ID: 1195596480

View in Genome Browser
Species Human (GRCh38)
Location X:106696989-106697011
Sequence CTTGAGATTGAAGGTTTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 206}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195596477_1195596480 -10 Left 1195596477 X:106696976-106696998 CCATTCTAGTTTGCTTGAGATTG 0: 1
1: 0
2: 3
3: 29
4: 464
Right 1195596480 X:106696989-106697011 CTTGAGATTGAAGGTTTCTTGGG 0: 1
1: 0
2: 1
3: 15
4: 206
1195596476_1195596480 -6 Left 1195596476 X:106696972-106696994 CCAACCATTCTAGTTTGCTTGAG 0: 1
1: 1
2: 3
3: 27
4: 179
Right 1195596480 X:106696989-106697011 CTTGAGATTGAAGGTTTCTTGGG 0: 1
1: 0
2: 1
3: 15
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195596480 Original CRISPR CTTGAGATTGAAGGTTTCTT GGG Intronic
901067611 1:6501915-6501937 CTTGAGACAGAAGGGTTCATCGG - Intronic
903829517 1:26166053-26166075 CATGGGATTGAAGGTCTCCTCGG + Intergenic
905381293 1:37563169-37563191 CTTGACATTGCAGGCTTGTTTGG + Intronic
907126388 1:52054837-52054859 CTGGAGTTTGAAGATTTCTTGGG - Intronic
907429393 1:54403383-54403405 TTTATGATTGAAGGTTACTTAGG - Intronic
907534604 1:55138608-55138630 CTCGACAGTGAAGGTATCTTTGG + Exonic
909529771 1:76669404-76669426 CTTGAGATTCTATTTTTCTTAGG - Intergenic
910532481 1:88254238-88254260 CTTGAGATGAAAGATTTCATAGG - Intergenic
910950194 1:92638152-92638174 TTTGAGTTTGATGTTTTCTTGGG - Intronic
911861311 1:102952846-102952868 GTTGAGATTAAAGGATTCATAGG - Intronic
914076501 1:144357333-144357355 ATTGAGAATGAGGGGTTCTTTGG + Intergenic
914102677 1:144609164-144609186 ATTGAGAATGAGGGGTTCTTTGG - Intergenic
914170947 1:145222913-145222935 ATTGAGAATGAGGGGTTCTTTGG + Intergenic
914526063 1:148466881-148466903 ATTGAGAATGAGGGGTTCTTTGG + Intergenic
914640341 1:149600242-149600264 ATTGAGAATGAGGGGTTCTTTGG - Intergenic
917507484 1:175641234-175641256 CTTGAAATTAAATGTTTGTTTGG - Intronic
918038880 1:180900049-180900071 TTTGAGAGTGAAGCATTCTTTGG + Intergenic
918335143 1:183502720-183502742 CTTTAGAATGAAAGTTTCTGTGG + Intronic
923025981 1:230204488-230204510 CTTGAGAGTGGAGGGTACTTTGG + Intronic
924221531 1:241880863-241880885 TTTGAGGTTGAAGTCTTCTTAGG + Intronic
1063232854 10:4082947-4082969 GTTGAGAGTGCATGTTTCTTTGG - Intergenic
1064187228 10:13172875-13172897 ATTGAGAAAGAAAGTTTCTTGGG + Intronic
1064221872 10:13447995-13448017 CTTGAGAATGAACCTTTCTTTGG + Intronic
1064993311 10:21275353-21275375 CTAGTGATTGAAGGTTGCTCTGG - Intergenic
1067531098 10:47074124-47074146 CTTGACTGTAAAGGTTTCTTAGG + Intergenic
1068677186 10:59780179-59780201 CTTGAGTATGCAAGTTTCTTAGG - Intergenic
1071635586 10:87250266-87250288 GTTGAGACTGAAGGCTTCATTGG + Intergenic
1075481287 10:122784151-122784173 CTTTAGCTTAAATGTTTCTTGGG - Intergenic
1079504759 11:21141356-21141378 CTAGAGCTGGAAGATTTCTTTGG + Intronic
1079752000 11:24211895-24211917 ACTGAGATTGGAGGTTTGTTAGG + Intergenic
1082752429 11:57033737-57033759 CTTGAGATTCGAGGTTTCGGTGG - Intergenic
1083580622 11:63822871-63822893 CCTGAGATTCTAGGTTTCTTTGG + Intronic
1085849195 11:80099890-80099912 CAGGAGCTTGAAGGTCTCTTGGG + Intergenic
1087225047 11:95590005-95590027 CTTGAGATAGAGCTTTTCTTAGG + Intergenic
1087326922 11:96735877-96735899 CTTGATCCTGAATGTTTCTTGGG - Intergenic
1087868716 11:103265747-103265769 TTTGAGCTTTCAGGTTTCTTGGG + Intronic
1092305592 12:7297509-7297531 GTTGATATCTAAGGTTTCTTTGG - Intergenic
1093514939 12:19974546-19974568 CCTGATTTTGAAGGTTTCCTAGG - Intergenic
1094450890 12:30582224-30582246 CTTGAGATGGAAGTTGTCCTAGG + Intergenic
1094473462 12:30823824-30823846 AGGGAGAATGAAGGTTTCTTGGG - Intergenic
1095980285 12:47969145-47969167 TTTGAGGTTGTAAGTTTCTTGGG + Intergenic
1096549292 12:52361546-52361568 CTTGAGACTGATGGTTGCTTGGG + Intronic
1097990032 12:65824687-65824709 ATTGAGATTGAAAGTGCCTTGGG - Exonic
1099355504 12:81629931-81629953 CTTGAGATTGAAAGATTATCTGG + Intronic
1099641442 12:85291375-85291397 ATTTAGATTTATGGTTTCTTGGG - Intronic
1100344071 12:93710179-93710201 CATGAGAGTAAAGCTTTCTTGGG - Intronic
1100711245 12:97259275-97259297 CTTGACATTGGAGGTTCATTAGG + Intergenic
1101555844 12:105808454-105808476 CCTGAGACTGAAGGTTCCCTAGG - Intergenic
1101766891 12:107709550-107709572 CCTGAGGTTCAAGATTTCTTGGG - Intronic
1103160669 12:118726556-118726578 TGTGAGATTTAAGGATTCTTTGG - Intergenic
1103266252 12:119633020-119633042 CTTGTGATTGAAGCTTTGTTAGG + Intronic
1103857317 12:123981711-123981733 CTTGAGTTTGAAGGTCTTATAGG + Intronic
1105061670 12:133157982-133158004 CTTGAGAAAGAGGGTATCTTTGG - Exonic
1107762169 13:43691569-43691591 CTTGAGTGTGAAAGTCTCTTAGG - Intronic
1110048277 13:70859578-70859600 ATTGAGATTTAAGTTTCCTTTGG - Intergenic
1111182769 13:84690254-84690276 GTTGAGATGGAAGGTTTTTTCGG + Intergenic
1111661407 13:91217011-91217033 CTTGAGATTTTAAGTTTCCTTGG - Intergenic
1112214614 13:97417422-97417444 CTTGCAACTGAAGATTTCTTTGG + Intergenic
1112596965 13:100816166-100816188 CTTGAGATCGAACCTGTCTTTGG + Intergenic
1113633552 13:111904615-111904637 CCTGCGTTTGAAGGTTTCTGCGG + Intergenic
1119965369 14:78909457-78909479 CTTGCTATTGAAGCTTTCTTGGG - Intronic
1119995127 14:79245182-79245204 CTAGAGATTGAAAGATGCTTAGG - Intronic
1120471348 14:84928852-84928874 CTTGAGATGGATGATTTCTGTGG - Intergenic
1126714819 15:51503728-51503750 CTTGAAATTTATTGTTTCTTCGG - Intronic
1130236353 15:82138149-82138171 ATGGAGATTCAAGGTTTCTGTGG - Intronic
1131662469 15:94532590-94532612 CATGATATTGATTGTTTCTTTGG + Intergenic
1131868062 15:96732883-96732905 ATTGAGGTAGTAGGTTTCTTAGG - Intergenic
1132931499 16:2461194-2461216 CTTGAGTGTGAAGGCTTCTGGGG - Exonic
1133000538 16:2849238-2849260 CATGAGATGGGTGGTTTCTTAGG - Intergenic
1134467650 16:14493582-14493604 CTTCAGATTGCAGGCTTCTTAGG - Intronic
1138888409 16:61109850-61109872 ATTGATATTTATGGTTTCTTTGG + Intergenic
1142898636 17:2998481-2998503 CATGAGTTTGCAGGTTTCTGGGG + Intronic
1143481711 17:7230953-7230975 ATTGAGTTTGGAGATTTCTTAGG - Intronic
1143977317 17:10839347-10839369 CTTGACTTTGAAGGTTTTTGAGG + Intergenic
1144289742 17:13814956-13814978 CCTGAGAGTGATAGTTTCTTAGG + Intergenic
1145920920 17:28609298-28609320 CTTAAGATTTAAGGTTATTTGGG - Intronic
1147513940 17:41098133-41098155 CTTGAGTTTGGAAGTTTCCTGGG + Exonic
1149080660 17:52652772-52652794 CTTGAAATTGAAGACATCTTTGG - Intergenic
1150156800 17:62860754-62860776 CCTGGGACTGAAGGTTTCCTGGG - Intergenic
1150780449 17:68117082-68117104 CTAGAGTTTGAATGTTTATTGGG + Intergenic
1153604794 18:6821682-6821704 ATTGTGATTAAAGGATTCTTTGG + Intronic
1154409647 18:14131130-14131152 CTTGGGATTGAGGTTTTCGTTGG - Intronic
1156547713 18:37981829-37981851 CTTGAGGTTCAAGGTTTATAAGG + Intergenic
1156579135 18:38355157-38355179 TTTGAGGTTGTAGGTTTGTTAGG + Intergenic
1160237761 18:77099452-77099474 CATGACATTTGAGGTTTCTTAGG + Intronic
1161429384 19:4222683-4222705 CTTAAGATTGAAGACTTCTTTGG - Exonic
1162386278 19:10362165-10362187 GATGAGATTGGAGGTTTCTGGGG + Exonic
1165425971 19:35745598-35745620 CTGGAGATTGTAGTCTTCTTTGG - Exonic
1166627400 19:44371596-44371618 ATTGGGTTTGATGGTTTCTTGGG - Intronic
926607559 2:14912951-14912973 CTTAAAATAGAAAGTTTCTTCGG + Intergenic
926833149 2:16987335-16987357 CTTGAGAATGGAGATTTATTAGG + Intergenic
927143645 2:20146198-20146220 ATTTAAATTGAAGGTTTATTTGG + Intergenic
928629684 2:33178138-33178160 CTTGAGATTGAGGCCTCCTTCGG - Intronic
930890696 2:56383125-56383147 ATTGAGATTAACAGTTTCTTTGG + Intronic
932113566 2:69023983-69024005 TATGAGATTAAAGGTTTCTAAGG + Intronic
935890607 2:107673906-107673928 CATGAGATTTTATGTTTCTTGGG + Intergenic
936647618 2:114389441-114389463 CTTGAGATGGGAGAGTTCTTTGG - Intergenic
937024838 2:118689367-118689389 CTTGAGAATCAGAGTTTCTTGGG - Intergenic
938546102 2:132332965-132332987 ATTGGGTTTGATGGTTTCTTGGG + Intergenic
940478403 2:154195465-154195487 TGTGAGATTTATGGTTTCTTAGG - Intronic
943146199 2:184048756-184048778 CTTGAGATTGCACTTTTCTAGGG + Intergenic
943254157 2:185572011-185572033 CATGAGATTGAAAGTTCCTAAGG - Intergenic
943696706 2:190943394-190943416 CTTTAAAATGATGGTTTCTTAGG - Intronic
947281662 2:228461918-228461940 TTTGATATTGAAGATTTATTTGG - Intergenic
947541634 2:230983957-230983979 CTTGAGATGAAATGATTCTTGGG - Intergenic
947988651 2:234469735-234469757 TTTGAGCTGGAAGGTTCCTTGGG + Intergenic
1168820402 20:769044-769066 CTTGAGACTGAAGCTTTTTGAGG + Intergenic
1169028521 20:2390009-2390031 CTTGGGATTGGAGGCTTCTCTGG - Intronic
1170422730 20:16208622-16208644 CCTTTGATTGAAGGTTGCTTGGG + Intergenic
1171786903 20:29475197-29475219 CTTGAAATTAAAGGTTTATAAGG - Intergenic
1171861749 20:30406778-30406800 CTTGAAATTAAAGGTTTATAAGG + Intergenic
1171874965 20:30565698-30565720 ATTGGGTTTGATGGTTTCTTGGG + Intergenic
1175775747 20:61652719-61652741 CTTGAAATTGAATTTTTCCTGGG + Intronic
1176863579 21:14028722-14028744 CTTGGGATTGAGGTTTTCCTTGG + Intergenic
1177743651 21:25184471-25184493 AATGAGCTTGAAGGTTTCTTTGG - Intergenic
1178251834 21:31010513-31010535 ATTTAGAATGAAGGTTTCTTTGG + Intergenic
1178608132 21:34056890-34056912 CTTGAAACTGATGGCTTCTTGGG - Intergenic
1180295863 22:10934459-10934481 CTTGAAATTAAAGGTTTATAAGG - Intergenic
1180412808 22:12631563-12631585 CTTGAAATTAAAGGTTTATAAGG + Intergenic
1182717892 22:32374274-32374296 CTTGAGATTAAAGGTAGATTTGG - Intronic
1184297141 22:43532088-43532110 ATTGAGATTGAAGGCTTTTCAGG - Intronic
949532694 3:4972370-4972392 CCTGAGCCTGAAGTTTTCTTTGG - Intergenic
950320890 3:12051843-12051865 CTTCATATGGAAGGTTTCTCAGG + Intronic
951065752 3:18263320-18263342 TTTGAGATTGAAGAGTTTTTTGG + Intronic
952024672 3:29064962-29064984 CTTGAGTTTGAAGGCTGCTGTGG + Intergenic
954541401 3:51395180-51395202 CTTGATAATGACGGTTTCCTAGG + Exonic
956248158 3:67207334-67207356 GTTGAAATTGAAGGATGCTTAGG - Intergenic
956358257 3:68417815-68417837 CCTGTGATTGAAAGTTTCCTGGG - Intronic
959130448 3:102349168-102349190 CCTGAGTTTGCAGCTTTCTTAGG + Intronic
960695583 3:120393293-120393315 AATGAGGTTTAAGGTTTCTTCGG - Exonic
961697398 3:128715027-128715049 CCTGAGAGTGAAGCTGTCTTTGG - Intergenic
961965499 3:130897592-130897614 CATCAGCATGAAGGTTTCTTAGG + Intronic
963352705 3:144171546-144171568 CTTGAGAGAAAAAGTTTCTTTGG - Intergenic
964036189 3:152200127-152200149 CTTGAATTTCAAGATTTCTTAGG + Intergenic
965381544 3:167995599-167995621 CTTGGGATTAAAGGTTTTTAAGG - Intergenic
968238222 3:197051063-197051085 CTTGAAATTTAATGTTTCTTAGG - Intronic
970420515 4:15901668-15901690 CTTGATATGGAAATTTTCTTTGG + Intergenic
970889430 4:21026343-21026365 CTTGAGATTAAAGGGTCCATGGG + Intronic
971011279 4:22438575-22438597 CTTGAGATTGAAGGATTTAAAGG - Intronic
971765543 4:30826077-30826099 CTTAAGAGTGAAGCCTTCTTTGG - Intronic
971793341 4:31196921-31196943 CTTGAGATTGGTAGATTCTTTGG + Intergenic
972414751 4:38827544-38827566 CATGAAACTGGAGGTTTCTTTGG + Exonic
972993419 4:44850607-44850629 CTTGGGATTGAGGGTTTTCTAGG + Intergenic
975829832 4:78357511-78357533 CTTCAGTTTGAAGGTTTTTTAGG + Intronic
975876347 4:78841844-78841866 TTTGAGATTGAAGGATAATTAGG - Intronic
976369258 4:84268114-84268136 GGTGAGATTGAAGTTTTCTCTGG - Intergenic
976931670 4:90573617-90573639 CTTGTGAATGTAGTTTTCTTGGG + Intronic
980135863 4:128857888-128857910 CCTGAGATTGCAGGTTTCCATGG + Intronic
982589859 4:157294391-157294413 CAAGAGATTGCAGGTTTTTTAGG + Intronic
984693840 4:182758974-182758996 CTTGAGATTAAAGCTTTTGTAGG + Intronic
985439932 4:189974657-189974679 CTTGAAATTAAAGGTTTATAAGG + Intergenic
987226675 5:15848985-15849007 GCTGAGATGGAATGTTTCTTTGG + Intronic
988102053 5:26692508-26692530 CTTTAGATTGAATGTATCCTTGG + Intergenic
989981276 5:50648708-50648730 ATTGAGAATGAGGGGTTCTTTGG - Intergenic
991277086 5:64861861-64861883 CATGATATTGAACATTTCTTTGG - Intronic
993391817 5:87327523-87327545 CCATAGATTGGAGGTTTCTTGGG + Intronic
994311768 5:98280958-98280980 CTTGAGATTTTAGGATCCTTAGG + Intergenic
995048305 5:107673094-107673116 CTTGGGATTTAAAGATTCTTGGG + Intergenic
995516640 5:112960809-112960831 CTTGAGAGTGCACTTTTCTTTGG - Intergenic
995950238 5:117703532-117703554 GTTGAGATTGAGAGTTACTTTGG - Intergenic
996980189 5:129482298-129482320 TTTGAGATGGAAAGTTTGTTGGG - Intronic
997052987 5:130404747-130404769 CTTGAGTTTATATGTTTCTTTGG - Intergenic
1000659076 5:163916636-163916658 CTTGAGGTTAATGGCTTCTTGGG - Intergenic
1001802715 5:174558156-174558178 CTTGATATTGAGGGTTTCACAGG - Intergenic
1003628855 6:7768370-7768392 CTTAGGATTCAAGGTTTCTCTGG + Intronic
1004592399 6:17066127-17066149 CTTGAGATTGCAGGAATCATAGG + Intergenic
1004963930 6:20825357-20825379 GTTGAGACTGCAGGGTTCTTAGG + Intronic
1005144675 6:22675186-22675208 CATGAGAGTGCAGGTATCTTTGG - Intergenic
1005222144 6:23598881-23598903 CTTGACATGGATGGCTTCTTGGG + Intergenic
1009778129 6:68232894-68232916 CTTGAGAGTTAAAGTCTCTTAGG - Intergenic
1009785629 6:68334706-68334728 ATTGAGATTGAGGGATTCTGTGG - Intergenic
1011100615 6:83716643-83716665 CTTGAGTTAGAAGTTTCCTTGGG - Intergenic
1011872091 6:91908123-91908145 TTACAGATTGAAGGTTTTTTTGG - Intergenic
1012582216 6:100882569-100882591 CTTGAGATTACATGTGTCTTTGG + Intergenic
1013436549 6:110115767-110115789 CTTGAGCTTGATGGTTTTCTTGG - Intronic
1013644805 6:112126148-112126170 CTTGAGATTGAATGTTTGTTGGG + Intronic
1016740330 6:147521044-147521066 CTTGAGATTGAATATGTATTAGG - Intronic
1018639692 6:165895172-165895194 CTTGAGAATGCAAGTTTATTTGG + Intronic
1020288361 7:6703772-6703794 CCTGAAATTGATGATTTCTTTGG - Intronic
1020692712 7:11376889-11376911 CTTCAGATTTCAAGTTTCTTTGG + Intronic
1020916605 7:14201480-14201502 CATGAGAGTGAAAGTTGCTTAGG + Intronic
1021911883 7:25393831-25393853 CTTGTTATTGAAGGTATCTCTGG + Intergenic
1022629129 7:32069207-32069229 CTTGATATTCAAAGTTTCTAAGG - Intronic
1024733378 7:52276747-52276769 CTGGAGATGCAACGTTTCTTGGG - Intergenic
1025930374 7:65988934-65988956 CTTGATATTCAAAATTTCTTGGG - Intergenic
1026391027 7:69901893-69901915 CTTGGACTTGAATGTTTCTTAGG + Intronic
1028737281 7:94230999-94231021 CGTTACATTGAAGGATTCTTTGG - Intergenic
1028838281 7:95397965-95397987 CTTGAGATTGTAGGCTCCTGTGG + Intergenic
1029891549 7:103935266-103935288 TTTGAGATGGAAGCTTACTTTGG - Intronic
1030023984 7:105304048-105304070 TTTGAGATGGATGTTTTCTTGGG - Intronic
1031318703 7:120292490-120292512 CTTGAAATTAAAAGTTTCCTTGG + Intronic
1035864940 8:3071581-3071603 CTTGAGGTTGAAAATTACTTTGG - Intronic
1036761356 8:11511128-11511150 CTTGAATTTCAAGGTTTCTTTGG - Intronic
1037275751 8:17176506-17176528 CTTTATCTTGAAGGTTTCTCTGG - Intronic
1037395475 8:18437331-18437353 TTTCAGTTTGAAAGTTTCTTTGG + Intergenic
1037801980 8:22040844-22040866 TGTGAGGTTGAAGGTTTCTCAGG + Intergenic
1038091969 8:24264226-24264248 ATTGAGATTGAAGCATTATTAGG - Intergenic
1038263178 8:26015803-26015825 CTTGAGAATGTAGGCTTCATTGG - Intronic
1038603469 8:28973263-28973285 CTTAATATTGAAGTTCTCTTGGG - Intronic
1038908783 8:31937993-31938015 GTTGAGTATTAAGGTTTCTTAGG - Intronic
1040933313 8:52757324-52757346 CTTGAGTTTGTAGATTGCTTTGG - Intergenic
1041619850 8:59954057-59954079 CTTGTACTTGAAGGTTTCATGGG + Intergenic
1041994410 8:64036215-64036237 CCTAGGATTCAAGGTTTCTTTGG - Intergenic
1044502695 8:92977836-92977858 TTTGAGATTTAAGTTTTGTTAGG + Intronic
1048114723 8:131508846-131508868 ATTGAGTTTGAATGTTTCTCTGG - Intergenic
1049970981 9:821661-821683 CTATAGATTGATGGTTTCGTAGG - Intergenic
1050567898 9:6905762-6905784 ATTGAGATGGAAGGTGTCTGGGG + Intronic
1050873622 9:10608409-10608431 ATTGAGATTGAATGTTTATTTGG - Intronic
1058426277 9:104877519-104877541 CTTGAAATTGGAACTTTCTTTGG - Intronic
1061033007 9:128098206-128098228 CTAGAGGGTGAAGGTTTGTTTGG + Intronic
1202802718 9_KI270720v1_random:15465-15487 CTTGAAATTAAAGGTTTATAAGG - Intergenic
1203447501 Un_GL000219v1:72673-72695 CTTGAAATTAAAGGTTTATAAGG - Intergenic
1188373522 X:29398912-29398934 CTTCAGATTGAAGTATTCATTGG + Intronic
1189862777 X:45290604-45290626 CTTGAGATGGAAAGTGCCTTGGG + Intergenic
1191777125 X:64826797-64826819 CTTGAAATAGATGGTTTCTATGG - Intergenic
1191897887 X:66012980-66013002 CATCAGATTGAAGGATTCTCAGG - Intergenic
1193702187 X:84777157-84777179 CTTGAACTTCATGGTTTCTTGGG - Intergenic
1194077344 X:89413253-89413275 CTTTAGCCTGAATGTTTCTTAGG + Intergenic
1194345553 X:92759710-92759732 CTTCAGTTTGCAGGTTTCTGTGG - Intergenic
1195596480 X:106696989-106697011 CTTGAGATTGAAGGTTTCTTGGG + Intronic
1200429992 Y:3068792-3068814 CTTTAGCCTGAATGTTTCTTAGG + Intergenic
1200653896 Y:5876361-5876383 CTTCAGTTTGCAGGTTTCTGTGG - Intergenic
1201968016 Y:19759711-19759733 CTTCAGATTGAAGAGTTTTTGGG + Intergenic