ID: 1195596272

View in Genome Browser
Species Human (GRCh38)
Location X:106693781-106693803
Sequence CTGTGTGTACAGCTGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 354}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195596267_1195596272 -7 Left 1195596267 X:106693765-106693787 CCTGGTTAAGGGTTACCTGTGTG No data
Right 1195596272 X:106693781-106693803 CTGTGTGTACAGCTGGAGGAGGG 0: 1
1: 0
2: 1
3: 40
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195596272 Original CRISPR CTGTGTGTACAGCTGGAGGA GGG Intronic
902321674 1:15672052-15672074 CTGTGTCTACAGCTTGGGGGAGG + Intergenic
902526772 1:17063979-17064001 CTGCATGTCCAGCTGGAGAAGGG + Intergenic
902797146 1:18807284-18807306 CTCTGTGTCCAGCAGGTGGAAGG - Intergenic
902873474 1:19327548-19327570 CTGGGTGAACAGATGGAGGGAGG - Intronic
903548307 1:24140953-24140975 TTGTGTGTAGAGTTGGAGTAGGG - Intronic
905268289 1:36770079-36770101 ATGTGTGGACATCTGGAGAAGGG - Intergenic
906511544 1:46412963-46412985 CTGTGTCTACAGCCAGAGAAAGG - Intronic
907052636 1:51340023-51340045 CTGTGTCTTCACATGGAGGAAGG - Intronic
907334697 1:53692616-53692638 CTGTGGGTGTAGCTGGGGGAGGG + Intronic
908969940 1:69815904-69815926 CTATGTCTTCAGCTGGTGGAAGG + Intronic
910510535 1:87999224-87999246 ATCTGTGTCCAGCTGGTGGAAGG + Intergenic
911741428 1:101390160-101390182 ATGTTTGTACACATGGAGGAGGG + Intergenic
917930460 1:179819045-179819067 CTGTGTGCTGGGCTGGAGGATGG - Intergenic
918269127 1:182879202-182879224 CTGTGTATACACAAGGAGGATGG + Intronic
918819902 1:189239685-189239707 ATGTGTGTACAGATTGAGGTAGG + Intergenic
920534963 1:206731428-206731450 CTGTGTGGAGGGCTGGAGGCAGG + Intronic
921322291 1:213953723-213953745 CTGTGTGGGCAGGTGGAGGCTGG - Intergenic
921986184 1:221315521-221315543 CTGTGTCCATAGCTGGGGGAAGG + Intergenic
922725461 1:227920964-227920986 CGGGGCGTACAGCTGGAGCAGGG - Exonic
1062886588 10:1021138-1021160 GTGTGTGCACATCTGCAGGAAGG - Intronic
1062982997 10:1741121-1741143 CTGTGTGGTCAGCCGCAGGAAGG - Intergenic
1063447697 10:6130027-6130049 CTGTGTGCAGAGGAGGAGGAGGG - Intergenic
1063631902 10:7741867-7741889 CTGAGTGTACAGAATGAGGAAGG - Intronic
1063762250 10:9093087-9093109 CTGTGTCCTCACCTGGAGGAAGG - Intergenic
1063856234 10:10257324-10257346 CTGTCTGTGCAGCAGGAGGAGGG - Intergenic
1064548472 10:16475009-16475031 CTGTGTGTTCACATGGTGGAAGG + Intronic
1064735265 10:18375745-18375767 CTGTGTCTACAGTTGAAGGATGG + Intronic
1065386396 10:25137974-25137996 CTGGGTCTACAGCTTGTGGATGG - Intergenic
1067452383 10:46390299-46390321 GTGAGGGTACAGCAGGAGGAAGG - Intronic
1067517408 10:46963580-46963602 ATGTGTGTACAGAGGGATGAGGG + Intronic
1067584851 10:47469456-47469478 GTGAGGGTACAGCAGGAGGAAGG + Intronic
1067750685 10:48969291-48969313 CTCTGCCTCCAGCTGGAGGAAGG - Intronic
1067776298 10:49167190-49167212 CAGTTTCTACAGCTGAAGGAGGG - Intronic
1068561512 10:58519929-58519951 ATGTGTGGACAGTGGGAGGAGGG - Intronic
1068690434 10:59908147-59908169 CTGTTTGTATAGCAGGAGGGAGG + Intergenic
1068739468 10:60452144-60452166 CTGTGTGCACCGCTAGAGGCTGG - Intronic
1069644122 10:69979725-69979747 CAGTGTGTCCAGCTTGAAGATGG - Intergenic
1069716188 10:70522933-70522955 GTGTGTGGCCAGCAGGAGGAAGG + Intronic
1071708431 10:88025005-88025027 CTGTGTGTAAAGCAGGATGAAGG + Intergenic
1072605809 10:96981741-96981763 CTTTGTGTACAGCTGGCATAGGG - Exonic
1073105325 10:101029627-101029649 TTGTGTGTACTTCTGGGGGATGG - Intronic
1073141084 10:101248235-101248257 CTGTGTCTTCACATGGAGGAAGG + Intergenic
1073420479 10:103420216-103420238 CTGTGTGACCATCTGGAGGAAGG + Intronic
1073472118 10:103729259-103729281 CTGTGGGTAAAGCTAGAGGCAGG - Intronic
1074182242 10:111075842-111075864 CTGTGTGTACATCTGAATGGGGG + Intergenic
1074225606 10:111481327-111481349 CTGTATGTACAGCATGAGCAGGG + Intergenic
1075682796 10:124344322-124344344 CTGGCTGTGAAGCTGGAGGAAGG - Intergenic
1076468513 10:130702513-130702535 ATGTGTGCACAGCTGGCAGAGGG + Intergenic
1076686219 10:132199602-132199624 CAGTGCGGACAGCAGGAGGAGGG - Intronic
1077298656 11:1837522-1837544 CTGTGTGTCCGGCTGGAGCCTGG + Intergenic
1077475932 11:2790487-2790509 CTGTGTGCACAGCTGGATGCTGG - Intronic
1077640882 11:3880453-3880475 GTTTGTGGACAGCTGGGGGATGG + Intronic
1079385627 11:19976776-19976798 CTGTGTGTTCTCCTGGGGGATGG + Intronic
1080443789 11:32318599-32318621 CTGAGTCAACAGCTGGAGGTAGG + Intergenic
1081516325 11:43833939-43833961 CATTGTGTACAGCTGGAGCCAGG + Intronic
1081660761 11:44886944-44886966 CTGTGTGTAGAGCAAGAGGCTGG + Intronic
1081804224 11:45881567-45881589 CTGTGTGTACTTCTGTAGGGTGG - Exonic
1082771427 11:57210796-57210818 CTGTCTGCACCGTTGGAGGATGG - Intergenic
1083604883 11:63972540-63972562 GTGTTTGTAGAGCTGGAGGGGGG - Intergenic
1083671848 11:64304355-64304377 CTGAGTGTTAAGGTGGAGGATGG - Intronic
1084736858 11:71110977-71110999 CTGTGTCTTCACGTGGAGGAAGG - Intronic
1089001988 11:115059856-115059878 CTGTTTGTACTGCTGGAGGCTGG - Intergenic
1089405575 11:118194709-118194731 CTGTGTGTACAGCCTCAGAAAGG + Intronic
1089729231 11:120510491-120510513 CAGTGTGTGGAGCTGGGGGAGGG + Intergenic
1090024560 11:123156619-123156641 CATTTTGTACAGCTGGAAGAAGG + Intronic
1090512293 11:127388128-127388150 ATGTGAGTACAGCTCTAGGATGG + Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1090731251 11:129574890-129574912 CTGTATTTGAAGCTGGAGGAAGG - Intergenic
1091033526 11:132213168-132213190 CGGTGTGCACAGATGGATGAAGG + Intronic
1091782882 12:3224998-3225020 CTGTGTGTGCAGCTGGTGGTGGG + Intronic
1091801541 12:3327772-3327794 CTGTGTTGACAGCTGGGGGGAGG + Intergenic
1092214616 12:6672349-6672371 CCGTGTGTGCTGCTGGAGGTGGG + Exonic
1093889092 12:24498050-24498072 CTGAGGGTGCAGCAGGAGGAGGG + Intergenic
1097954134 12:65465920-65465942 CTGTGTGTGCCTCTGAAGGATGG - Exonic
1099805508 12:87513758-87513780 ATGTGTGTATAGCAGGGGGAGGG - Intergenic
1100387664 12:94118739-94118761 CTCTGTGTAAAGCTGGACTATGG - Intergenic
1101581972 12:106049737-106049759 CTGTGTGCCAGGCTGGAGGATGG - Intergenic
1102540577 12:113616380-113616402 CTCTGTGTAAAGGTGGAGCAGGG + Intergenic
1102646425 12:114406725-114406747 CCTTGTGTACACCTGGAGCAGGG - Intronic
1103603943 12:122072758-122072780 CGGTGTGTACGGCAGGAGCATGG - Intergenic
1103731688 12:123032087-123032109 CTGGCTGCACAGCTGCAGGAAGG + Intronic
1104155559 12:126127861-126127883 CAGTGTGTACTGCTGGGTGATGG + Intergenic
1104399239 12:128461993-128462015 CTGTGTGTTCAGCAGAAGGTGGG + Intronic
1104425681 12:128675716-128675738 GTGGGTGGACAGATGGAGGAAGG + Intronic
1104644773 12:130489270-130489292 GTGTGTGTACGCCTGGATGAGGG + Intronic
1104703273 12:130923509-130923531 CTGTGTTTTCACCTGGCGGAAGG - Intergenic
1104743501 12:131195540-131195562 CTGTGTTTACAGCTGGATCACGG - Intergenic
1104790832 12:131481144-131481166 CTGTGTTTACAGCTGGATCACGG + Intergenic
1106554346 13:30797284-30797306 CAGTGTGAAACGCTGGAGGAGGG + Intergenic
1108030192 13:46221116-46221138 CTATGTGTACAGCTGGCACATGG + Intronic
1108066324 13:46581276-46581298 CTCTGTGTGCAACTGGAGTATGG + Intronic
1111788713 13:92825149-92825171 CTGTGATTTCAGCTGGAGAAGGG - Intronic
1112025202 13:95405364-95405386 CTGTGTCTTCTGGTGGAGGAGGG + Intergenic
1112429815 13:99341546-99341568 GTGTATTTAAAGCTGGAGGATGG + Intronic
1112882556 13:104124969-104124991 CTCTGTGTGCAGATGAAGGATGG + Intergenic
1113729023 13:112626404-112626426 CTGTGTGACTAGCAGGAGGAGGG - Intergenic
1114487488 14:23071576-23071598 CTGTGTGTGCGGATGGGGGAGGG + Intronic
1114600447 14:23951966-23951988 CTGTGTGTGCGGCTGGGGGAGGG - Intergenic
1114931480 14:27474249-27474271 CTATATGTACAGCTTGAGAAGGG - Intergenic
1115319741 14:32066913-32066935 CTGTGTGTACATCTGCAGTGTGG - Intergenic
1115619193 14:35124010-35124032 CTGTGTTTACATCTTGATGAAGG - Exonic
1115762962 14:36594009-36594031 CTGAGTGCACAGCTTCAGGAGGG + Intergenic
1116588645 14:46742522-46742544 CTGAATGTGCAGCTTGAGGATGG + Intergenic
1116692376 14:48125832-48125854 CTGTGTGGACAGCTGGTTCAGGG + Intergenic
1119613106 14:76080355-76080377 CTTTGTGCACATTTGGAGGAGGG + Intronic
1120787464 14:88550528-88550550 CTGGGTGAGCAGCTGGAGGCCGG - Exonic
1120960153 14:90117195-90117217 CAGTGTATACAGCTGGACAAAGG + Intronic
1121794920 14:96726758-96726780 CTGTGTGTAGTGGTAGAGGATGG + Intergenic
1122650044 14:103221154-103221176 AAGGGTGTACAGCTGGACGATGG + Intergenic
1123681224 15:22765636-22765658 CTCTGTGTCCAGCTGGGGGAAGG + Intergenic
1123704583 15:22941724-22941746 CTGTGTGCAAAGCTGGGGGAAGG - Intronic
1123793987 15:23753384-23753406 CAGTGTGCAGAGCAGGAGGAGGG + Intergenic
1124013633 15:25859262-25859284 CTGAGTGTCCAGCTGGAACAGGG - Intronic
1124111161 15:26789946-26789968 CCGTCTTAACAGCTGGAGGAAGG - Intronic
1124125831 15:26937529-26937551 CTCTGTGTGCAGCTGCAGGGAGG - Intronic
1124159161 15:27253416-27253438 CTGAGTGGACAGCTTGGGGAGGG - Intronic
1124246870 15:28078627-28078649 CTCAGTGTTCAGCTGGAGCAAGG - Intronic
1124333435 15:28840098-28840120 CTCTGTGTCCAGCTGGGGGAAGG + Intergenic
1124857738 15:33407079-33407101 CTGTGTCTACACGTGGTGGAAGG + Intronic
1125217249 15:37289553-37289575 CTGTGTCTTCACCTGGTGGAAGG + Intergenic
1125852564 15:42918987-42919009 CTGTGTCTAAAACTGGAAGAGGG + Intronic
1126838181 15:52688901-52688923 CTATTTTTACAGATGGAGGAAGG + Intronic
1127396049 15:58544718-58544740 CTGTGGGTAGGGCTGGAGAACGG + Intronic
1127597159 15:60497174-60497196 CTCTGTTTACAACAGGAGGAGGG - Intronic
1127764017 15:62166984-62167006 CTGAGTGAATAGATGGAGGAAGG - Intergenic
1130247348 15:82263493-82263515 CTGTGTTTACAGGTGATGGAAGG - Intronic
1130288189 15:82572568-82572590 CTGTGCCTACAGTTGCAGGAGGG - Intronic
1130557683 15:84934294-84934316 GTGTGTGTACATGTTGAGGAGGG + Intronic
1131229068 15:90647159-90647181 GTGGGTGTAGAGGTGGAGGAGGG - Intergenic
1131366634 15:91847033-91847055 GTGTGTGAACGGCTGGGGGAGGG + Intergenic
1131461336 15:92619667-92619689 CTGTGTGGGGAGCTGGGGGAGGG - Intronic
1132025257 15:98399648-98399670 CTGTGTGCTCACATGGAGGAAGG - Intergenic
1135222623 16:20625740-20625762 CTGCCTGTACTGATGGAGGACGG + Intronic
1135865719 16:26099978-26100000 CTGTGTGGCTATCTGGAGGAAGG + Intronic
1135922574 16:26664263-26664285 GTGTGTGTCCATCTGGATGAGGG - Intergenic
1136274492 16:29170419-29170441 CTATGTGTTCAGCTGGACAAAGG + Intergenic
1137495374 16:48965313-48965335 CTGTGTAGACAGATGAAGGAGGG + Intergenic
1139647866 16:68344919-68344941 GTGTGTGTAGAGATGCAGGAAGG - Intronic
1140558445 16:75948259-75948281 CTGTCTTTAGAGATGGAGGAAGG + Intergenic
1141489540 16:84362884-84362906 CTGTGGGTACGGCGGGAGGACGG - Intergenic
1141859158 16:86704724-86704746 CTGTGTGAACAGCTCCATGAGGG - Intergenic
1142078778 16:88136073-88136095 CTATGTGTTCAGCTGGACAAAGG + Intergenic
1142205208 16:88779677-88779699 CTGTGTGTGCAGCATGAGGGAGG + Intronic
1143284912 17:5781744-5781766 CTGCAGGTACAGGTGGAGGATGG + Intronic
1143727155 17:8856987-8857009 CTGTGGGGAAAGCTGGGGGAAGG - Intronic
1144523282 17:15968568-15968590 CTGTGTGGTCAGGCGGAGGAGGG + Intronic
1144836946 17:18161499-18161521 CTGGGTGGACAGCTGGTGGGAGG + Intronic
1145231162 17:21174376-21174398 CTGTGGCTAAAGCTGGAGGAAGG - Intronic
1145902576 17:28498120-28498142 CGGTTTTTCCAGCTGGAGGAAGG - Intronic
1146460328 17:33041109-33041131 CTGTGTGGGCAGGAGGAGGAGGG - Intronic
1147159719 17:38562952-38562974 CATTGTGCACAGCTGGGGGATGG - Intronic
1147182635 17:38696195-38696217 CTGTGTGCCCTGGTGGAGGAGGG - Intergenic
1147210244 17:38869117-38869139 CTTTGTGCTCAGCGGGAGGAGGG - Intergenic
1147316265 17:39621891-39621913 GTGTGTGTAAGGCTGGTGGAGGG + Intergenic
1148960966 17:51392469-51392491 GTGTGTGTATATCTGGAGCAGGG + Intergenic
1149436041 17:56634216-56634238 CTGTGTCTACACATGGTGGAAGG + Intergenic
1149473398 17:56938224-56938246 AAATGTGTACAGCTGAAGGAGGG + Exonic
1149661370 17:58335767-58335789 ATGTGAGTACAGGTGGAAGAGGG + Intergenic
1151320427 17:73349299-73349321 GTGTGTGTTCATCTAGAGGATGG - Intronic
1151666900 17:75550241-75550263 CTGTGTGTACCTTTGCAGGAAGG + Intronic
1151727587 17:75893711-75893733 CTGTGTGAAATGCTGGAGGCTGG - Intronic
1151804475 17:76397023-76397045 CTTTGGGTCCAGCTGGAGGGTGG - Intronic
1151944944 17:77314675-77314697 CAGTGTGTACTCCTGGAGCAAGG + Intronic
1152041328 17:77905839-77905861 CTGTGTGAGCAGCTAGTGGACGG - Intergenic
1152092008 17:78252354-78252376 CAGAGTGTGCAGCTGGTGGATGG - Intergenic
1152224335 17:79085769-79085791 CTGTTTGTCCAGCTGGAGTGGGG + Intronic
1152387686 17:79984902-79984924 CTGTGTCCGAAGCTGGAGGATGG - Intronic
1157131219 18:45009120-45009142 CTGTGGGTACAGTTGGCGGCTGG - Intronic
1157401864 18:47395453-47395475 CTGTGTTCCCAGCAGGAGGAAGG + Intergenic
1158883529 18:61804323-61804345 CTGTGTGTTCACATGGCGGAAGG + Intergenic
1160198899 18:76779885-76779907 CTGGCTGTGCAGATGGAGGAAGG + Intergenic
1160905980 19:1451935-1451957 GTGTGTGGCCAGGTGGAGGAGGG + Exonic
1161634196 19:5377060-5377082 CTGTGAGAACATGTGGAGGAAGG + Intergenic
1161854960 19:6759022-6759044 CTGTGTGACCAGCATGAGGAGGG + Intronic
1162127317 19:8506490-8506512 CTGTGTGTACAGCGGGCCCACGG - Intergenic
1162712882 19:12609290-12609312 CTGTGTGTACAGGTAGATGCAGG - Intronic
1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG + Intronic
1163187542 19:15649598-15649620 CTTTGTGGACAGCTTCAGGAAGG + Intronic
1163782273 19:19256818-19256840 CCATGGTTACAGCTGGAGGAGGG + Exonic
1165022326 19:32935089-32935111 CTGTGTGTTCTGCCTGAGGAGGG - Intronic
1165941567 19:39417058-39417080 CTGTTGGTTCATCTGGAGGATGG + Intronic
1166746603 19:45144843-45144865 CTGAGTGTGCGGCTGGAGGGAGG - Exonic
1167246015 19:48373668-48373690 CTGTGTGTCCAGGACGAGGAAGG - Exonic
1167552008 19:50167817-50167839 CCGTGTGTGCATGTGGAGGAAGG - Intergenic
1168449859 19:56457937-56457959 CTGTGTCTGCACATGGAGGAAGG - Intronic
925156103 2:1649864-1649886 CTGTGTTTGGGGCTGGAGGAGGG - Intronic
925568108 2:5279046-5279068 CTGGGTGTTCAGCTTGAGAAAGG - Intergenic
925902094 2:8515957-8515979 CTGTGTGGGGAGGTGGAGGAGGG - Intergenic
925977601 2:9151969-9151991 CTGTGTGTACAGCAAGAGCATGG - Intergenic
926089293 2:10040008-10040030 CTGTCTGTCCATCTGGAAGATGG + Intergenic
927154547 2:20213879-20213901 CTGTGTGTGAAGGTGGGGGAGGG + Intronic
928400932 2:30978216-30978238 CAGTTTGGGCAGCTGGAGGAGGG - Intronic
929920920 2:46171072-46171094 CTGTGTCTCCAGCTGGAAGTGGG - Intronic
930443418 2:51438199-51438221 CTGTGTGTGCAGTGGGTGGAGGG + Intergenic
930505714 2:52280990-52281012 CTGTGTTCTCAGATGGAGGAAGG + Intergenic
930660022 2:54044104-54044126 CTGTGTGTACATCTGTTGCAGGG - Intronic
934851972 2:97707318-97707340 CTGCGTGGAGAGCTGGGGGAGGG + Intergenic
934980233 2:98833410-98833432 CTGTGTGTGCAGCAGGCTGAGGG + Intronic
935308061 2:101757086-101757108 CTGTGTGTACCTTTGGAGTAAGG + Intronic
935374165 2:102378374-102378396 GTGTGTGTACAGCTCTAGGATGG + Intronic
935708585 2:105877555-105877577 CTGTGTCTCCAGATGGAAGAGGG - Intronic
936328258 2:111524032-111524054 CTGTGTGCATAGCTGGAGATGGG + Intergenic
936550159 2:113430820-113430842 CTGTGTGTTCACCTGGCAGAAGG - Intergenic
936690852 2:114886795-114886817 CTGTGAGTACAGCCAGAGCAAGG - Intronic
936870903 2:117133267-117133289 GAGTGAGTACAGCTGAAGGAGGG - Intergenic
937331649 2:121034283-121034305 CTGTCTGTAAACCAGGAGGAGGG - Intergenic
937463131 2:122106452-122106474 CTGAGTGTAGAGGTGGAGGTGGG + Intergenic
938072640 2:128316713-128316735 GTGTGTGTACAGTTGGGGGAGGG + Intronic
939814216 2:146874108-146874130 CTCAGTGTACAGATGGAGCAAGG - Intergenic
941964990 2:171292187-171292209 CTGGGTGGAGAGCTGGAGGGTGG - Intergenic
943367785 2:186982053-186982075 CTGTGGCTGCAGCTGGAGCAAGG - Intergenic
943896005 2:193360494-193360516 CTGTCAGTACAGCTGGATGAGGG + Intergenic
946059061 2:216926210-216926232 CAGTGTGCAGAGTTGGAGGAAGG + Intergenic
948059492 2:235032641-235032663 CTGCGTGTAGAGCTGGATGAAGG - Intronic
948120710 2:235528323-235528345 CTGAGTGCACAGATGGTGGATGG - Intronic
948295237 2:236855663-236855685 CTGGCTGTGCAGATGGAGGAAGG - Intergenic
948940210 2:241191528-241191550 GTGGCTGAACAGCTGGAGGATGG - Intronic
1170615416 20:17945217-17945239 CTGTGTGTAGGTCTAGAGGAAGG - Intronic
1173648637 20:44649500-44649522 CAGTGTCCACACCTGGAGGATGG - Intronic
1173935585 20:46859449-46859471 CTGAGTGTGCAGCTTCAGGAGGG - Intergenic
1175515668 20:59568384-59568406 CTCTGTGCCCAGGTGGAGGAGGG + Intergenic
1176111658 20:63413706-63413728 CTGTGTGTGGAGCTGGTGGGCGG - Intronic
1176185448 20:63775881-63775903 CTCTATGCACAGGTGGAGGAGGG - Exonic
1177723370 21:24936213-24936235 ATGTGTGTACAGCTGGTGCTGGG + Intergenic
1178704835 21:34864574-34864596 CTGTGTGTGCTGCTGGAAGTCGG + Intronic
1179405314 21:41121115-41121137 CTGTGTGAAGACCTGAAGGAGGG - Intergenic
1179823452 21:43950821-43950843 CTGCGTTTAAAGCGGGAGGAAGG + Intronic
1180228870 21:46414455-46414477 CTGTGTGTCCAGGAGGAGGAGGG - Intronic
1180228898 21:46414566-46414588 CTGCGTGTCCAGGAGGAGGAGGG - Intronic
1180228941 21:46414734-46414756 CTGCGTGTCCAGGAGGAGGAGGG - Intronic
1180228949 21:46414761-46414783 CTGTGTGTCCAGGAGGAGGGTGG - Intronic
1180228973 21:46414857-46414879 CTGTGTGTCCAGCAGGAGGAGGG - Intronic
1182700155 22:32230227-32230249 CTGTGTGTCAGGGTGGAGGAAGG + Intronic
1183022355 22:35037601-35037623 GAGTGTGTACAGCTTGAGTAGGG - Intergenic
1183261495 22:36798578-36798600 CTGTGTGGAATGCAGGAGGAGGG - Intergenic
1183586705 22:38756910-38756932 CTATCTGTACAGTTGGCGGATGG - Intronic
1183700810 22:39449976-39449998 CTGTGTCTACCGCTGGCGGTAGG - Intergenic
1183778514 22:39983703-39983725 CTGTGGGTACAGATGGTGGTGGG - Intergenic
1184486544 22:44783317-44783339 CTGTGTGGACAGCTCGGGGATGG - Intronic
1184510478 22:44930446-44930468 CTCTGTCTACAGCTGGAAGCAGG + Intronic
1185148475 22:49151617-49151639 CTGTGTGTCCCACTGGAGGCAGG + Intergenic
1185181842 22:49368232-49368254 CTGTTTGGGCACCTGGAGGATGG - Intergenic
950915700 3:16642934-16642956 CACTGTGTTCAACTGGAGGAAGG - Intronic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
951702662 3:25511791-25511813 CTCTGTGCACAACTTGAGGATGG + Intronic
952832421 3:37576213-37576235 CTGTGTGCCCAGCTGCAAGAAGG - Intronic
953179341 3:40581894-40581916 CTGTGTGTCCTGCTGCAGGGAGG + Intergenic
953576982 3:44120758-44120780 CTGTGTGAGCAGCAGCAGGAAGG - Intergenic
954801702 3:53190736-53190758 CTGTGTGCCCTGGTGGAGGAGGG - Intronic
958662477 3:97088561-97088583 CTGTGTCTTCAGGTGCAGGAAGG - Intronic
959370565 3:105520274-105520296 CTGTGAGTACAAATGTAGGAAGG + Intronic
961677937 3:128578938-128578960 CAGTGGGGACAGCTGCAGGATGG + Intergenic
962350723 3:134653736-134653758 TTGTGTGAGCAGCTGGAGGGAGG - Intronic
962423569 3:135249458-135249480 CTGGGTGACCAGCTGGAGGGAGG - Exonic
962756391 3:138468250-138468272 AGGTGTGTGCAGGTGGAGGAAGG + Intronic
963127784 3:141831224-141831246 TTGTGTGTAGAGATGGAGAAAGG + Intergenic
965670754 3:171145414-171145436 CTGGGTGTATAGCCAGAGGAAGG - Intronic
966599046 3:181756870-181756892 GGGGGTGAACAGCTGGAGGAGGG + Intergenic
967564432 3:190957445-190957467 CTGTGCCTACAGCTTGAGAAAGG + Intergenic
969031398 4:4217892-4217914 CTTTGTGGAAAGCTGGAGGAGGG + Intronic
969342637 4:6551793-6551815 GTTGGTGTTCAGCTGGAGGATGG - Intronic
969555437 4:7905739-7905761 CTGTGTGTGCTTCTTGAGGAGGG - Intronic
971663820 4:29456341-29456363 CTGTCTTTAAAGATGGAGGAAGG - Intergenic
972628453 4:40822952-40822974 CAGTGTGGCCAGCTGGAGGCAGG + Intronic
973982580 4:56318387-56318409 CTGTTTGTCCTGCTGGATGAGGG + Intronic
974282865 4:59822057-59822079 CTGAGTGTTCAGCTGAAGGGAGG - Intergenic
977603765 4:98961474-98961496 CTGTGTCTTCACATGGAGGAAGG - Intergenic
979352060 4:119655685-119655707 ATGTGGGTCCAGCTGTAGGAAGG - Intergenic
979551993 4:122001880-122001902 CTGTGTGTGATGCTGGTGGATGG + Intergenic
979642591 4:123026366-123026388 AAATGTGTACAGCTGAAGGAGGG - Intronic
981374451 4:143997483-143997505 CAGTGTGAACAGCTCTAGGAGGG - Intronic
982536581 4:156614426-156614448 CTGTGTGTGAAGCAGGAGGCGGG + Intergenic
982572545 4:157068495-157068517 CTGTGTCTTCACATGGAGGAAGG + Intergenic
982788741 4:159566055-159566077 ATGTGTGGATAGCTGGAGGATGG - Intergenic
983602839 4:169549271-169549293 CAGTGTGTACAGCCCAAGGAGGG - Intronic
984162876 4:176275531-176275553 CTGTGTAAACTGCTGGAGAAAGG - Intronic
985099513 4:186444489-186444511 CTGAGTGGACAGCTGTAGGAGGG + Intronic
986041871 5:4001376-4001398 CAGGGAGTACAGCTGGGGGAAGG + Intergenic
986392213 5:7297630-7297652 CTCTGTGTCCAGCTGGGGGAAGG + Intergenic
987082771 5:14440760-14440782 CTTTGTGTACATCTGGAGGGAGG - Intronic
990389365 5:55303275-55303297 CAGTGTGTACATCTGCAGAATGG + Intronic
991113465 5:62927603-62927625 CTGAGTCTAAAGCTTGAGGATGG + Intergenic
996848931 5:127931492-127931514 CAATATGCACAGCTGGAGGAGGG - Intergenic
997447971 5:133955678-133955700 CTTTATGTAGAGCTGGAAGAAGG - Exonic
998460653 5:142307676-142307698 CTGTCTGGAGAGCTGTAGGAGGG + Intergenic
999252365 5:150190383-150190405 CTGGGGGTGCACCTGGAGGAGGG + Intronic
999859539 5:155631066-155631088 CTGTGTGTACCTCTGGGGCAAGG + Intergenic
999897034 5:156045840-156045862 CTGTGGCTACAGTTGGAGGGGGG - Intronic
1000546112 5:162604822-162604844 ATGTATGTAGAGCTGGAGGCTGG + Intergenic
1001269739 5:170302305-170302327 CTGTGTGTGGGGCTGGGGGAAGG + Intergenic
1001563725 5:172686424-172686446 CTGTATGCTCAGCTGGAGGGAGG + Intronic
1001728008 5:173924086-173924108 ATGTTTCTACAGATGGAGGAAGG - Intronic
1002001129 5:176196810-176196832 CTGGGTGTGCATGTGGAGGAAGG - Intergenic
1002253206 5:177942162-177942184 CTGGGTGTGCATGTGGAGGAAGG + Intergenic
1002644344 5:180645830-180645852 CAGTGTGTCCAGCTGGAGCCAGG - Intronic
1002783643 6:385047-385069 CTGTGTGTACTGATGGAAAATGG + Intergenic
1002889977 6:1324012-1324034 CTCTGTGCCCAGCTGGAGGATGG + Intergenic
1004050747 6:12076540-12076562 CTGTGTCTTCACATGGAGGAAGG + Intronic
1005405755 6:25486087-25486109 CAGTGTTTACAGCTGGAAAAAGG - Intronic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006436489 6:34028355-34028377 CTGGATGTACAGCTGGCGGAGGG + Exonic
1009815362 6:68726335-68726357 CTGTGTGCACATCTTGAGAAAGG - Intronic
1010121666 6:72382829-72382851 CTCTGTGTAGAGGTAGAGGACGG - Intronic
1012728769 6:102852404-102852426 GTGTGTGTACAAATGGAGTAAGG - Intergenic
1013749261 6:113383531-113383553 CTGTGTCTTCACCTGGTGGAAGG + Intergenic
1014493393 6:122090239-122090261 CTGTAAGTAGAGCTGGAGAAAGG + Intergenic
1017341604 6:153330656-153330678 CTGTATGTTCAGATGGAAGATGG + Intergenic
1018176141 6:161180986-161181008 CTATCTGTAAAGATGGAGGAGGG + Intronic
1018706305 6:166465779-166465801 GTCTGTGAGCAGCTGGAGGACGG + Intronic
1018951730 6:168382775-168382797 CTGTGTCCACAGCTGGATGGGGG - Intergenic
1019047771 6:169161574-169161596 GAGTTTGGACAGCTGGAGGATGG - Intergenic
1019659383 7:2215566-2215588 CTGGGTGTGGAGATGGAGGACGG - Intronic
1019694414 7:2437172-2437194 GTGTGGACACAGCTGGAGGATGG - Intergenic
1022162116 7:27721549-27721571 CTGTGGGTCCAGCTCCAGGAGGG + Intergenic
1023181049 7:37484224-37484246 ATGTGGTGACAGCTGGAGGAAGG + Intergenic
1023662226 7:42481536-42481558 GTGTGTGCACAGCAGGAGGAGGG + Intergenic
1023770418 7:43551891-43551913 CTGTGTCTTCATGTGGAGGAAGG + Intronic
1024153907 7:46600742-46600764 TTGTCTGTACAGCAGGAAGATGG - Intergenic
1025028532 7:55537210-55537232 ATGTGTGTTCAGCTGAAGGAAGG - Intronic
1026014939 7:66665466-66665488 CAGTGTGTCCTGCTGGGGGATGG + Intronic
1029330469 7:99849479-99849501 CTGTGTGTATAGCAGAAGGAAGG + Intronic
1029714737 7:102319806-102319828 CTGTGGGAACAGCTGGAACAGGG - Intronic
1031305834 7:120125826-120125848 CTGTGTCTTCATATGGAGGAAGG - Intergenic
1031968831 7:128048915-128048937 CCGTGTGAACAGCTGGAAGAAGG - Intronic
1032326165 7:130930418-130930440 CTGTCAGTGCTGCTGGAGGAAGG - Intergenic
1032457905 7:132087547-132087569 CTGTGTGTGCTGCTGGAGGTGGG - Intergenic
1032696861 7:134344643-134344665 CTGTGTTTTCAGCTAGAGGAAGG + Intergenic
1033038051 7:137893470-137893492 CTTTGTGTGCAGCTGGGGGTGGG + Intronic
1034275514 7:149822150-149822172 CTGGGTGTCCAGGTGGAGGAAGG - Intergenic
1034702839 7:153111274-153111296 CTGTGTGTTCTGCTGGTGGCTGG + Intergenic
1034954707 7:155327375-155327397 CTTTCTGTCCAGGTGGAGGAGGG - Intergenic
1035091789 7:156319050-156319072 CCGTGTGTTTAGCTGGATGACGG - Intergenic
1035966924 8:4202900-4202922 CTGTGTGGACACCTGGAGTGAGG + Intronic
1036561751 8:9904678-9904700 CAGTGTGGAGAGGTGGAGGAGGG - Intergenic
1037688302 8:21162392-21162414 CCCAGTGTACAGCTGCAGGAAGG + Intergenic
1037701023 8:21273899-21273921 ATGGGTTTTCAGCTGGAGGAGGG + Intergenic
1038441410 8:27573184-27573206 CTGTGAGAACAGCTGGAGTGGGG + Intergenic
1040984555 8:53279634-53279656 CTGTGTCTTCAGGTGGGGGAAGG - Intergenic
1041053974 8:53963697-53963719 TTGTTTATCCAGCTGGAGGATGG - Intergenic
1043501851 8:80866358-80866380 CTGTGTGTACAGCAGGAACCTGG + Intronic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1045519026 8:102887098-102887120 CTGTGGCAGCAGCTGGAGGAAGG - Intronic
1046932491 8:119855620-119855642 CTGTGCCAGCAGCTGGAGGATGG - Exonic
1047206267 8:122804966-122804988 CTGAGTCTACAGCTGGGGGATGG - Intronic
1047478539 8:125258576-125258598 TTCTGTGTGCAACTGGAGGATGG + Intronic
1048173715 8:132132642-132132664 GTGTGTGTGCAGGTGGAGAAGGG + Intronic
1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG + Intronic
1049073123 8:140372472-140372494 GTGTGTGGACAGGTGAAGGAAGG - Intronic
1049603264 8:143517851-143517873 CTGTGTGTGCAGGTGGGGCAGGG - Intronic
1049902781 9:186000-186022 CTGTGTGTTCACCTGGCAGAAGG + Intergenic
1049939621 9:532899-532921 TTGTGTACACAGCTGCAGGAGGG + Intronic
1050586602 9:7118870-7118892 CTGTGTTTACATCTGGAAGGAGG - Intergenic
1051277279 9:15408939-15408961 CTGTGTCTTCACCTGGTGGAAGG + Intergenic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1053366931 9:37529429-37529451 ATGTGTGTACTGGTGCAGGAAGG - Intronic
1053506266 9:38646000-38646022 CTGTGTTGAGAACTGGAGGAAGG - Intergenic
1054481467 9:65668932-65668954 CTGTGTGTTCACCTGGCAGAAGG - Intronic
1054682539 9:68234989-68235011 CTGTGTGTTCACCTGGCAGAAGG - Intronic
1055641043 9:78319345-78319367 CTGGGCTTGCAGCTGGAGGAGGG - Intronic
1055694425 9:78868390-78868412 CTTTGAGCACACCTGGAGGATGG - Intergenic
1056071695 9:82993805-82993827 CAGTGGGTCCAGCTGGTGGAGGG - Intronic
1056237490 9:84609652-84609674 CTATGTATGCAGCTGGTGGATGG + Intergenic
1056331484 9:85524635-85524657 CTGTGGGAACACCTGTAGGAAGG + Intergenic
1056735176 9:89203312-89203334 CTGTGTCTTCACATGGAGGAAGG + Intergenic
1058743637 9:107968446-107968468 CTGTGTGTCCAGTTGGAGGGAGG + Intergenic
1059322659 9:113481547-113481569 CTGTTTGCACAGCTGGAGTCAGG - Intronic
1060850916 9:126874688-126874710 GTGTGTGCACAGCTGGAACAAGG - Intronic
1060957194 9:127650612-127650634 CTGTTTTTAGAGCTTGAGGAGGG + Intronic
1061431739 9:130535651-130535673 CTGAGTGAGCAGCTGGAGGCGGG + Intergenic
1061660858 9:132129471-132129493 CTGTGGCTAGAGCTGGAGGGAGG + Intergenic
1062033750 9:134373607-134373629 CTCTGTGGATAGCTGGGGGATGG - Intronic
1062080699 9:134621910-134621932 CTGTGTGTTCAGCTGGATTCAGG + Intergenic
1062087194 9:134654941-134654963 GGGTGTGTAGAGCTGGGGGAGGG + Intronic
1062330998 9:136044900-136044922 CTGGGTGTTCAGCCGGGGGATGG + Intronic
1202781936 9_KI270718v1_random:7063-7085 CTGTGTGTTCACCTGGCAGAAGG + Intergenic
1186117392 X:6319258-6319280 CTGTGTCTACACATGGTGGAAGG + Intergenic
1186307931 X:8284489-8284511 AAATGTGTACAGCTGAAGGAGGG - Intergenic
1186387188 X:9121759-9121781 CTGTGTCTTCACATGGAGGAAGG - Intronic
1186524741 X:10238212-10238234 CTGGGGGTACAGCTGGGGAAAGG + Intergenic
1187474960 X:19602396-19602418 CTGTAAGTACAGCTGGAGAAGGG + Intronic
1187715827 X:22101626-22101648 CTCTCTATTCAGCTGGAGGATGG + Intronic
1188760835 X:34027377-34027399 CTGTGTCTACACATGGTGGATGG - Intergenic
1191693479 X:63964428-63964450 CTGTGTAAATAGCTGAAGGAAGG - Intergenic
1191821733 X:65317473-65317495 CAGTGTATACAGCTCGATGATGG - Intergenic
1192423481 X:71054420-71054442 GTGTGTGTAGAGATGGGGGAGGG - Intergenic
1192615739 X:72620277-72620299 CTGTGAATACAACTGAAGGAGGG + Intronic
1194492453 X:94568519-94568541 CTCTTTGTACTGCTGGGGGATGG + Intergenic
1194653864 X:96547881-96547903 GTGTGTGTGTAGCTGGGGGAAGG - Intergenic
1195596272 X:106693781-106693803 CTGTGTGTACAGCTGGAGGAGGG + Intronic
1195620522 X:106950055-106950077 ATCTGTGTTCAGCTTGAGGACGG + Intronic
1196025025 X:111033115-111033137 CTGTGTGTACAGAGAGAGGGAGG - Intronic
1198208486 X:134492763-134492785 GTGTGTGTACACCAGGAGGCAGG + Intronic
1198553085 X:137764708-137764730 CTGTGAGTACTTCTGGAGAATGG - Intergenic
1199001758 X:142647234-142647256 ATGTGTGTACAGCAGGGAGAAGG - Intergenic
1199600572 X:149539335-149539357 CTGTGGGTGGAGCTGGGGGAGGG - Intergenic
1200081154 X:153577082-153577104 CTGAGTGAACCGCTGCAGGATGG - Intronic