATAAATAAGGTAAAAGG - Intergenic
1156290532 18:35745772-35745794 CAAAATTAAAAGATGTTAAAAGG - Intergenic
1156443549 18:37216866-37216888 GGCAATCAAAGAATGGTAAAGGG - Intronic
1156479447 18:37426971-37426993 AAAAAAAAAAAGATGGTCAAGGG + Intronic
1156530752 18:37812801-37812823 GAAAATAAAATGTTTATAAATGG - Intergenic
1156585957 18:38431350-38431372 AAAAATAAAACTATGGTAATCGG + Intergenic
1156647513 18:39184084-39184106 GAAATTAAAAGCAAAGTAAAGGG + Intergenic
1156727859 18:40150892-40150914 GTAAATAAAATGGTGGTATAGGG - Intergenic
1156728944 18:40166235-40166257 GAAAATAAAAAGAAAGAAAATGG + Intergenic
1156877737 18:42036205-42036227 GAAAACAAAAACATGGAAAATGG - Intronic
1157092918 18:44657807-44657829 GAAAACAAGAGGATGGATAATGG - Intergenic
1157116442 18:44866721-44866743 GAAAATAAAAGGCTGGGATGAGG - Intronic
1157178183 18:45470302-45470324 GAAAACAAAAGGAAGGAAAAAGG - Intronic
1157510658 18:48269997-48270019 GAAAATAAAGTAATGGAAAAAGG + Intronic
1157903804 18:51547386-51547408 GAAAATAGAATGATGGTTACTGG - Intergenic
1158056175 18:53283986-53284008 GAAAATAAAATGATAATACATGG - Intronic
1158146291 18:54317015-54317037 GAAAAGATAATGATGGAAAAAGG - Intronic
1158629292 18:59098369-59098391 GAGAGTAGAAGGATGGTAACTGG + Intergenic
1158783316 18:60678215-60678237 GAAGATAAAGGGAAGGGAAAAGG + Intergenic
1159112248 18:64073031-64073053 GAAAAAAAAAAGATAGAAAAAGG - Intergenic
1159258687 18:65981447-65981469 GAAAATAAAAGAAAGAAAAATGG - Intergenic
1159480349 18:68982369-68982391 GAAAGTAGAAGGATAGTTAAGGG - Intronic
1159564439 18:70032466-70032488 CAAAATAAAGGGATGGAAAAAGG + Intronic
1159648312 18:70945917-70945939 GAAAATAAAGAGATGGAAAAAGG + Intergenic
1159794014 18:72820534-72820556 AAAACTTACAGGATGGTAAAAGG + Intronic
1159997769 18:74982971-74982993 GAAAATTAAATGATGATAAAAGG - Intronic
1160138187 18:76292905-76292927 GAAATTCAAAGGATGATTAATGG - Intergenic
1160156461 18:76437432-76437454 GAAAAAAAAAATATGGTCAAGGG - Intronic
1160451867 18:78971869-78971891 GAAAATGAGAGGCTGGAAAAGGG - Intergenic
1160472778 18:79153153-79153175 GTAAATAAATGGATAATAAATGG - Intronic
1161179346 19:2869018-2869040 GAATATAAAAGAGTGATAAAGGG - Intronic
1162466751 19:10846698-10846720 GACATTAAAAGGATAGTAAGGGG + Intronic
1163101376 19:15099133-15099155 GAAAAGAAAGGGAAGGGAAAGGG + Intergenic
1163781818 19:19254214-19254236 AAAAAAAAAAAAATGGTAAATGG + Intergenic
1164510683 19:28894580-28894602 GAAAAAAAAAAGAAGGTAATTGG - Intergenic
1164659961 19:29955639-29955661 GAAAAGAAAAAAATGGTAACTGG - Intronic
1164673156 19:30084610-30084632 GAAAAGAAATGGATGGTGAGGGG - Intergenic
1164796246 19:31033953-31033975 AAAAATAAAAGAATGGGAAAAGG - Intergenic
1165197427 19:34115864-34115886 AAAAATAAAAAGATGGGCAAAGG + Intergenic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
1167218193 19:48179150-48179172 GAAAATAAAAGAAAGGGAATAGG - Intronic
1167675738 19:50884102-50884124 GAAAACACAAGGGTGGTAAAAGG + Intergenic
1167978046 19:53247818-53247840 TATAATAAAAGGATGTAAAAAGG - Intronic
1168452167 19:56475135-56475157 GAAAAGTAAAGCAGGGTAAAGGG - Intronic
1168514224 19:56997307-56997329 GAAAAAAAAAGGTTGATCAAAGG + Intergenic
924983649 2:247343-247365 GGAAAGAAAAGGAAAGTAAATGG + Intronic
925009662 2:473152-473174 GAAAGTAAAAGTATGGAAAAGGG + Intergenic
925453112 2:3988870-3988892 AAAAATAAAAAGATAGGAAATGG - Intergenic
925813725 2:7726823-7726845 AAAAAAAAAAAGATGGTAGATGG + Intergenic
925850353 2:8075592-8075614 GAAAAAAAAAAAATGGGAAAAGG + Intergenic
925882645 2:8365728-8365750 AAAAAAAAAAGGATGGAGAAAGG - Intergenic
926177031 2:10602898-10602920 TAAAATAAAAGAATGGTATTTGG + Intronic
926536532 2:14120013-14120035 AAAAATAAAGGAATGCTAAAAGG + Intergenic
926800791 2:16658728-16658750 GAAAAGAAAAGGAAGAGAAAAGG - Intronic
926896700 2:17698574-17698596 GAAAGTAAAAGGATGGAAAATGG - Intronic
927064912 2:19461620-19461642 GAAAATAATAGTAATGTAAATGG - Intergenic
927315760 2:21679791-21679813 GAAAGTAAAAGGATGGAAAAAGG + Intergenic
927333161 2:21890152-21890174 CCAGATAAAAGGAGGGTAAAGGG + Intergenic
927441830 2:23124261-23124283 GAAAGTAAAAGGATGGTAAAGGG - Intergenic
927486036 2:23489038-23489060 GAAAATAAAAGTATTGTTTAGGG + Intronic
927531927 2:23813755-23813777 TAAAATAAAAGGAAGAGAAATGG + Intronic
927764792 2:25796728-25796750 TAAAATAAAAGCATCCTAAAAGG + Intronic
928077236 2:28276181-28276203 AAGAATAAAGAGATGGTAAAAGG + Intronic
928416979 2:31102976-31102998 GAAAATAAAAGGATGAGTGAAGG - Intronic
928737608 2:34310376-34310398 AAAAGTAAAAGCAAGGTAAATGG + Intergenic
929159943 2:38821835-38821857 GAAATAAAAAGGATTATAAAGGG + Intronic
929492919 2:42412871-42412893 AAAAATAAAGGAATGGAAAAAGG - Intronic
929514679 2:42596018-42596040 GAAAATAAAAGAACAATAAAAGG + Intronic
929541048 2:42822217-42822239 GAAAATAAAGGGATGGAAAAAGG - Intergenic
929659664 2:43771033-43771055 GAAAGTAAGACGTTGGTAAAAGG - Intergenic
929661973 2:43795638-43795660 GGAAATAAAAGGGTAGAAAAAGG + Intronic
929850571 2:45585153-45585175 AAAAAAAAAAAGATGGGAAAAGG + Intronic
930246292 2:48986381-48986403 AAAAAAAAAAGCATGGCAAATGG - Intronic
930288476 2:49464974-49464996 AAAAATAAAGGGATGAAAAAAGG - Intergenic
930293145 2:49520706-49520728 GTAAATAAAAGAATGGCAACGGG + Intergenic
930323893 2:49888556-49888578 GAAAATAAAATGAGGCTACACGG - Intergenic
930880529 2:56265039-56265061 GAAAAATAAAGGAAGGTAAGGGG - Intronic
930922190 2:56769425-56769447 GAAAAAAAAAACATGGTATATGG + Intergenic
931136187 2:59404056-59404078 GAAAATTATATGATGATAAAAGG + Intergenic
931256123 2:60574627-60574649 GAAAATAACAGTATGAAAAATGG + Intergenic
931261330 2:60622140-60622162 GAAAATAGAGGGGTGGGAAAAGG - Intergenic
931387734 2:61812165-61812187 GAAAAATAAAGCAAGGTAAAGGG - Intergenic
932889785 2:75582690-75582712 GAAAATAAAGGAATAGAAAAAGG + Intergenic
932889835 2:75583722-75583744 GAAATTAAAAGGATCATTAAAGG + Intergenic
933016583 2:77135986-77136008 GAAAAAAAAAGGGTATTAAAAGG + Intronic
933373601 2:81449641-81449663 GAAAATAAAATGTTGGAAGAGGG + Intergenic
933745978 2:85571612-85571634 GAAAAGAAAAAGATGGCCAAGGG + Intronic
933873875 2:86598627-86598649 ATAAATAAAAGTTTGGTAAAGGG + Intronic
934142218 2:89057942-89057964 GAATATAAAAGGAAGGAAAATGG + Intergenic
934227022 2:90142607-90142629 GAATATAAAAGGAAGGAAAATGG - Intergenic
934724494 2:96606772-96606794 GCAAACAAAAGAATGGAAAAAGG + Intronic
935020881 2:99230165-99230187 CAAAATAAAGGAATGGAAAAAGG + Intronic
935023145 2:99251101-99251123 GAGAGTAAGAGGAAGGTAAAGGG + Intronic
935089258 2:99878627-99878649 TAAAATAAAAACATAGTAAATGG + Intronic
935350167 2:102145593-102145615 TAAATTAAAAGTAGGGTAAAAGG + Intronic
935464405 2:103379358-103379380 GAAAATAAATACATGGGAAATGG - Intergenic
935712964 2:105915510-105915532 GAAACTGAAAGGGTGGGAAAGGG + Intergenic
935799884 2:106685052-106685074 GAAAGTAAAAGGATGGAAAATGG - Intergenic
935851646 2:107227878-107227900 GAAAGTAAAAGGAAGGACAAAGG - Intergenic
935975775 2:108576986-108577008 GAAAATCAAACAATGGTATAAGG - Intronic
935989877 2:108709560-108709582 GAAAATAAAGGGATTGGGAAAGG + Intergenic
936164651 2:110109337-110109359 TAAAGTAAAAGGGTGGAAAAAGG + Intronic
936526726 2:113246517-113246539 GAAACTAAAAGAAGGATAAATGG + Intronic
936619352 2:114079279-114079301 AAACAAAAAAGGAAGGTAAAGGG - Intergenic
936828854 2:116615740-116615762 AAATATGAAAGGATGGAAAAAGG + Intergenic
936885276 2:117302702-117302724 GAAAATGAAGGGATGGCAAAAGG + Intergenic
937157336 2:119730395-119730417 GAGTATAACTGGATGGTAAAAGG - Intergenic
937329083 2:121012879-121012901 GAAAATGAAAGGATGGGGAAAGG + Intergenic
937351676 2:121168606-121168628 AAAAGTAAAAGGATGGAAAAAGG - Intergenic
937561822 2:123233741-123233763 GAAAGTAAAAGGATGAGAAAAGG - Intergenic
937607517 2:123819259-123819281 GAAAAACAAAGAATGGTATAGGG - Intergenic
937654954 2:124364299-124364321 GGAAATAAAAGGGGGGTTAAAGG - Intronic
938047005 2:128130750-128130772 GAAAATAAAAGGATAAAATAAGG - Intronic
938048843 2:128148744-128148766 GAAAAAAAAAGGCTGGGGAATGG - Intronic
938704366 2:133909016-133909038 GAAAGTAAAAGGATGGAAAATGG + Intergenic
938872307 2:135492328-135492350 GAAAATAAAAAGATGGTTAAAGG + Intronic
938941744 2:136175715-136175737 GAACATAAAAAGCTGGTAGACGG + Intergenic
939157092 2:138538540-138538562 GAAAGTGAAAGGATGAAAAAAGG - Intronic
939482279 2:142764006-142764028 GAAAGTAAAAAAATGGAAAAAGG + Intergenic
939726947 2:145732401-145732423 GAAAATAAAAGAAAGGAAAAAGG + Intergenic
940047940 2:149429644-149429666 GAAAATAAAATGATTGTTACTGG - Intronic
940325767 2:152423652-152423674 GCAAAGAAGAGGAGGGTAAATGG - Intronic
940553920 2:155197981-155198003 CAACATAAAAGCCTGGTAAAGGG + Intergenic
940587679 2:155674714-155674736 TAAAATAAAATAATGGGAAAGGG + Intergenic
940632143 2:156253586-156253608 GAAAATAACAAGAAGATAAAAGG + Intergenic
940690157 2:156907064-156907086 GAAAATCAAGGGATAGTCAAAGG + Intergenic
940706775 2:157115296-157115318 GAAAGTGAAGGGATGGAAAAAGG + Intergenic
940954089 2:159709319-159709341 GACAAAAAGAGGATGGTTAATGG + Intergenic
941001662 2:160208863-160208885 GAAAAATAAAGGATGGCAAGGGG + Intronic
941155236 2:161969708-161969730 GAAAACAAAAAGAGGGCAAATGG + Intronic
941227939 2:162871593-162871615 GAAAATAAAGAGATGATAAAAGG + Intergenic
941255282 2:163221738-163221760 GAAAATTAAAAGAAGGAAAAGGG - Intergenic
941296605 2:163746806-163746828 CAAAAGAAAAGAATGGTAAGAGG - Intergenic
941304467 2:163845397-163845419 GAAAGAAAAAGGATGGACAAAGG - Intergenic
941306188 2:163870670-163870692 AAAAAAAAAAGAGTGGTAAATGG - Intergenic
941363670 2:164583318-164583340 GAAAAAAAAAGGAGAGTAAAAGG + Intronic
941382099 2:164806132-164806154 AAAAATAAAAGGAAGAAAAAGGG + Intronic
941479250 2:165985386-165985408 GAAAGAAAAAGGAAGGAAAAAGG + Intergenic
941734808 2:168962062-168962084 GAAAAGAAAATAATGGAAAAGGG - Intronic
941840326 2:170076064-170076086 GCAAATTAAAGGAAGGAAAATGG - Intronic
941982204 2:171470892-171470914 GAAAAAAAAAGGATGGTATAAGG + Intronic
942425934 2:175860693-175860715 GAAAGTACAAAGATGGGAAAAGG + Intergenic
942514160 2:176734390-176734412 GAAAATAAAAGAAAAATAAAGGG - Intergenic
942577648 2:177381550-177381572 GAAAAGAAAATAATGGGAAATGG + Intronic
942604382 2:177675075-177675097 GAAAATAAAAGGAGGCAAAAAGG - Intronic
943003696 2:182362594-182362616 GAAAATAAAAGGAAGATAAAAGG - Intronic
943153789 2:184148112-184148134 TAAAATAGAAGGATGGTCCATGG - Intergenic
943467930 2:188253243-188253265 AAAAACAAAAAGATGGAAAAGGG + Intergenic
943584833 2:189725919-189725941 GAAAAGAAAAGAAAAGTAAAGGG + Intronic
943845334 2:192637930-192637952 GAAAATAATGGGATGGAAAAAGG + Intergenic
943925872 2:193779023-193779045 TATAAAAAAAGGAAGGTAAAGGG + Intergenic
944133425 2:196371372-196371394 GAATAAAAAAGCATAGTAAAAGG + Intronic
944289108 2:197984835-197984857 GAAAATAAAAGGATAGTGAATGG + Intronic
944731917 2:202525543-202525565 GAAAAGTAAGGGAAGGTAAAAGG + Intronic
944759848 2:202803441-202803463 GAAAGGAAAAGGATGGAAAAGGG + Intronic
944829414 2:203518213-203518235 GAAAATAAAAGAATACTATAAGG + Intronic
945341687 2:208663780-208663802 GAAAAGAAAAGACTGATAAAGGG + Intronic
945924931 2:215793598-215793620 GAAAATGAAAGAAAGGAAAAAGG - Intergenic
945956828 2:216094038-216094060 GGAAATAAAGGGATGGCAAATGG + Intronic
946745623 2:222842742-222842764 GAAAATGAAAGAATGTTAAAAGG - Intergenic
946812360 2:223539492-223539514 AAAAATAACAGGATGTGAAATGG - Intergenic
946891609 2:224282771-224282793 GAAAAAAAAAAGCTGGTAACAGG - Intergenic
946992657 2:225352655-225352677 GAAAATAAAGGGCTGGAATAAGG - Intergenic
948542081 2:238698260-238698282 GAAAATAAAAAGATGGGTAGAGG - Intergenic
948548571 2:238751551-238751573 GAAAATAAAGGGATGGAAAAGGG + Intergenic
948842188 2:240657368-240657390 GAAGATAAAAGGATGGAGAAAGG - Intergenic
949054316 2:241917511-241917533 GAACATTACATGATGGTAAAGGG + Intergenic
1168926164 20:1581215-1581237 GGAAATGAAAGGATGCTATATGG + Intronic
1168930026 20:1614263-1614285 GGAAATGAAAGGATGCTACATGG + Intronic
1168937529 20:1679215-1679237 GGAAATGAAAGGATGCTACATGG + Intergenic
1168939870 20:1700175-1700197 AGAAATAAAAGGATGCTACATGG + Intergenic
1169617689 20:7468575-7468597 GAAAACAAAGGGATGGAAAAAGG - Intergenic
1169722221 20:8690967-8690989 GAAAATAAATGGCTGGTACTGGG - Intronic
1170357376 20:15507347-15507369 GAAAGAAAAAGGAAGGAAAAAGG - Intronic
1170400793 20:15981002-15981024 GTAATTAAAAAGATGATAAATGG - Intronic
1170444089 20:16407136-16407158 GAAAACAAAAGCATGGGAAGAGG + Intronic
1170808034 20:19651012-19651034 GAATTTAGAAGGATGATAAAAGG - Intronic
1172378471 20:34467079-34467101 GACATTAAAAGGATAATAAAGGG + Intronic
1172389454 20:34557082-34557104 AAAAGTAAAACGATGGGAAAAGG - Intronic
1173058487 20:39639082-39639104 GAAAACAAAAGTATGGTGGAAGG + Intergenic
1173086066 20:39919447-39919469 CAAAATAAAGGGATGGAAGAAGG - Intergenic
1173909935 20:46659787-46659809 GAAGAGAAGAGGGTGGTAAATGG - Intronic
1174188104 20:48721318-48721340 AAAAATAAAAGCAAGGTGAAGGG + Intronic
1174739626 20:52999372-52999394 GAAAAACAAAGGGTGGCAAAGGG + Intronic
1174785276 20:53426763-53426785 AAAAATAAAAGGAAGGTGGAGGG + Intronic
1174953035 20:55064266-55064288 CAAAATAAAAAAATGATAAAGGG - Intergenic
1175247475 20:57590592-57590614 GAAAAGAGAAGCATGGTAACAGG + Intergenic
1175406250 20:58731846-58731868 AATAGTAAAAGGATGGAAAAAGG + Intergenic
1175631930 20:60547860-60547882 GAAAATAAAGGGATGGAAAAAGG - Intergenic
1175645636 20:60668594-60668616 GAAAATAAAATGTAAGTAAATGG - Intergenic
1176783826 21:13231737-13231759 AAAAAAAAAAGAATGCTAAAAGG - Intergenic
1176816163 21:13605766-13605788 GAAAGTAAAAGGAGGAAAAATGG + Intergenic
1176865448 21:14049995-14050017 GACATCAAAAGGATGATAAAGGG + Intergenic
1177057011 21:16318714-16318736 GAAAATAAAAAGATGGTGAGAGG - Intergenic
1177080875 21:16637044-16637066 GAAATCAACAAGATGGTAAAGGG - Intergenic
1177166284 21:17608544-17608566 AAAAAAAAAAGTATGGAAAAAGG - Intronic
1177185211 21:17786122-17786144 GAAAATAAGTGGATGCCAAATGG + Intergenic
1177416154 21:20795786-20795808 GAAAGTAAAAGGAAAGAAAAAGG + Intergenic
1177534603 21:22407415-22407437 TAAAATAAAAAGATGGGAAAGGG + Intergenic
1177720786 21:24904036-24904058 GCAAATAAAAGGAAAGAAAAGGG - Intergenic
1177957619 21:27619577-27619599 AAAAATAAAAGCATGATAAAAGG - Intergenic
1177984382 21:27955136-27955158 AAAAAAAAAAGCATGGTTAAAGG - Intergenic
1178108820 21:29350371-29350393 GAAAATAAAGGAATGGTAGATGG + Intronic
1178150803 21:29791321-29791343 GAAAAAAAAAGGAGGGAAAAGGG + Intronic
1178227791 21:30743351-30743373 GAAAGAACAAGGATGGAAAAAGG - Intergenic
1179000695 21:37455303-37455325 CAAAATAAAAGGAAAGAAAAGGG - Intronic
1179058503 21:37957655-37957677 GAAAAGAACAGGGTGGTTAAGGG + Intronic
1179245364 21:39629006-39629028 AAAAAAAAAAGGATGTTAAGAGG - Intronic
1179515325 21:41902609-41902631 TAAAGTAGCAGGATGGTAAAAGG + Intronic
1180146832 21:45925622-45925644 AAAAATGAAAGAATGGGAAAAGG + Intronic
1180250481 21:46583043-46583065 GACAGTAAAAGGATGAGAAAAGG + Intergenic
1180914532 22:19476314-19476336 GGAAAGGAAAGGATGGTAATTGG - Intronic
1183131420 22:35840347-35840369 GAAAGAAAAAGGAAGGAAAACGG - Intronic
1183313706 22:37125700-37125722 GAAAGGAAAAGGATTGTAAAGGG - Intergenic
1183802460 22:40178588-40178610 AAAAATAAAAAGATAGAAAAAGG - Intronic
1183846288 22:40543592-40543614 GAAAATAAAATTTTTGTAAAAGG + Intronic
1184025786 22:41855136-41855158 GAAGATAACAGGATGACAAATGG + Intronic
1184922804 22:47617271-47617293 AAAAGTAAAAGGAAAGTAAAAGG - Intergenic
1185056449 22:48581185-48581207 GAATATAAAAGGACTGGAAATGG + Intronic
949173636 3:1032738-1032760 GACAATAAAAAAATGATAAAGGG - Intergenic
949384644 3:3487296-3487318 GATAATAAAAGGCTAATAAAGGG + Intergenic
949595707 3:5544723-5544745 GAAAGTGAAGGGATGGAAAAAGG - Intergenic
949805758 3:7953684-7953706 GACAATAAAAGGTTTTTAAAGGG + Intergenic
950581077 3:13862513-13862535 GAAAATATACAGATGGAAAAAGG + Intronic
950603210 3:14054591-14054613 TAAAGTAAAGGGATGGAAAAAGG - Intronic
950677434 3:14563014-14563036 AAAAAAAAAAGGAGGGAAAAGGG + Intergenic
951206641 3:19932960-19932982 GAAAATGAAATGAAGGTTAAAGG + Intronic
951304028 3:21035506-21035528 AAAAATCAATTGATGGTAAATGG + Intergenic
951460035 3:22941571-22941593 TAAAGTAAATGGGTGGTAAAAGG - Intergenic
951767810 3:26219437-26219459 GATAATAAAAAGATGGAAAGAGG + Intergenic
951860514 3:27246716-27246738 GAACATAGAAGGATGGTCACCGG - Intronic
951987797 3:28640300-28640322 TAAAATAAAAAGATGGAGAAGGG - Intergenic
952724628 3:36570877-36570899 GAAAGTAAAAGAATGGAAAAAGG - Intergenic
952845642 3:37685912-37685934 AAAAAGAAAAGCATGGTAAAGGG - Intronic
953323149 3:41990284-41990306 GAAAATCAAAGGATGAGATAAGG + Intergenic
953369905 3:42378555-42378577 GACAATAAAAGGTTGTTTAATGG + Intergenic
953830830 3:46296434-46296456 GAAAATAAATAGATGAGAAATGG - Intergenic
954543903 3:51416423-51416445 GAAAATGAAAGCAGGGTAAGAGG - Intronic
954860504 3:53684776-53684798 GAAGATAGAAGGAAGTTAAATGG + Intronic
954910583 3:54104032-54104054 GACATTAAAAGAATGGTAATTGG - Intergenic
954940165 3:54364592-54364614 GAACAAAAAAGGATGGCAAATGG + Intronic
955686663 3:61556128-61556150 GAAAACAAACGAAGGGTAAAAGG + Intergenic
955837185 3:63068978-63069000 GAAAACACAAGGGTGGGAAAGGG - Intergenic
956107415 3:65834935-65834957 CAAAGTAAAAGGATGGAAAAAGG - Intronic
956121696 3:65972553-65972575 GCAAATAAAAGGAAGTGAAATGG - Intronic
957087479 3:75695121-75695143 GAAAATAAAAGGATGGAAAAAGG + Intergenic
957161320 3:76612932-76612954 GAAAATAAAAGGATAGCAAAAGG - Intronic
957263041 3:77924473-77924495 AAAAATAAAAGTATGGAAAGGGG + Intergenic
957508793 3:81160335-81160357 GAAAATAAAAGTAAAATAAAAGG + Intergenic
957607248 3:82417328-82417350 GAAAAGAAAAGAAAAGTAAAGGG + Intergenic
958174830 3:89983869-89983891 GAAAACAAACGGATGGAAAAAGG - Intergenic
958438231 3:94123897-94123919 GAAAATAAAAGCAGGATAAAAGG - Intronic
958630960 3:96683250-96683272 GAAAATAAAGGGATGAAAAAAGG - Intergenic
959134076 3:102394919-102394941 GCAATTAAAAGGAAGGAAAAAGG + Intronic
959237668 3:103745688-103745710 AGAAATCAAAGGATGATAAATGG - Intergenic
959241049 3:103794638-103794660 CAGAATAAAAGCATAGTAAATGG + Intergenic
959280106 3:104326516-104326538 TAAATTAAAGGGATGGGAAAAGG + Intergenic
959382751 3:105661322-105661344 GAAAATAATAGGAAAATAAATGG - Intronic
959436373 3:106319472-106319494 TAAGATAAAGGGATGGAAAAGGG + Intergenic
959473144 3:106777363-106777385 GAAAATAAAAGCAAGTTAGATGG - Intergenic
959722487 3:109508125-109508147 AAAAAAAAAAAGATGATAAAAGG + Intergenic
959980371 3:112509280-112509302 GAAAAGAAAAGGTTACTAAAAGG + Intergenic
959994905 3:112669867-112669889 AAAAAGAGAAGGATGGTCAATGG - Intergenic
960193784 3:114740247-114740269 TTAAATAAAATGATGGAAAATGG + Intronic
960345386 3:116524034-116524056 GAGAACAAAAAGATGCTAAAAGG - Intronic
960665842 3:120108052-120108074 GAAAATAAAATAATAGGAAATGG + Intergenic
960827178 3:121801128-121801150 GAAAATAAATGGCTTGAAAATGG - Intronic
960843669 3:121986652-121986674 GAAAACCAAAGGATTCTAAAGGG - Intergenic
960892740 3:122467693-122467715 AAAAAAAAAAGGTTGGAAAAAGG + Intronic
961055443 3:123784554-123784576 GAAAGTAGAGGGATGGTGAATGG - Intronic
961712059 3:128835371-128835393 GAAAGTAGAAGCAAGGTAAAAGG - Intergenic
962044284 3:131739211-131739233 GAATAAAAAAAGATGGTTAAAGG - Intronic
962067788 3:132000853-132000875 AAAAAAAAAAGGAAGGAAAATGG + Intronic
963140851 3:141945123-141945145 AAAAAAAAAAGGTGGGTAAAGGG - Intergenic
963238724 3:142981879-142981901 GATAATAAAAGGGGGGAAAACGG + Intronic
963429905 3:145186938-145186960 AAAAATAAAAAGATTTTAAATGG + Intergenic
963434265 3:145247827-145247849 TAAAATAAAATGATGGAAAAAGG - Intergenic
963440966 3:145339404-145339426 GAAAAGAAAATGAAGGTGAAGGG - Intergenic
963653893 3:148021148-148021170 AAAAAAAAAAGGATGCTTAAAGG - Intergenic
963662430 3:148143951-148143973 GAAAAAAAAAGCATGGTAAGTGG + Intergenic
963694288 3:148545320-148545342 GAAAATAAATTAATGGAAAAAGG - Intergenic
963763072 3:149304978-149305000 GAAAATAAAGAGATGGAAAGAGG - Intergenic
963786397 3:149538900-149538922 GAAAATAACAGACAGGTAAATGG - Intronic
964002799 3:151796131-151796153 GAAAAGAAAAGGGGGGGAAAGGG + Intergenic
964019732 3:151995061-151995083 AAAAATAGAAGCATGGTTAAGGG + Intergenic
964136754 3:153352962-153352984 GAGAATAAAAGGTTGGATAAGGG + Intergenic
964274467 3:154994823-154994845 GAAAATAAAACAAATGTAAAAGG + Intergenic
964285367 3:155111992-155112014 GGAAATAAAAATATGGTAACGGG - Intronic
964318425 3:155468528-155468550 GAAAATAAACGGATGGAAAAAGG + Intronic
964487880 3:157205160-157205182 GAGAATAACAGGATGGCAGAGGG + Intergenic
964701503 3:159572970-159572992 CAAAATAAAAGGATGGAGGAAGG - Intronic
964804316 3:160590235-160590257 GAAAATAAATGGATGGAAAAAGG + Intergenic
964908430 3:161747755-161747777 TGAAATAAATGCATGGTAAAAGG + Intergenic
964956417 3:162363433-162363455 GGAAATAAAAGGAGGGTTAAGGG - Intergenic
965251112 3:166345201-166345223 GAAAATAAAGGGATAGACAAAGG + Intergenic
965877779 3:173348761-173348783 GAAAGTGAAAGAATGGAAAAAGG - Intergenic
965903918 3:173678961-173678983 GAGAGAAAAAGTATGGTAAATGG + Intronic
965949353 3:174286896-174286918 AAAAAGAAAAGAATGGAAAAAGG + Intergenic
966681701 3:182648413-182648435 GAAAAATAAAGCAAGGTAAAGGG - Intergenic
966705498 3:182909450-182909472 GAAAAAAAAAGCATAGTAATGGG - Intronic
967666400 3:192177879-192177901 GAAAACAAAAGCAAGGTAAAGGG - Intronic
967954175 3:194864727-194864749 CTAAATGAAAGGATGGTGAAGGG + Intergenic
968056683 3:195697184-195697206 AAAAAAAAAAGAATGGGAAAGGG - Intergenic
968248620 3:197182711-197182733 AAAAATAAAAGGACGAGAAATGG - Intronic
969287790 4:6216684-6216706 GAAAGTCAAAGGATGGAAAAAGG - Intergenic
969317763 4:6392410-6392432 GAAAACTATAGTATGGTAAATGG + Intronic
970181561 4:13402579-13402601 AGAAATAGAAGGATGGGAAAAGG - Intronic
970468018 4:16347329-16347351 GATGATAAAAGAATGGAAAAGGG - Intergenic
970479939 4:16462565-16462587 GAAAAGAAATGGAAGGCAAATGG + Intergenic
970680075 4:18496610-18496632 GAACATTACATGATGGTAAAGGG + Intergenic
971004125 4:22355238-22355260 TAAAATAAAAAGATGGAAAAAGG + Intronic
971058432 4:22939756-22939778 GAAAAGAAAAAGGTGATAAATGG + Intergenic
971459174 4:26875915-26875937 AATAATAAAAGGATGATAAATGG - Intronic
971817786 4:31511084-31511106 GAAATAAAAAGGAAGGAAAAAGG + Intergenic
971971120 4:33622464-33622486 AAAAATATAAAGATGGTGAAAGG - Intergenic
972014778 4:34230204-34230226 GATGATAAAGGGATGGAAAAAGG - Intergenic
972086806 4:35227966-35227988 GAAATTAAAAGGATGATAGTGGG + Intergenic
972207985 4:36800690-36800712 GAAAATAAAAGGATATTAATGGG + Intergenic
972275271 4:37551310-37551332 GTAATTAAAAAGATGATAAATGG + Intronic
972555131 4:40173847-40173869 GAAAAGAAAAGGGAGGTAAAAGG - Intergenic
972868542 4:43267020-43267042 GAAAATAAATGCATTTTAAAAGG - Intergenic
973094965 4:46185547-46185569 GAAAAAAAAAGCATGAAAAAAGG + Intergenic
973179376 4:47249782-47249804 TAAAGTAAAAGGGTGGAAAAAGG - Intronic
973767062 4:54172437-54172459 GAAAAGAAATGGGTGCTAAAAGG + Intronic
974229888 4:59097198-59097220 CAAAATATAAAGATGCTAAAAGG - Intergenic
974329988 4:60465631-60465653 CAAAGTAAAAGGATGGAGAAAGG + Intergenic
974794823 4:66735032-66735054 GAAAAAAAAAGAATGGAGAAGGG + Intergenic
975012600 4:69376146-69376168 GAAACTAAAAGGAATGTTAAAGG + Intronic
975786587 4:77896137-77896159 AAAAAAAAAAGGAAGCTAAAAGG - Intronic
975962671 4:79932174-79932196 GAAAATAAACGGATGAATAAAGG + Intronic
976026132 4:80689826-80689848 CAAAATAAAAGGATGGAGGAAGG + Intronic
976124659 4:81820441-81820463 GAAAACAATAGGAAGGGAAAGGG - Intronic
976192608 4:82502495-82502517 GAAATGATAAAGATGGTAAAGGG + Intronic
976292613 4:83435939-83435961 GAAAATAAAAGAATGGAAAAAGG + Intronic
976313767 4:83637771-83637793 GAAAATGAAAGGAAAGGAAAGGG - Intergenic
976654510 4:87474593-87474615 GAAAAAAAGAGGAAAGTAAAAGG - Intronic
976825361 4:89254831-89254853 GAAAAGAAAGGGAAGGAAAAAGG - Intronic
976841386 4:89436582-89436604 GAAAACAAAAGGAAAGAAAAAGG - Intergenic
976845350 4:89483154-89483176 GAAAATAATAGCATAGGAAAAGG - Intergenic
976985970 4:91298446-91298468 GAAGGTAAAAGGAAGGCAAAAGG - Intronic
977008636 4:91606828-91606850 CAAAATAATAGGATGTTAAGAGG + Intergenic
977106976 4:92898762-92898784 GAGTATAAAAGGATGGTATTTGG - Intronic
977219896 4:94326398-94326420 AAAAATAAAAGAATGAAAAAAGG - Intronic
977243095 4:94597733-94597755 GAAAATAGAAGAGTGGTAAAAGG + Intronic
977783119 4:101002218-101002240 TTAATTAAAAGGATGGCAAAAGG - Intergenic
977889785 4:102296437-102296459 GAAAAGACAAAAATGGTAAATGG + Intronic
977941293 4:102862486-102862508 CAAAATAAGAGAAAGGTAAAAGG - Intronic
978039883 4:104047083-104047105 GAAAAATAAAGCAGGGTAAAGGG + Intergenic
978991890 4:115093886-115093908 AACAATAAAAAGATGGTAGAAGG + Intronic
979040794 4:115791051-115791073 GAAAATGCAAGGATGGAAAAAGG - Intergenic
979072703 4:116229853-116229875 GAACATAAAAAGATGAAAAAAGG + Intergenic
979096785 4:116561303-116561325 TAAATTAAAAGGAAGATAAAGGG + Intergenic
979190597 4:117852056-117852078 CAAAGTAAAAGGATGAAAAAAGG + Intergenic
979381892 4:120016547-120016569 TAAAGTAAAAGGGTGGAAAAAGG - Intergenic
979562141 4:122112237-122112259 CAAAATAAAAGGATGGAGGAAGG + Intergenic
979567952 4:122177835-122177857 GAAAATAAAAGCAAGGTTAGTGG - Intronic
979794729 4:124832917-124832939 TAAAATAAAGGGGTGGAAAAAGG - Intergenic
979794739 4:124833082-124833104 TAAAATAAAGGGGTGGAAAAAGG - Intergenic
979806567 4:124980164-124980186 AAAAATAAAAAGAGGGGAAAGGG + Intergenic
979816331 4:125110360-125110382 GAATATAAAGGGATGGTAAGAGG - Intergenic
980039311 4:127921016-127921038 AAAAATAAAAGGAGTGTAAAGGG + Intronic
980089480 4:128427687-128427709 GCATATAAAAGGGTGGTGAAAGG - Intergenic
980468991 4:133226252-133226274 AAAAATAAAATAATGGAAAAAGG - Intergenic
981558361 4:146020444-146020466 GAAAATAAAGGTATAGAAAAAGG - Intergenic
981685137 4:147445886-147445908 GTAAATAAAATGATGCTTAAAGG + Intergenic
981781089 4:148429729-148429751 AAAAATAAAAGCATGTTAAATGG - Intronic
981950936 4:150406487-150406509 GAAAATAAAATAATGGAAAAAGG + Intronic
981966921 4:150614958-150614980 GAAAATACAAGGGAGGTAATAGG + Intronic
982456480 4:155615622-155615644 GAAAAAAGAAGGAAAGTAAAAGG - Intergenic
982476701 4:155861520-155861542 AAAAGTAAAAGAATGGAAAAAGG - Intronic
982531922 4:156556099-156556121 GAAATAAAAGGGATGGAAAAAGG - Intergenic
982538186 4:156633121-156633143 GACAAGCAAAGAATGGTAAATGG + Intergenic
982839420 4:160164151-160164173 GAAATAAAAAGGATTGTAAGAGG - Intergenic
982885248 4:160771576-160771598 AAATATAAAAGCTTGGTAAACGG + Intergenic
983464857 4:168074491-168074513 GGAAATAAAAGAATGAGAAAGGG + Intergenic
983505195 4:168545948-168545970 GAAAATAAAGGGTTTGAAAATGG - Intronic
984036210 4:174671467-174671489 TACAATAAAAGGATAGGAAATGG - Intronic
984175796 4:176415264-176415286 GAAAATAAACTTATGGTGAAAGG - Intergenic
984255955 4:177390382-177390404 GAAAAGAAAGGGAGGGAAAAGGG - Intergenic
984619876 4:181940556-181940578 GAAAATTAAAGCAGGGTAAAGGG + Intergenic
984674485 4:182531288-182531310 GTAAATAAAAAGATAGTAATGGG + Intronic
985223693 4:187735794-187735816 GACACTAAAAGGATAGTAAAGGG + Intergenic
985344020 4:188983361-188983383 GAAAATAAAATTATGGTGAAAGG - Intergenic
985357230 4:189134473-189134495 GAAACTAAAAGGAGAGCAAATGG + Intergenic
985519361 5:364784-364806 GAAAGTAAAAGGATGGGAAAGGG + Intronic
985825725 5:2189975-2189997 GAAATGAAAAGGATTTTAAATGG - Intergenic
985900829 5:2789487-2789509 GAAAAGAATTGGATGGGAAATGG - Intergenic
986103622 5:4637996-4638018 GAAAATGAAAGTGTGGTAAAAGG - Intergenic
986243194 5:5980028-5980050 GAAAATAATAGCATTTTAAAAGG - Intergenic
986257297 5:6110901-6110923 GAAAAGAAAAGTGAGGTAAAGGG + Intergenic
986277827 5:6295639-6295661 TTAAATAAATGGATGGTGAATGG + Intergenic
986345493 5:6831485-6831507 GAGAACAAAATGATGGCAAAGGG - Intergenic
986592406 5:9385132-9385154 GAAAATAAAAGGAAGTTTAGGGG - Intronic
987008735 5:13738178-13738200 GAAAATAAATGGGTGATTAAAGG - Intronic
987229060 5:15873558-15873580 CACAATAAAAGAATGATAAAGGG + Intronic
987240304 5:15990975-15990997 GAAAGGAAAGGGATGGAAAAAGG - Intergenic
987244030 5:16030111-16030133 TAAAATAATAGGATGATAAAAGG - Intergenic
987551553 5:19388968-19388990 GAAAATAAAAGTATGAGCAATGG - Intergenic
987763273 5:22192649-22192671 GAAAAGAAAAGAATGGTGAGAGG + Intronic
988020214 5:25611614-25611636 GAAAGTAAAAGAATGGGAAAAGG + Intergenic
988343108 5:30000581-30000603 GAAAAAAATAGTATGGTACAGGG + Intergenic
988376474 5:30441559-30441581 GAAAATAAAGGGATGGAAAAAGG + Intergenic
988962704 5:36385661-36385683 GAAAGTAGAATGATGGTAACCGG + Intergenic
989223691 5:38999910-38999932 GAAAGTAAAAGGATGGTAAAAGG + Intronic
989313573 5:40050339-40050361 GAAAATATGAGGATGGCAGATGG + Intergenic
989794262 5:45447169-45447191 CAAAATAAAAGGATGGAGGAAGG + Intronic
989797800 5:45497560-45497582 CAAAATAAAAGGATGGAGGAAGG - Intronic
989845291 5:46133139-46133161 CAAAATAAAGGGATGGAAGAGGG + Intergenic
989847230 5:46159983-46160005 CAAAATAAAGGGATGGAAGAAGG - Intergenic
989949673 5:50282361-50282383 CAAAATAAAAGGATGGAGGAAGG + Intergenic
990144042 5:52738509-52738531 GAAAATATAAGGAAGGAAATGGG - Intergenic
990207001 5:53440484-53440506 GAAAAAAAAAGGAGTGGAAAGGG + Intergenic
990422552 5:55651237-55651259 AAAAAAAAAAAGATGGCAAAAGG - Intronic
990497767 5:56365993-56366015 GAAAATATAAATATGGTATAGGG + Intergenic
990593341 5:57288226-57288248 GAAATTCAAAGGATGGTTATTGG + Intergenic
990695064 5:58407298-58407320 GAAGACAGAGGGATGGTAAATGG + Intergenic
990895004 5:60689563-60689585 GAAAATACAAAAATGTTAAAGGG + Intronic
991199244 5:63971928-63971950 GAACATTACAGAATGGTAAAGGG + Intergenic
991252054 5:64574067-64574089 TAATCTAAAAGGAGGGTAAAGGG - Intronic
991294986 5:65071208-65071230 GAAAATAAAGGGATGGGGCAGGG - Intergenic
991663863 5:68977089-68977111 GAAAATAAAAGGTTAGAAAAAGG + Intergenic
991672369 5:69061422-69061444 GAAAATAAAGGGATAGAAAAAGG - Intergenic
991675805 5:69088947-69088969 GAAATTAAAAAGATGATAAATGG - Intergenic
991682668 5:69154123-69154145 AAAAAAAAAAGAATGGCAAAGGG - Intergenic
991897993 5:71425733-71425755 GAAAAGAAAAGAATGGTGAGAGG + Intergenic
992087552 5:73291481-73291503 AAAAAAAAAAGCATGGAAAAGGG - Intergenic
992300933 5:75379577-75379599 GAAAAAAAAAAGATGCTAATTGG - Intronic
992420020 5:76594292-76594314 CAAAAATAAAGGATGGTTAAAGG - Intronic
992638434 5:78747634-78747656 GACAATTAAAAGATGATAAATGG - Intronic
992667463 5:79025245-79025267 GAAAATAAAAGGCAGGAGAATGG + Intronic
992817450 5:80458043-80458065 AAAAAAAAAAAGGTGGTAAAAGG + Intronic
992945551 5:81805272-81805294 GAAAGTGAAGGGATGGAAAAAGG + Intergenic
992962218 5:81967619-81967641 AAAAAAAAAAGGATAGTAATGGG + Intergenic
992979340 5:82151630-82151652 AAAAAAAAAAAAATGGTAAAAGG + Intronic
992989351 5:82268402-82268424 GTAATTAAAAAGATGATAAATGG - Intronic
993249876 5:85507236-85507258 GAATATGAGAGGATGGTAAAAGG + Intergenic
993473751 5:88338574-88338596 AAAAATAAAGGGATGAAAAAAGG + Intergenic
993665931 5:90696127-90696149 GAAAAGAAAAGGCAGGGAAAAGG - Intronic
993669012 5:90737780-90737802 GAAAATGAAGGAATGGAAAAAGG - Intronic
993864611 5:93177255-93177277 AAAGAGAGAAGGATGGTAAAGGG + Intergenic
994063537 5:95508643-95508665 GAAAATTAAAGTAGGGAAAAGGG - Intronic
994133577 5:96260011-96260033 AAAAAGAAAAGGATGGAAAATGG - Intergenic
994328659 5:98480074-98480096 AAAAATATAGGGATGGGAAATGG + Intergenic
994344345 5:98667087-98667109 GAAAATAAAGGAATGGAAAAAGG + Intergenic
994368138 5:98939373-98939395 GTAAATAACAGGATTCTAAATGG + Intergenic
994436589 5:99742949-99742971 GATAATGAAAGGATGGTTAATGG - Intergenic
994654162 5:102568906-102568928 GAAAATGAAGGGATGCAAAAGGG - Intergenic
994726098 5:103437455-103437477 CAAATCAAAAGAATGGTAAAGGG + Intergenic
994735476 5:103548418-103548440 GAAAATAATAGGATAACAAAGGG - Intergenic
995140770 5:108732725-108732747 GAAAAGAAAAGGAAGGGAAGGGG - Intergenic
995217373 5:109611396-109611418 AAAAATAAAGGGATGGATAAAGG + Intergenic
995474700 5:112535905-112535927 GAACATGAAAGGATGATTAATGG + Intergenic
995818023 5:116193461-116193483 GAAAGTAAAGGGGTGGAAAAAGG + Intronic
995997235 5:118316305-118316327 GAAGAGAAAAGGATGTTTAACGG + Intergenic
996070571 5:119126402-119126424 CAAAATAAAAGGATGCTGCAAGG - Intronic
996139793 5:119892791-119892813 GAAAATGAATGGAAGGTAATAGG + Intergenic
996235150 5:121118921-121118943 GAAAATAAAAGAATGGAAAAGGG + Intergenic
996353721 5:122574091-122574113 GAAGAAAAAAGGGGGGTAAAAGG + Intergenic
996513778 5:124347241-124347263 GAAAGTAAAAGGGTGGAAGAAGG + Intergenic
996631100 5:125633636-125633658 GAAAAAGAAAGGAAGGGAAAGGG + Intergenic
997293654 5:132755767-132755789 GAAAGTTACAGGAAGGTAAAGGG - Intronic
997495796 5:134324059-134324081 GAAAATATACAGATGGCAAATGG + Intronic
997511112 5:134455190-134455212 GAAAGTAGAAGGATGGTTACCGG + Intergenic
997730253 5:136166796-136166818 GAAAAGAAAAGGAGGTTAAGTGG - Intronic
997918950 5:137958856-137958878 GAAAAAAATAAGATGGTTAATGG - Intronic
997934359 5:138097651-138097673 GAAAAGAAAAGAAAGGAAAAGGG - Intergenic
998002138 5:138633714-138633736 GAAAAACAAAGGATGGTAAGGGG - Intronic
998196425 5:140076727-140076749 GAGAAGGAAAGGATGGTAGATGG - Intergenic
998245117 5:140494179-140494201 AACAAGAAAAGGAAGGTAAATGG - Intronic
998288604 5:140889654-140889676 TAAAATAAAAGGCTGGGAAGAGG - Intronic
998552595 5:143091954-143091976 TAAAATAAAACTTTGGTAAAAGG - Intronic
998695533 5:144634041-144634063 GAAAATAAAGGGATGGAACATGG + Intergenic
998993513 5:147845229-147845251 TAAAATAAAAAAATTGTAAAAGG - Intergenic
999215719 5:149933266-149933288 TAAAATAAATGGATGATAATGGG - Intronic
999849351 5:155521959-155521981 GAAAATAGAGGGATTGAAAAAGG - Intergenic
999970320 5:156853936-156853958 GAAAGTAAAAGAATGGAAAAAGG + Intergenic
1000106312 5:158062348-158062370 GAAACTTAAATGATGGTAACAGG + Intergenic
1000237174 5:159372745-159372767 AAAATTAAAAAGATGATAAATGG + Intergenic
1000255243 5:159531590-159531612 AAAAAAAAAAAGAAGGTAAAGGG - Intergenic
1000630079 5:163583010-163583032 GAAAAAAAGAAGAAGGTAAAAGG - Intergenic
1001246792 5:170110986-170111008 GAAAGTAAAAGGATGGGACGTGG + Intergenic
1002302335 5:178264342-178264364 AAAAAAAAAAGGATGATGAAGGG + Intronic
1002802279 6:535513-535535 GACATTAAAAGGATAGTAAAAGG + Intronic
1002862012 6:1087748-1087770 TAAAATAAAAGGATGATGGAAGG - Intergenic
1002952302 6:1826018-1826040 AAAAATAAAAAGATAGAAAATGG + Intronic
1003029224 6:2587427-2587449 TAAAGTAAAAGGGTGGAAAAAGG - Intergenic
1004282220 6:14290109-14290131 GAAAATACAAGGGTGGAATAGGG - Intergenic
1004632200 6:17432890-17432912 GAAAATAAAAGCAAAGGAAAGGG - Intronic
1005173689 6:23018828-23018850 GAAAATTTAAAGATAGTAAAAGG + Intergenic
1005281697 6:24281500-24281522 AAAAAAAAAAGGAGGGTGAAGGG + Intronic
1005367549 6:25094376-25094398 GAAAATATAAGGAGGGAAATAGG + Intergenic
1005673791 6:28133675-28133697 GAAAAGAAAAGGATGAAAAGAGG + Intergenic
1005775625 6:29128782-29128804 GAAGAGAAAAGGATAGCAAAAGG + Intergenic
1005792341 6:29316816-29316838 GAAAATAAAAGGAAAGGAATGGG + Intergenic
1005989601 6:30894730-30894752 GAAAAAAAGAGAATGGGAAAGGG - Intronic
1006031215 6:31177905-31177927 GAAAAGAGAATGATGGGAAAGGG + Intronic
1006191194 6:32210641-32210663 AAAAATAAAAGGAGGTGAAATGG + Intronic
1006553849 6:34848668-34848690 AAAAATAAAGGGATGGAAAAAGG - Intronic
1006663552 6:35671501-35671523 GAAAATAAAGGGAAGGAACAAGG + Intronic
1006937127 6:37726265-37726287 GAGAGTAAATGGATGGTATATGG - Intergenic
1007313412 6:40964630-40964652 GAAAAAGAAAGCAGGGTAAAGGG + Intergenic
1007499666 6:42287302-42287324 AAAAAGAAAAGGATGGGGAAGGG + Intronic
1007663182 6:43498896-43498918 GAAAAAACAAAGATGGTGAAAGG - Intronic
1007954991 6:45909820-45909842 GAAAATGAAAGCAAGGTAGAAGG - Intronic
1008140906 6:47831015-47831037 GAAGATAAAAGAATGAGAAAAGG - Intronic
1008307218 6:49918176-49918198 GAAAAGGAAAGGAAGATAAAGGG - Intergenic
1008588945 6:52974466-52974488 GAAAATAAGAGGATAAGAAAGGG + Intergenic
1008802524 6:55387274-55387296 GAAAATATAAGGGTGGAAAATGG - Intronic
1008916557 6:56794251-56794273 AAAAATAAAGAGATGGTAAAAGG - Intronic
1009453376 6:63827059-63827081 TAAAGTAAAGGGATGGAAAAAGG + Intronic
1009597818 6:65758652-65758674 AAAAGTGAAAGGATGGAAAAAGG - Intergenic
1009718028 6:67426311-67426333 CAAAATAAAGGGATGGAGAAAGG - Intergenic
1009749245 6:67861851-67861873 AAAAAAAAAAGGAAAGTAAATGG - Intergenic
1010183166 6:73112068-73112090 GAAAATATATGGATGGCAAAAGG - Intronic
1010274623 6:73955061-73955083 GACTATAAAAGGATGGCAGATGG - Intergenic
1010768190 6:79799849-79799871 GAAAATAAAAAGAAAATAAAAGG - Intergenic
1010772233 6:79845073-79845095 GAAAAGAAAAGAAAGGCAAAGGG - Intergenic
1011256612 6:85428108-85428130 GAAAATACAAGGATGGTGAAGGG + Intergenic
1011322601 6:86113387-86113409 GAAAATAAAGAGATGGAAAAAGG - Intergenic
1011666873 6:89642733-89642755 GAAGATGACAGGATTGTAAAAGG - Exonic
1011902142 6:92312402-92312424 GAAAAGAAAAGGAAGGAAGATGG - Intergenic
1012007374 6:93730365-93730387 AAAAAAAAAAAGATGGTGAAGGG - Intergenic
1012107480 6:95182102-95182124 CAAAATAAATGGATGAAAAAGGG - Intergenic
1012221997 6:96659795-96659817 CAAAATAAAAGGATAGAAAAAGG + Intergenic
1012262208 6:97100549-97100571 AAAAATAAAAGAATAGTCAAAGG - Intronic
1012534483 6:100279146-100279168 GAAAATAAAATGGTGTTCAAGGG + Intergenic
1012645563 6:101675177-101675199 AAAAATAAATGGAGGGTAGAGGG - Intronic
1012670889 6:102046213-102046235 GAAATTAAAATAATAGTAAAAGG + Intronic
1012725950 6:102810146-102810168 GAAAATATAATTATGCTAAAAGG - Intergenic
1012738026 6:102975623-102975645 AAAAGTAAAGGGATGGAAAAAGG + Intergenic
1012748815 6:103130727-103130749 GAAAATAAAAGGTTAGAAGATGG + Intergenic
1013440627 6:110162909-110162931 GAAAATAAAAGTATGCTGATTGG + Intronic
1013741005 6:113285034-113285056 AAAAATAAAAGAATGGGAAAAGG - Intergenic
1013826949 6:114224144-114224166 GAAAATGAAAGGATAGGCAAAGG - Intronic
1013908746 6:115248604-115248626 GAAAACAAAAAGATGTTAATGGG + Intergenic
1014149467 6:118037153-118037175 GAAATAAAATGGATGGAAAAAGG - Intronic
1014365377 6:120533893-120533915 GAAAATGAAAGGATAGAAAAAGG + Intergenic
1014655862 6:124103109-124103131 TAAAATAAAAATGTGGTAAAGGG + Intronic
1014683299 6:124461854-124461876 GAAAAAAGAAAGATGGAAAAAGG - Intronic
1014745359 6:125194048-125194070 AAAAACAAAAGGCTGATAAAAGG + Intronic
1014763099 6:125379543-125379565 GTAAATAACAGGTTGGGAAAGGG + Intergenic
1014803185 6:125799905-125799927 GAAAATAGAAGGATGAGCAAAGG - Intronic
1014939982 6:127426543-127426565 GAAAGTAAACAGATGGAAAAAGG + Intergenic
1015184390 6:130397574-130397596 CAAAGTAAAAGAATGGAAAAAGG - Intronic
1015462674 6:133510773-133510795 TAAAATAAAAGCATTCTAAATGG - Intronic
1015809296 6:137145788-137145810 GAAAATAATCAGTTGGTAAATGG + Intronic
1015942220 6:138463877-138463899 GTAAATAAAACAATGGTAAGGGG - Intronic
1016472891 6:144393490-144393512 GAAAAAGAAACGATGGAAAAAGG + Intronic
1016596514 6:145808175-145808197 AAAAAAAAAATGGTGGTAAAGGG - Intronic
1016646567 6:146416042-146416064 GAAAATCAAAGGATGGAAAATGG - Intronic
1016681938 6:146840936-146840958 GCAAATTAATGGATGTTAAAGGG - Intergenic
1017052076 6:150402517-150402539 GAAAAGAAAAGGAGGGGAGAAGG + Exonic
1017318896 6:153065087-153065109 TAAAATAAAGGGATGGAATAAGG + Intronic
1017574489 6:155786972-155786994 GAAATTACAAGGAAGCTAAAAGG + Intergenic
1017590194 6:155970877-155970899 GAAAGTAAAAGGGTGGGAGAAGG + Intergenic
1018136201 6:160780382-160780404 GAAACTAAACGGATGATACAAGG - Intergenic
1018276142 6:162133534-162133556 GAATATACAAGGATGGAGAAAGG + Intronic
1018663054 6:166106038-166106060 GAAAAAAAAAGGAAGTCAAAAGG - Intergenic
1019084171 6:169458434-169458456 GAAAATTGAAGGAGGGTCAAGGG - Intronic
1019132177 6:169885052-169885074 AAAAATAAAAAGAAAGTAAATGG + Intergenic
1019232533 6:170580304-170580326 CAAAATAACAGAATGGTCAAGGG + Intronic
1019441951 7:1052050-1052072 GAAAATAAAACGATTGAAACTGG + Intronic
1019959391 7:4446313-4446335 GAGAATAAAAAGATCTTAAAGGG + Intergenic
1020362301 7:7340637-7340659 GGAAAAAAAAAGATGGGAAATGG - Intergenic
1020653046 7:10898048-10898070 GAGTATAAAAGGATGGTTAACGG + Intergenic
1020661587 7:10990565-10990587 GTTAATAAAAGAATGGAAAATGG + Intronic
1020823499 7:12999556-12999578 CACAATAAAAGAATGATAAAGGG - Intergenic
1020914303 7:14172754-14172776 TAAAATAAATGGGTAGTAAAGGG + Intronic
1020999097 7:15305164-15305186 GAGAATAGCAGGATGGTAAAAGG - Intronic
1021521095 7:21539837-21539859 GAAAAGCAACGGAGGGTAAAAGG - Intergenic
1021947929 7:25745979-25746001 CAAAATAAAAGGATGGAGGAAGG + Intergenic
1022086863 7:27077060-27077082 GAAAAAAAAAGGAGGTTAAGTGG + Intergenic
1022304296 7:29132044-29132066 GAAAATCAAAGCAGGATAAACGG + Intronic
1022825674 7:34010436-34010458 CAAAATATAAGAATGGAAAATGG - Intronic
1022983400 7:35625862-35625884 GAAAGTAAAAGGATGGAAAAAGG - Intergenic
1023125776 7:36952644-36952666 GAAAATGAATGGATGGGAAGCGG + Intronic
1023325322 7:39049006-39049028 GAAATTAAAAGGATTCTAAAGGG - Intronic
1023354607 7:39354275-39354297 AAAACTAAAAGGAGGTTAAATGG - Intronic
1024121644 7:46248012-46248034 GTAAATAAAAGCATGGTAAGTGG + Intergenic
1024190318 7:47000108-47000130 GCAAATGAAAGGACTGTAAAAGG - Intergenic
1024745164 7:52398102-52398124 TAAAATAAAGGGATGGAAAAAGG - Intergenic
1024778094 7:52812026-52812048 GAAACTACAGTGATGGTAAAAGG - Intergenic
1024891414 7:54208418-54208440 AAAAGTCAAAGGATGATAAAAGG + Intergenic
1024910976 7:54446851-54446873 GAAAATAAAAATACAGTAAAAGG - Intergenic
1024921896 7:54565948-54565970 GAAGAGAAAAGGATGAGAAATGG + Intronic
1025138298 7:56439425-56439447 GAGAATTAAGGGATGGAAAAAGG + Intergenic
1026081079 7:67221342-67221364 GAAAGGGAAAGGATGGAAAAAGG - Intronic
1026326795 7:69317569-69317591 GGAAATAAAGGGATGGATAAAGG + Intergenic
1026495746 7:70901174-70901196 GAAAGTGAAAGGATGGAAAAAGG - Intergenic
1026667234 7:72352765-72352787 GAAAATAGAAGAAAGGAAAAAGG + Intronic
1026696004 7:72592683-72592705 GAAAGGGAAAGGATGGAAAAAGG + Intronic
1027412113 7:77931422-77931444 AAAAATAAAAGGATGTGAACAGG + Intronic
1027654064 7:80906756-80906778 GAAAATAAAAACATTATAAAAGG + Intronic
1027682593 7:81238996-81239018 GAAAAAAAAAGTTTGGAAAAAGG - Intergenic
1028140707 7:87272005-87272027 GAAAGTAAAAGGATTCTACAAGG - Intergenic
1028191995 7:87864666-87864688 GAAAATGAAGGGATGGGGAAAGG - Intronic
1030118068 7:106078794-106078816 GAAAAAAAAAGGAGGGGAAAGGG - Intergenic
1030626238 7:111848909-111848931 GCAGATAAAGGGATGGTCAATGG - Intronic
1030631647 7:111902213-111902235 TAAAATAATAGGACTGTAAAGGG + Intronic
1030706529 7:112698192-112698214 GAAAATAAAGGGATGGAAAAAGG - Intergenic
1030750825 7:113229891-113229913 GAAAATAAAAGGGTAGACAAAGG - Intergenic
1030794344 7:113769798-113769820 CAAAAAAAGAGGAGGGTAAAGGG + Intergenic
1031159343 7:118147389-118147411 GATAATATATAGATGGTAAAAGG + Intergenic
1031207189 7:118775157-118775179 TAAAACAAAAGGAAGATAAATGG + Intergenic
1031231382 7:119111954-119111976 GAGAATAAAGGAATGGAAAAGGG - Intergenic
1031294053 7:119980388-119980410 AGAAGTAAAAGGATGGAAAAGGG + Intergenic
1031316249 7:120261172-120261194 GAAGAGAATAGGATGGAAAAGGG - Intergenic
1031562203 7:123251958-123251980 GAAATCAAAAGGATGGTAAAAGG + Intergenic
1032743230 7:134760437-134760459 GAAAATTGAAGGATGCTAAGAGG + Intronic
1033175469 7:139119550-139119572 AAACATAAAAGGATGCTAATGGG - Intergenic
1033232359 7:139610474-139610496 GCAAATAAAAGGAAGCTACAAGG + Intronic
1033530591 7:142258973-142258995 GAATATATACAGATGGTAAATGG + Intergenic
1033706638 7:143893062-143893084 GAAAGTGAAAGGATGGAAAAAGG + Intronic
1033821194 7:145135916-145135938 GAGAATAGAAGGATGGTTACCGG - Intergenic
1033831155 7:145254875-145254897 CAAAAGATAAGGATGGTAAATGG + Intergenic
1033831621 7:145261216-145261238 GAAAAAAAAATGATATTAAATGG - Intergenic
1033974388 7:147082092-147082114 GGAAAAAAAAGAAAGGTAAAGGG + Intronic
1034146768 7:148880426-148880448 AAAAATATAAGGAAGGGAAAGGG - Intronic
1034713050 7:153213254-153213276 GAAAGTGAAGGGATGGAAAAAGG - Intergenic
1034752134 7:153579188-153579210 TAAAATAAAAGGATAGAAAAAGG + Intergenic
1034760850 7:153670325-153670347 GAAGATAAAAGGGTGGTAAAAGG - Intergenic
1034883674 7:154781243-154781265 GAAAATGAATGGCTGGGAAAAGG + Intronic
1035433960 7:158843902-158843924 GAAGAAAAAAGGAAGGAAAAAGG + Intergenic
1036661567 8:10712566-10712588 TAAAATAAAAGGTTTGTAATTGG + Intergenic
1036931365 8:12959504-12959526 AAAAAAAAAAGGAAGGAAAAAGG - Intronic
1037385343 8:18334019-18334041 GGAAAGAAAAGGATGCTAATGGG + Intergenic
1037422700 8:18720804-18720826 GAAAATAAAATGAGGTTAAAGGG + Intronic
1037636895 8:20708164-20708186 TAAAATAGAAGGATGGCAAAGGG + Intergenic
1037670226 8:21008975-21008997 GGATATAAAAGGATGGTATAGGG + Intergenic
1037697845 8:21242840-21242862 GAAAGTAAAGGGATCATAAAAGG - Intergenic
1037721995 8:21452311-21452333 GAAAACAAAATCATGGTAGAAGG + Intergenic
1037934376 8:22905263-22905285 TAAAAAAAAAGGATGTTAATGGG - Intronic
1038296738 8:26298770-26298792 AATAACAAAAGGATGGGAAAGGG - Intronic
1039209421 8:35195604-35195626 GAAAAGAGAAGGAAGGTGAAAGG + Intergenic
1039778884 8:40764090-40764112 GATAATAAAAGGGTGAAAAACGG + Intronic
1039912645 8:41836936-41836958 AAAAACAAAAGGAGGGTAAGAGG + Intronic
1040656105 8:49510389-49510411 AAAAGTAAAAGGATGAAAAAAGG - Intergenic
1040702240 8:50080313-50080335 GAAATTAAAAGGATAGCATATGG - Intronic
1041060495 8:54030280-54030302 GAATGTAAAAGGATGGAAAAAGG - Intergenic
1041076134 8:54171778-54171800 GAAAATAAATGCATGGATAAAGG + Intergenic
1041139103 8:54795765-54795787 GAAAAAATAAGGATGGCTAATGG - Intergenic
1041159230 8:55020763-55020785 TAAAATAAAAGGGTGAAAAAAGG + Intergenic
1041281379 8:56213304-56213326 GCAAAAAAAAGAATGGAAAAGGG - Intronic
1041322894 8:56633245-56633267 AAAAAAAAAAGAATGATAAAGGG - Intergenic
1041334432 8:56764143-56764165 AAAACTAAAATGATAGTAAAAGG - Intergenic
1041592736 8:59608399-59608421 GAAACTAAAATGATGGAAGAAGG + Intergenic
1041764994 8:61409947-61409969 CATAATAAAAAGATGGGAAAGGG - Intronic
1041782104 8:61588326-61588348 GAAAATAAAAGGATAGCTGAAGG + Intronic
1041816470 8:61977800-61977822 GAAAGTCAAAGGATGGAAAAGGG + Intergenic
1041924801 8:63225488-63225510 CAAAATAAAAGCATAATAAAAGG - Intergenic
1041953390 8:63529779-63529801 TAAAATAAATTGTTGGTAAAAGG + Intergenic
1042129815 8:65577003-65577025 GAAAGTAAACAGATGGAAAAAGG - Intergenic
1042264860 8:66898260-66898282 GAATATAAAAGAATGGAAATAGG - Intronic
1042381605 8:68121165-68121187 GAAAATAAAAGTACTGAAAATGG + Intronic
1042584526 8:70320942-70320964 GATAATAAAAGGATTTCAAAAGG - Intronic
1042740022 8:72032725-72032747 GAAAAAGAAAGGATGGCAATAGG - Intronic
1042755690 8:72208074-72208096 GAAAAACAAAGGATGGCAATAGG - Intergenic
1042980629 8:74522943-74522965 GAAAATAAAGGGATGGAAGAAGG + Intergenic
1043259325 8:78177742-78177764 GAGAATTACAGGATGGTTAAGGG - Intergenic
1043310890 8:78858473-78858495 AACAATAAAAGGATGGACAAAGG + Intergenic
1043715440 8:83479234-83479256 GAAAATAAAGTGGTGGGAAAAGG + Intergenic
1043722518 8:83563664-83563686 GAAAGTAAAAGGGTAGAAAAAGG - Intergenic
1044121301 8:88399541-88399563 GAAATTAAAAGGATAGTTATTGG + Intergenic
1044278668 8:90331639-90331661 GAAAATAAAAGGAAGATGTATGG + Intergenic
1044479604 8:92670016-92670038 TAAAATATAAAGATAGTAAAAGG - Intergenic
1044495594 8:92876615-92876637 GACAATTAAAGCAGGGTAAAGGG + Intergenic
1044511220 8:93081468-93081490 GAATGTTAAAGAATGGTAAAGGG + Intergenic
1044560987 8:93611969-93611991 GAAACTAAAAGGAAGTAAAAAGG + Intergenic
1044579226 8:93806156-93806178 GAAAAGAAAAGGAAGGATAATGG + Intronic
1044707405 8:95022076-95022098 GAAAATATAAGGATTGAATAAGG + Intronic
1045409315 8:101901606-101901628 GAAAAGTAAAGGAATGTAAAGGG - Intronic
1045598754 8:103689824-103689846 GAAAATAAAGAAATGGAAAAAGG - Intronic
1045621758 8:103986446-103986468 TACAATAAAAGGATTGTACATGG + Intronic
1045742053 8:105372562-105372584 GTAAATAAAAGTCTGGTAGATGG + Intronic
1046029864 8:108770471-108770493 CAAAAGAAAAGGAAGGAAAATGG + Intronic
1046233726 8:111393292-111393314 GTAAGAAAAAGGATGATAAAAGG + Intergenic
1046317607 8:112527246-112527268 AAAAGTAAAAAGATGCTAAAAGG + Intronic
1046369375 8:113281402-113281424 GAACATTATATGATGGTAAAAGG - Intronic
1046461284 8:114540288-114540310 TAAAATAAAAAAATGTTAAAAGG + Intergenic
1046608558 8:116397738-116397760 GAAAGCAAAAGGATGGAAAAAGG + Intergenic
1046848018 8:118940330-118940352 AAAAAGAAAAGGGTGTTAAATGG + Intronic
1047591208 8:126329444-126329466 GAAAATAAAGGAAGGGCAAAGGG - Intergenic
1047657087 8:126989805-126989827 GAAAACCAAAGGAGGGAAAAGGG - Intergenic
1047918365 8:129607034-129607056 TAAAATAAATGGAAAGTAAATGG - Intergenic
1047975578 8:130127101-130127123 GAAAATAAAAGTTTGGGAGAAGG + Intronic
1048416638 8:134234488-134234510 GAAATTAAAAAAATGGAAAAAGG + Intergenic
1048609257 8:136004151-136004173 GAAAAGACAAGAATGGGAAATGG + Intergenic
1048672584 8:136739704-136739726 GAAAAAAAAAGTTTTGTAAATGG + Intergenic
1048769117 8:137876824-137876846 GAAATTAAAAATATGGAAAAAGG + Intergenic
1048790901 8:138102340-138102362 GAAAGTAATAGGATGCTAAATGG + Intergenic
1048875803 8:138836283-138836305 GAAAAGAAAAGGAAAGGAAAGGG + Intronic
1050839339 9:10127635-10127657 AATAATAACAGGATGGTAGAAGG - Intronic
1050971732 9:11885787-11885809 GAAAATCAACTGATTGTAAATGG - Intergenic
1051087810 9:13371217-13371239 GAAAATGAGAGGATGGTTAATGG - Intergenic
1051395152 9:16612424-16612446 TCTAATAAAAGGATGGAAAATGG - Intronic
1051477485 9:17523688-17523710 GACAAAAAAAGGATTGTACATGG - Intergenic
1051529051 9:18079349-18079371 GAAGTTAAAAGGATATTAAATGG - Intergenic
1051545186 9:18265796-18265818 GAAAATGAAATTATGGAAAAGGG + Intergenic
1051918740 9:22238532-22238554 GAGACTAAAAGGAAGGTAAGGGG + Intergenic
1052301641 9:26958841-26958863 GAAAAGAAAAAGATGGTGGATGG + Intronic
1052372729 9:27684007-27684029 GAAAATAAAAGGAAGGGAAATGG - Intergenic
1052378073 9:27740577-27740599 CAAAATGAAAGGAGTGTAAAAGG - Intergenic
1052775808 9:32731164-32731186 CAAAATAAAAGGATGGAGGAAGG + Intergenic
1053242337 9:36506288-36506310 GAAAAGAAAAGTATGATTAAGGG + Intergenic
1054894083 9:70287614-70287636 TAAAATAAAGGGATAGAAAAAGG - Intronic
1055129352 9:72756565-72756587 GAAATTAAAACAGTGGTAAAGGG - Intronic
1055650566 9:78403096-78403118 GAAAACAAAAGGACAGGAAAGGG - Intergenic
1055798966 9:80010741-80010763 TGAAATTAAAGGATGGAAAAGGG - Intergenic
1055929766 9:81548002-81548024 GAAAATACAAGATTGGTATAGGG - Intergenic
1056032564 9:82568135-82568157 GAAAATTAAAGGCTGAAAAAGGG - Intergenic
1056211934 9:84372978-84373000 TAAAATACTAAGATGGTAAATGG + Intergenic
1056334844 9:85557938-85557960 AAAAATAATATGATGGTAACTGG + Intronic
1056541493 9:87575261-87575283 TAAAATAAAATAAAGGTAAAAGG + Intronic
1056685995 9:88759839-88759861 GAAAGTAAAAAGAGGGAAAAAGG + Intergenic
1056882152 9:90405524-90405546 TAAAATAAAAGGATGTTTCACGG - Intergenic
1057089383 9:92242979-92243001 CTAAAAAAAAGGATGGGAAAAGG + Intronic
1057323899 9:94042129-94042151 ATAAGTAAAAGGATGGTGAATGG - Intronic
1057346421 9:94255115-94255137 AAAAAAAAAAGCAAGGTAAAAGG - Intergenic
1057558061 9:96103439-96103461 GAAAAGAAAAGGAAAGAAAAAGG - Intergenic
1057560081 9:96120566-96120588 GAAAAGAAATCTATGGTAAAGGG + Intergenic
1057935002 9:99229960-99229982 GAAAAAAAAAGTTTGGTAATGGG + Intronic
1057970300 9:99549912-99549934 GAAAATAAAGGGATGGAAAAAGG - Intergenic
1058041904 9:100311847-100311869 GAAAAAACAAGAATGGTAGAAGG + Intronic
1058207754 9:102129667-102129689 CACAATAAAAAAATGGTAAAGGG - Intergenic
1058393442 9:104522965-104522987 GAAACAAAAAGGATTGTAATAGG + Intergenic
1058666952 9:107328033-107328055 GAAAGTAAAATGATAGAAAAAGG - Intronic
1059122792 9:111657513-111657535 AAAAAAAAAAGCATGGTAACAGG + Intronic
1059172668 9:112140532-112140554 GAAAAGAAAAGAAAGGAAAAAGG + Intronic
1059288064 9:113194501-113194523 TAAAATGAAAGGAGGGTGAAAGG - Intronic
1059380978 9:113924324-113924346 GACATTAAAAGGATGATCAAAGG - Intronic
1059622127 9:116018310-116018332 GAAATAAAAAGGATCATAAAGGG - Intergenic
1059897869 9:118888430-118888452 GAAAATAAAACAATGGAGAAAGG + Intergenic
1059981576 9:119778249-119778271 GAATTTAAAGGGATGGGAAATGG - Intergenic
1060175853 9:121497228-121497250 TAAAATAAAAGGAAAGTACAGGG + Intergenic
1060358691 9:122934054-122934076 GAAAAGAAAAGGTTAGGAAAAGG - Intergenic
1060699442 9:125738044-125738066 GAAAAGAAAAGGAAGAGAAAAGG + Intergenic
1061692986 9:132349637-132349659 AAAAATAAAAGCATTGTATAAGG + Intronic
1062175775 9:135162006-135162028 AAAAAAAAAATGATGCTAAATGG + Intergenic
1062248072 9:135579929-135579951 GTAAATAAATGGATGGACAATGG - Intergenic
1062378013 9:136273296-136273318 GCAAATAAATGGAAAGTAAAAGG + Intergenic
1062596538 9:137302295-137302317 GCAAATATAAAGAAGGTAAAAGG - Intergenic
1203531195 Un_GL000213v1:143699-143721 GAAAGTAAAAGGAGGAAAAATGG - Intergenic
1186087896 X:6011013-6011035 GCAAATTAAAGAATAGTAAATGG + Intronic
1186316878 X:8380438-8380460 AAAAATAAGAGGAAGGTCAAAGG + Intergenic
1186614199 X:11169761-11169783 AAAAAAAAAAGGAGAGTAAAAGG - Intronic
1186751108 X:12621821-12621843 GAAAAGAAAAGAAAGGAAAAAGG + Intronic
1186751236 X:12623009-12623031 GAAAAGAAAAGAAAGGAAAAAGG + Intronic
1186789586 X:12983904-12983926 GAAAATGAAAGGTTTGTAATTGG + Intergenic
1186925522 X:14329537-14329559 GCAAATTAAAGCAGGGTAAAGGG + Intergenic
1187073298 X:15910219-15910241 GAATGTCAAAGGATGGTTAATGG - Intergenic
1187323383 X:18262700-18262722 GAAAAAAAAAGGAAAGGAAAAGG - Intronic
1187406831 X:19011960-19011982 CAAAATAATAGGATGTTAAGTGG - Intronic
1187560316 X:20396667-20396689 GAGAATAAAACAATGGTAAGAGG + Intergenic
1187651803 X:21417640-21417662 CAAAATAATAGAATGATAAAGGG - Intronic
1187686138 X:21817636-21817658 GAAAAAAAAAAGATTGTGAAGGG + Intergenic
1187837638 X:23451169-23451191 CAAAGTAAAAGAATGGGAAAAGG - Intergenic
1187975414 X:24700465-24700487 GATCATAAAAGGTTGCTAAAAGG + Intronic
1188211582 X:27431459-27431481 GAAAATAAAAGAAAGCTAAAAGG + Intergenic
1188418108 X:29962273-29962295 GAAAAAAAAGGGATTGTAAATGG - Intergenic
1188536056 X:31198113-31198135 GATAAAAAAGGGATGGTTAATGG + Intronic
1188757739 X:33985267-33985289 GAAAGTAAAAGGGTTGGAAAAGG - Intergenic
1188974800 X:36660354-36660376 GAGAATAGAAGGATGGTGACCGG + Intergenic
1189291792 X:39891262-39891284 GAAAATAAAGGGAGAGTAAAAGG - Intergenic
1189759466 X:44306343-44306365 AAAAACAAAAGGAGGGCAAAGGG + Intronic
1190027344 X:46936761-46936783 GATATTAAAAGGATAATAAATGG - Intronic
1190504560 X:51113995-51114017 CAAAATAAAAGGATGGAGGAAGG + Intergenic
1190614964 X:52220848-52220870 GAAAATAAAAGGATGGAAAAAGG + Intergenic
1191039273 X:56061898-56061920 GAACATTAAATAATGGTAAAGGG - Intergenic
1191132757 X:57031989-57032011 CAAAGTAAAAGGGTGGGAAAAGG - Intergenic
1191903380 X:66062532-66062554 TAAAATAAAGGGGTGGAAAAAGG - Intergenic
1191928337 X:66340406-66340428 GAAAAAAAAACGGTTGTAAATGG + Intergenic
1192104473 X:68300900-68300922 GAAAATAAAGGCATGGAATAAGG + Intronic
1192347659 X:70324699-70324721 AAAAAAAAAAGAATGGTAAAGGG + Intronic
1192425208 X:71068757-71068779 GAAAATAGAAGGGTGGTCTATGG + Intronic
1192820428 X:74638939-74638961 TAAAGTAAAGGGATGGAAAAAGG + Intergenic
1192855518 X:75006192-75006214 GAAATTAAAAAACTGGTAAATGG - Intergenic
1192970093 X:76219460-76219482 TAAAGTAAAAGGGTGGAAAAAGG - Intergenic
1192978807 X:76316945-76316967 TAAAGTAAAAGGGTGGAAAAAGG - Intergenic
1193084358 X:77436060-77436082 GAAAATAAAACCATGGATAAGGG + Intergenic
1193576145 X:83198731-83198753 GGAAAGAAAAAGATGGTAGAAGG + Intergenic
1193596721 X:83455276-83455298 CAAAATATGAGAATGGTAAATGG - Intergenic
1193601174 X:83509603-83509625 GAAAATGAAAGGAAAGGAAAGGG - Exonic
1193672924 X:84411899-84411921 GAACATTAAATAATGGTAAAGGG - Intronic
1193702780 X:84783469-84783491 GAAAATAAAAGGATGTTTATCGG + Intergenic
1193730625 X:85098118-85098140 GAAAATGAAATGATGGAAAAAGG + Intronic
1193989396 X:88287033-88287055 GATAATCAAAGGATACTAAAAGG + Intergenic
1194024677 X:88736812-88736834 GAAAATAAATTGATTGAAAATGG - Intergenic
1194378935 X:93169696-93169718 GAAAACAAAATGATGAAAAAAGG + Intergenic
1194457277 X:94120644-94120666 GAAAATAAAGGGATGGTAAAAGG - Intergenic
1194477277 X:94373776-94373798 GAAAAGATGAGGATGGTTAATGG + Intergenic
1194543267 X:95201646-95201668 TAAAATAAAAGGGTGGAAAAAGG - Intergenic
1194626374 X:96230785-96230807 AAAAATAAAAGGAGGGAGAAAGG + Intergenic
1194628249 X:96251099-96251121 GAAAATAAAGGAATGGCAAAAGG + Intergenic
1194724089 X:97374149-97374171 GAAAATTAAAGGGTGGGACAGGG + Intronic
1194921754 X:99775752-99775774 TAAAATAAAGGAATGGAAAAAGG - Intergenic
1195019310 X:100810866-100810888 TAAAATAAAGGGGTGGAAAAAGG - Intergenic
1195075272 X:101321478-101321500 GATAAAAAAAGGTTGGTTAATGG + Intergenic
1195198544 X:102523232-102523254 CACAATAAAAGAATGATAAAGGG + Intergenic
1195201651 X:102556284-102556306 TAAAATAAAAGGTTGTTTAAAGG - Intergenic
1195242528 X:102966898-102966920 GAAAAGAGAAGGATGGAAGAAGG - Intergenic
1195496734 X:105544549-105544571 GAATATAAAAGGATCTGAAAAGG - Intronic
1195592454 X:106646159-106646181 GAAAATAAAAGGATGGTAAAAGG - Intronic
1195647379 X:107247596-107247618 GAAAATAAAAGGTTGGGAAGAGG - Intergenic
1195695488 X:107663854-107663876 GAAAAAAAAAGCATGGTCCAGGG - Intergenic
1195933910 X:110107121-110107143 GAAACTAAAAGGAGGGAAAGAGG + Intronic
1196130527 X:112150451-112150473 GAAAATAAAAGAAAGGAAAGTGG - Intergenic
1196134179 X:112188994-112189016 AAACATAAATAGATGGTAAAAGG - Intergenic
1196310181 X:114154942-114154964 TAAAATACAAGGACAGTAAAAGG + Intergenic
1196505240 X:116434611-116434633 GAAAAGCAAAGCATGGTAATGGG + Intergenic
1196575206 X:117309124-117309146 GAAAATAAAATGATTTCAAAGGG - Intergenic
1197013013 X:121589946-121589968 GAAAATAAGTGAATGGAAAATGG - Intergenic
1197045752 X:121996080-121996102 GAAACTAAAAAGAGGGTACAAGG - Intergenic
1197052339 X:122074827-122074849 GAAAATAAAGGGATGAAGAAAGG - Intergenic
1197105208 X:122705658-122705680 GAAAATTAAGGGATGGAAAAAGG + Intergenic
1197186686 X:123595240-123595262 CAAAATAAACTGATGGTGAAGGG - Intergenic
1197662229 X:129186715-129186737 GAAAAACTAAGGCTGGTAAACGG + Intergenic
1197668882 X:129254063-129254085 TAAAGTAAAGGGATGGAAAAAGG - Intergenic
1197866968 X:131029320-131029342 GAAAACAAAGGGAAGGAAAAGGG - Intergenic
1198042559 X:132868068-132868090 CAAAATAAAGGGATGGAGAAAGG + Intronic
1198107341 X:133474254-133474276 AAAAATAAAATGATGGGAAGAGG + Intergenic
1198538711 X:137613247-137613269 TAAAATAAAAGAATGGGAAAAGG + Intergenic
1198696977 X:139352356-139352378 GAAAATAAAGGGGTGGAAAAAGG - Intergenic
1198977989 X:142358814-142358836 GTAAACTAAAGGTTGGTAAATGG - Intergenic
1199021693 X:142886128-142886150 GAAAAAAAAAACCTGGTAAACGG - Intergenic
1199032515 X:143016966-143016988 GAAAATATAACGAAGATAAAGGG + Intergenic
1199081511 X:143581875-143581897 GAAACAAAAAAGATGGTGAATGG + Intergenic
1199149466 X:144413507-144413529 AAAAATAAAGGGATGGAAAAAGG - Intergenic
1199355992 X:146865377-146865399 GAAAATAAAATAAAGGAAAAAGG + Intergenic
1199615923 X:149655964-149655986 TAATATAAGAGGATGGTAATAGG + Intergenic
1199797220 X:151211753-151211775 TAAAGTAAAGGGATGGAAAAAGG + Intergenic
1199946117 X:152669586-152669608 TAAAAAAAAAGGAAGGAAAAGGG - Intergenic
1200391723 X:155952356-155952378 GAAAAAAAAAAAATGGCAAAAGG - Intergenic
1201386939 Y:13451412-13451434 GAAAAAAAAAGAACGGAAAAAGG + Intronic
1201535872 Y:15047678-15047700 GAAAAAAAAAGAATGTGAAATGG - Intergenic
1201615042 Y:15887581-15887603 TAAAATAAAAGGATGGAGGAAGG + Intergenic
1201618444 Y:15928021-15928043 GTAAAGAAAAAGATGATAAATGG + Intergenic
1201776420 Y:17670886-17670908 GAATATAAAAGATTGGTATAAGG - Intergenic
1201825136 Y:18235106-18235128 GAATATAAAAGATTGGTATAAGG + Intergenic