ID: 1195597893

View in Genome Browser
Species Human (GRCh38)
Location X:106713612-106713634
Sequence CAGTAGCCACAGATGGCTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 919
Summary {0: 1, 1: 0, 2: 30, 3: 185, 4: 703}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195597893 Original CRISPR CAGTAGCCACAGATGGCTCG TGG (reversed) Intronic
901517543 1:9759041-9759063 CAGCAGCCACATGTGGCTGGTGG + Intronic
901715871 1:11153696-11153718 CAGTAGCCACATGTGGCCAGTGG - Intronic
901890738 1:12261572-12261594 CAGTAGCCACATGTGGTTAGTGG + Intronic
901900708 1:12359416-12359438 CAGCAGCCACATGTGGCTAGTGG - Intronic
902114561 1:14110684-14110706 TTGTAGCCACAGATGGTTTGTGG - Intergenic
902311028 1:15581872-15581894 AAGTAGCCACATGTGGCTAGTGG + Intronic
902849499 1:19142600-19142622 CAGTAGTCACATGTGGCTGGTGG - Intronic
903321435 1:22545762-22545784 CAGTGGCCACATGTGGCTGGTGG + Intergenic
903468803 1:23570553-23570575 CTGTAGCCACACATAGCTAGTGG + Intergenic
904390919 1:30185303-30185325 CAGATGCCACAGATGGCACAAGG - Intergenic
904942504 1:34174938-34174960 CAGTAGCCACATATGGCTAGTGG - Intronic
905024701 1:34841704-34841726 CACTAGCCACACGTGGCTAGTGG - Intronic
905756126 1:40510711-40510733 CAGTAGCTACATCTGGCTGGTGG - Intronic
905756131 1:40510795-40510817 AAGTAGCCACATATGGCTAGTGG + Intronic
905806226 1:40879703-40879725 CAGTAGCCACATGTGGCTCATGG + Intergenic
905930610 1:41784195-41784217 CAATAGCCACAAGTGGCTAGTGG - Intronic
905949556 1:41937484-41937506 CAATAGCTACATATGGCTAGTGG - Intronic
906040179 1:42783010-42783032 CAGTAGCCACATGTGGCTGCTGG + Intronic
906714326 1:47955729-47955751 CATTAGCCTCAGATGTCTCCAGG + Intronic
907171640 1:52471586-52471608 CAGTAGCTACATGTGGCTAGTGG - Intronic
907238313 1:53066515-53066537 CAGTAGCCACATGTGGCCAGTGG + Intronic
907872811 1:58458207-58458229 CAATAGCCACATGTGGCTAGTGG + Intronic
908018513 1:59874185-59874207 CAATAGCCACATGTGGCTAGTGG + Exonic
908348533 1:63260915-63260937 CAGTAGCCACATGTGACTAGTGG - Intergenic
908613217 1:65885951-65885973 CACTAGTCACATATGGCTAGTGG - Intronic
909650451 1:77970403-77970425 CAATAACCACATATGGCTAGTGG - Intronic
909849865 1:80447203-80447225 TAATAGCCACACATGGCTTGTGG + Intergenic
910544347 1:88397223-88397245 CAATAGCCACATGTGGCTAGTGG - Intergenic
910874658 1:91867295-91867317 CAGTACGCACAGATGGTACGAGG + Intronic
911089600 1:94007862-94007884 TAGTAGCCACATATGGCTCGTGG - Intronic
911110732 1:94181800-94181822 CAGTAGCCACATGTGGCTTGTGG - Intronic
911146893 1:94561153-94561175 CAGTAGCCACAGGTAGCTAGTGG + Intergenic
911202496 1:95059829-95059851 ACGTAGCCACATATGGCTAGTGG + Intronic
911552162 1:99296191-99296213 AAGTGGCCACAGGTGGCTAGTGG - Intronic
911970993 1:104437608-104437630 CAGTAGCCACATGTGGCTAGTGG - Intergenic
912314918 1:108659421-108659443 CAGTAGCTACACATGGCAAGTGG - Intronic
912528885 1:110305892-110305914 CAGTCGCCACATGTGGCTAGTGG + Intergenic
912557084 1:110524239-110524261 CATTAGCCACAGATGTCTGCAGG - Intergenic
913549202 1:119900457-119900479 CAATAGCCAGAGGTGGCTAGTGG - Intergenic
914749308 1:150522669-150522691 CAGTAGTCACAAGTGGCTGGTGG - Intergenic
914902717 1:151720202-151720224 CAAGAGCCACAGGTGGCTTGTGG + Intronic
914982869 1:152430718-152430740 CAGCAGCCACAGTGGGCTCTGGG + Intergenic
917331471 1:173884881-173884903 CAATAGCAACAGGTGGCTAGTGG + Intronic
917452221 1:175156614-175156636 CAGTAGCTACACGTGGCTAGCGG - Intergenic
917826393 1:178825777-178825799 CAGTAGTCACATGTGGCTAGTGG + Intronic
918115566 1:181493747-181493769 AAATAGCCACATATGGCTAGTGG + Intronic
918425178 1:184402180-184402202 CAGTAGCCACATATGGTTAATGG + Intronic
918433354 1:184485171-184485193 CAATAGCCACATGTGGCTCATGG - Intronic
919675308 1:200376384-200376406 CAGTAGCCACATGTAGCTAGTGG - Intergenic
919864245 1:201767655-201767677 CATTAGCTACATATGGCTAGTGG + Intronic
920608738 1:207416221-207416243 CAGTAGGCACATATGGCTAGTGG + Intergenic
920968177 1:210719165-210719187 CATTAGCCATATATGGCTGGGGG + Intronic
921065278 1:211618205-211618227 CAATAGCCACAGGTAGCTAGTGG - Intergenic
921136718 1:212267385-212267407 CAGTAGCCACATTTGTCTAGTGG + Intergenic
921704537 1:218306929-218306951 CACTAGCCACATGTGGCTTGTGG + Intronic
921719707 1:218457059-218457081 CAGTAGCCACATGTGGCTAGTGG + Intergenic
922755258 1:228093058-228093080 AAGTAGCCACTGGTGGCTCCTGG + Intronic
922954166 1:229585317-229585339 CAGTAGCTACACATGGCTAGTGG + Intergenic
923140727 1:231160362-231160384 CAGTAGCCACAGATGGGAGATGG - Intergenic
923162262 1:231324863-231324885 CACTAGCCACAGGTGGCTACTGG + Intergenic
923940931 1:238825736-238825758 CAATAGCCACATGTGGCTCATGG - Intergenic
924103900 1:240631589-240631611 CACTAGCCACAGGTGGCTCTAGG + Intergenic
924219928 1:241863757-241863779 AAATAGCCACACATGGCTAGTGG - Intronic
924309115 1:242721567-242721589 CAGTAGCCACATTTGGCTAGTGG + Intergenic
924434154 1:244023699-244023721 CAGTAGCCAAACGTGGCTCATGG - Intergenic
924590608 1:245400562-245400584 CAGTAGCCCCATGTGGCTGGTGG - Intronic
924717273 1:246588511-246588533 CAGTAGCCAAATATGGCTCATGG - Intronic
1063098868 10:2932412-2932434 CACTAGCCAAAGATGTCACGTGG + Intergenic
1063104003 10:2976686-2976708 CAGTGGCCACATGTGGCTAGAGG + Intergenic
1063433680 10:6013390-6013412 AAGTATCCACAGGTGGCTAGTGG + Intronic
1063541668 10:6940298-6940320 CAGTAGCCCCATGTGGCTAGTGG - Intergenic
1064055683 10:12095201-12095223 CAATAGCCACTGATGGCTAGTGG - Intronic
1064382170 10:14854810-14854832 AAGCAGCCACAGGTGGCTAGTGG - Intronic
1064787290 10:18912129-18912151 CACTATCCACATATGGCTGGTGG + Intergenic
1064867307 10:19895641-19895663 CAGTAGTCACACGTGGCTAGTGG + Intronic
1065089595 10:22218655-22218677 CAGTAGCCTCAGCTGGCTCCAGG - Intergenic
1065136666 10:22677509-22677531 CAGCAGCCACACGTGGCTCGTGG + Intronic
1065348646 10:24774454-24774476 CAGTAGCCACATGTGGCTAGTGG - Intergenic
1066350536 10:34632897-34632919 CAGTGGCCACAGGTGGCTCGGGG + Intronic
1066611502 10:37253272-37253294 CAATAGCCACATGTGGCTAGTGG - Intronic
1067122454 10:43485668-43485690 CAATATCCACATATGGCTAGTGG - Intergenic
1067686524 10:48469183-48469205 CAGGAGCCCCACATGGCTAGAGG + Intronic
1068734361 10:60394975-60394997 CAGTAGCCACATATGGCTAGTGG - Intronic
1068955119 10:62814727-62814749 CTAGAGCCACAGATGGCTGGGGG - Intronic
1069436653 10:68390496-68390518 TAGTAGCCACATGTGGCTCATGG - Intronic
1069517808 10:69093160-69093182 CAGTAGCCACAAGTGACTTGTGG - Intronic
1070016409 10:72536870-72536892 CAGTAGCCAAATATGGCTACTGG + Intronic
1070263981 10:74884971-74884993 CAATAGCCACATGTGGCTGGTGG - Intronic
1070546810 10:77458884-77458906 CAATAACCACAGATGGCTGGTGG + Intronic
1070973516 10:80586700-80586722 CCGTTGCCACTGCTGGCTCGGGG - Intronic
1071028788 10:81146778-81146800 CAGTAGCCACATGTGGCTAGTGG - Intergenic
1071365065 10:84891125-84891147 GAGCAGCCACAGATGGCTCTGGG - Intergenic
1071588624 10:86849664-86849686 GAGTAGCCACATATGGTTAGTGG + Intronic
1071787033 10:88912620-88912642 CAGAAGCCACATGTGGCTAGTGG - Intronic
1072425512 10:95326802-95326824 CAGCAGCCACAGGTGGCTGTTGG + Intronic
1072482715 10:95825179-95825201 CAATAGCCATACATGGCTGGTGG + Intronic
1072539968 10:96390798-96390820 CAGTAGCCACATGTGGCTGGGGG - Intronic
1072844331 10:98812694-98812716 CAGTAGCCACATGTGGCTAGTGG + Intronic
1073058979 10:100722087-100722109 CAATAGCCACATGTGGCTGGTGG + Intergenic
1074312974 10:112338372-112338394 CAGTAGTCACAGGAGGCTAGTGG + Intergenic
1074567908 10:114597943-114597965 CAGTAGCCACATGTGGTTAGTGG - Intronic
1074589304 10:114797674-114797696 CAATAGCCACATGTGGCTAGTGG - Intergenic
1074644580 10:115432290-115432312 CAATAGCCACATATGGCTAGTGG + Intronic
1074736319 10:116437834-116437856 CAATAGCCACATGTGGCTAGTGG + Intronic
1075870448 10:125769332-125769354 CAATTGCCATTGATGGCTCGTGG + Intronic
1076083194 10:127602074-127602096 CAGTAGTCACAAGTGGCTAGTGG + Intergenic
1076215584 10:128690997-128691019 CACAGGCCACACATGGCTCGTGG + Intergenic
1076622637 10:131802328-131802350 CAGTACCCACTGATGGCTCGAGG + Intergenic
1076873364 10:133204288-133204310 CAGTAGCCACACGTGGCTGTTGG - Intronic
1077258867 11:1604783-1604805 CTGTAGCCCCAGATGGCTCCTGG - Intergenic
1078141752 11:8698265-8698287 CAGGAGGCACAGTTGGCTTGGGG + Intronic
1078389098 11:10920172-10920194 CAGTAGCTACATGTGGCTAGTGG + Intergenic
1078546522 11:12251208-12251230 CATTAGCCACAGATAGTTTGAGG + Intronic
1078935836 11:15949231-15949253 CAATAGCCACATGTGGCTAGAGG + Intergenic
1079309708 11:19354314-19354336 CCGTAGCCAGATATGGCTAGTGG - Intronic
1079401608 11:20110643-20110665 GAGAAGCCACAGGTGGCTTGGGG + Intronic
1080062604 11:27972967-27972989 CAGCAGGCACAGATGGCTAGTGG - Intergenic
1080349540 11:31367602-31367624 CAGTAGCCACATGTGACTAGTGG - Intronic
1080837973 11:35958143-35958165 CAGTAGCCCCAGGTGGCTAGTGG - Intronic
1080889292 11:36395453-36395475 CAATAGCCATATATGGCTAGTGG + Intronic
1080941628 11:36924874-36924896 CAGTAGTCACATATGGCTAGTGG + Intergenic
1081824362 11:46033670-46033692 CAATAGCCATATATGGCTAGTGG - Intronic
1081834319 11:46141801-46141823 CATTTGCCACACATGGCTGGTGG - Intergenic
1081956059 11:47094711-47094733 CACAAGCCACATATGGCTAGTGG + Intronic
1082276426 11:50226899-50226921 CAATAGCCACATGTGGCTGGTGG - Intergenic
1083182709 11:60997871-60997893 CAGTAGCCACACGTGGCTGGTGG + Intronic
1084964076 11:72734748-72734770 CAGTAGCCACACGTGGCTGTTGG + Intronic
1085648930 11:78249625-78249647 CAGTAGACACATATGTCTAGGGG - Intronic
1085743159 11:79094018-79094040 CAATAGCCACATGTGGCTAGTGG + Intronic
1087523402 11:99274071-99274093 CAGTAGCCACACGTAGCTAGTGG + Intronic
1088091152 11:106041431-106041453 CAATAGCCACATGTGGCTAGTGG - Intergenic
1088411004 11:109534614-109534636 CAGTAGCTACAGGTGGCTAGTGG - Intergenic
1088496049 11:110432029-110432051 CAGTAGCCACATGTGGCTAGTGG + Intronic
1088596754 11:111446869-111446891 CAGTAGCCATAGGTGGCTGGTGG - Intronic
1090004200 11:122985454-122985476 CAATAGCCACATAGGGCTAGTGG + Intergenic
1090110503 11:123902817-123902839 CAGTAGCCACCTATGGCTAGTGG - Intergenic
1090694387 11:129223208-129223230 CAATAACCACATATGGCTAGTGG + Intronic
1090830799 11:130419655-130419677 CAATAGTCATATATGGCTCGTGG + Intronic
1091411321 12:241483-241505 AAACAGCCACAGGTGGCTCGTGG - Intronic
1091512329 12:1140726-1140748 TAATAGCCACAAATGGCTGGTGG - Intronic
1091561293 12:1615890-1615912 CAGTAGCTACAAGTGGCTAGTGG - Intronic
1091640870 12:2236193-2236215 CAGGATCCCCAGATGGCTCTTGG - Intronic
1091747961 12:3004508-3004530 CAGTAGCCACAGATGGGCACTGG + Intronic
1091957143 12:4655355-4655377 CAGTAGCCACATGTGGCCAGTGG - Intronic
1092996732 12:13957993-13958015 CACTAGTCACAGGTGGCTAGTGG + Intronic
1093047621 12:14467862-14467884 CAGTAGCTACAAATGGCTAGTGG + Intronic
1093232833 12:16568495-16568517 CATTAGCCACATGTGGCTGGTGG - Intronic
1093384815 12:18539583-18539605 CAGTAGCCACGTTTGGCTAGTGG + Intronic
1093787633 12:23211129-23211151 CAGTGGCCACACATGACTAGTGG - Intergenic
1093961823 12:25282118-25282140 CAGTAGCCGCAAATGGCTAGTGG + Intergenic
1094082637 12:26554252-26554274 CAGTAGCCACATGTGGCTAATGG - Intronic
1094164073 12:27423892-27423914 CAGTAGCCACATGTGGCTAGTGG - Intronic
1094215195 12:27933050-27933072 CAGTAGCCACATGTGGCTCGTGG - Intergenic
1094284530 12:28778016-28778038 AAATAGCCACAGGTGGCTGGTGG - Intergenic
1094485577 12:30923994-30924016 CAGTAGCCACATGTGGCTAGTGG - Intergenic
1095192718 12:39276179-39276201 CAGCAGCCACACATGGCTAGAGG - Intergenic
1095550785 12:43436604-43436626 GATTAGCCACACATGGCTAGCGG + Intronic
1095995515 12:48080210-48080232 CATTAGCCACATGTGGCTAGTGG - Intronic
1096103783 12:48985178-48985200 CAGGAGCCACAGTAGGCTCAGGG + Intergenic
1096737683 12:53668634-53668656 CAGTAGCCAGATGTGGCTAGAGG - Intronic
1097621135 12:61940934-61940956 CAGTAGCCACATATAGCTAGTGG - Intronic
1097688688 12:62714159-62714181 CAGTAGCCACATGTGGCTAGTGG - Intronic
1098930667 12:76408635-76408657 CAGTAACCACATATGGCTAGTGG - Intronic
1098978148 12:76926246-76926268 CAGTAGCCACATGTGCCTGGTGG + Intergenic
1099982097 12:89616394-89616416 CAGTATTCACACATGGCTAGTGG + Intronic
1100019067 12:90047919-90047941 CTTTAGGCACAGATGGCTCCAGG - Intergenic
1100302243 12:93318524-93318546 CAGTAGCCACATGTGGCTAGTGG + Intergenic
1100354484 12:93816643-93816665 CAGTAGCCACACATGTCTAGTGG + Intronic
1100721215 12:97360747-97360769 CAGTAGCCACATGTGGGTAGTGG + Intergenic
1101269062 12:103123608-103123630 CAATAGCCACAGGTGGCTAATGG - Intergenic
1101315614 12:103626292-103626314 AAATAGCCACATGTGGCTCGTGG + Intronic
1101588084 12:106102402-106102424 CAGTAGCCACAGGAGGCTAGTGG - Intronic
1101590772 12:106123370-106123392 CAGTAGCCCCATGTGGCTAGTGG - Intronic
1101811012 12:108107714-108107736 CTGTAGCCACAACTGGCTCATGG - Intergenic
1101859627 12:108472426-108472448 CAGTAGCCCCATGTGGCTAGTGG - Intergenic
1101991913 12:109492959-109492981 CAGTAGCCACATATAGCCAGTGG + Intronic
1102133964 12:110557143-110557165 CAATAGCCACATGTGGCTAGTGG - Intronic
1102848246 12:116211238-116211260 CAGTAGCTACATATGGCTAGAGG - Intronic
1102984178 12:117265193-117265215 CAATAGCCACATGTGGCTGGTGG - Intronic
1103021551 12:117538663-117538685 CAGTAGCCACATGTGGCTGGTGG - Intronic
1103196774 12:119050799-119050821 AAATAGCCACAGATGGCTAGTGG - Intronic
1103349145 12:120271224-120271246 CAGTAGTCACATGTGGCTAGCGG + Intergenic
1103403184 12:120657104-120657126 CAATAGCCACATGTGGCTAGTGG - Intronic
1103875859 12:124126703-124126725 CAATGGTCACATATGGCTCGAGG - Intronic
1103890729 12:124237247-124237269 CAGTAGCCCCACAGGGCTGGTGG - Intronic
1103932098 12:124456320-124456342 CAGTGGGCACAGATGGCTGTGGG + Intronic
1104445291 12:128828207-128828229 CAATAGCCACACATAGCTAGTGG - Intergenic
1105265194 13:18809041-18809063 CTGCAGCCCCAGATGGCTCCTGG - Intergenic
1105775628 13:23657468-23657490 CAGTAGCCACATGTGGCTAATGG - Intronic
1106258905 13:28047016-28047038 CAATAGCCACATGTGGCTGGTGG + Intronic
1106526517 13:30545608-30545630 AAATAGCCACATATGGCTAGTGG - Intronic
1106986285 13:35355487-35355509 CGGTAGCCACATGTGGCTGGTGG + Intronic
1107092736 13:36499867-36499889 CAGTAGCTACATGTGGCTAGTGG - Intergenic
1107340515 13:39400360-39400382 CAATAGCCACATGTGGCTGGTGG + Intronic
1107798124 13:44075823-44075845 CAGTAGCCACATATGGCTAGTGG - Intergenic
1108317046 13:49247257-49247279 CAATAGCCACATGTGGCTGGTGG + Intergenic
1108996126 13:56736348-56736370 GAGTTGCCACTGGTGGCTCGGGG - Intergenic
1112255155 13:97823831-97823853 CAGTAGCCACATGTGGCTAGTGG - Intergenic
1112451451 13:99514771-99514793 CAATAGCCACATGTGGCTGGTGG + Intronic
1113185760 13:107684106-107684128 TGGGAGCCACAGATGGCTGGTGG - Intronic
1114064247 14:19047340-19047362 CAATAGCCACATGTGGCTAGTGG + Intergenic
1114098012 14:19352658-19352680 CAATAGCCACATGTGGCTAGTGG - Intergenic
1114585063 14:23803869-23803891 CAGTAGTCACATATGGCAAGTGG - Intergenic
1115008314 14:28512915-28512937 TAATAGCCACAGGTGGCTAGTGG + Intergenic
1115286596 14:31720769-31720791 CAGTAGTCACATGTGGCTAGTGG + Intronic
1115610880 14:35047408-35047430 CATTAGCCACATGTGGCTAGTGG + Intronic
1115878463 14:37888702-37888724 CAGTAGCCACATGTGTCTGGTGG - Intronic
1117221986 14:53615730-53615752 CAGTAGTCACATGTGGCTAGTGG - Intergenic
1117355233 14:54917610-54917632 CAGCAGGCACACATGGCTAGTGG - Intergenic
1117408866 14:55431846-55431868 CAGTAGCCACATCTGACTAGTGG + Intronic
1117880605 14:60309689-60309711 CAGTAGCCACATGTGGCTAATGG - Intergenic
1117982941 14:61359745-61359767 AAATAGCCACATATGGCTAGTGG - Intronic
1118295857 14:64568912-64568934 CAGTAGCCACATGTGGCTAGTGG + Intronic
1118453205 14:65922991-65923013 CAGTAGCCACATGTGGCTAGTGG + Intergenic
1118729603 14:68657092-68657114 CAATAGTCACATATGGCTAGTGG - Intronic
1118848121 14:69563482-69563504 CAGCAGCCACATATGGCTGGTGG - Intergenic
1119200833 14:72751557-72751579 CAGTAGCCACAGGTGGCTAGTGG - Intronic
1120191117 14:81440577-81440599 CAATAGCCACACATGCCTAGTGG - Intergenic
1120784447 14:88519366-88519388 CAGTAGCCACATGTGGCTAGTGG - Intronic
1120910074 14:89658338-89658360 CAGTAGCCCCATGTGGCTAGTGG + Intergenic
1121411544 14:93751865-93751887 AAGTAGCCACATGTGGCTGGTGG - Intronic
1121504386 14:94465312-94465334 CAGTAGCCACACATGGCTAATGG - Intronic
1121763700 14:96467308-96467330 CAGCAGCAAAAGATGGCTCTTGG - Intronic
1122063834 14:99158093-99158115 CAGTAGCCACATGTGTCTTGTGG - Intergenic
1122190832 14:100042241-100042263 CGGTAGTCACACATGGCTTGAGG + Intronic
1122479595 14:102038308-102038330 AAGTAGCCACACATAGCTAGTGG + Intronic
1123492368 15:20791831-20791853 CAATAGCCACATGTGGCTAGTGG - Intergenic
1123507982 15:20964589-20964611 CAGTAACCACATGTGGGTCGTGG + Intergenic
1123548870 15:21360918-21360940 CAATAGCCACATGTGGCTAGTGG - Intergenic
1123565200 15:21538331-21538353 CAGTAACCACATGTGGGTCGTGG + Intergenic
1123601463 15:21975618-21975640 CAGTAACCACATGTGGGTCGTGG + Intergenic
1124861630 15:33447726-33447748 CAATAGCCACACATGACTAGTGG + Intronic
1125466834 15:39961422-39961444 CAATAGCCATACATGGCTAGTGG - Intronic
1125743840 15:41985944-41985966 CAGCAGGCACAGGTGGTTCGCGG + Exonic
1126509555 15:49453525-49453547 CAGTAGCCACATGTGGCACATGG + Intronic
1127370721 15:58337092-58337114 CAATAGCCACATGTGGCTAGTGG + Intronic
1127422105 15:58816486-58816508 CTGCAGCCTCAGATGGCTCAAGG + Intronic
1127827865 15:62720992-62721014 CAGTACCCACAAATGGCTCCAGG - Intronic
1128267254 15:66277666-66277688 CAGTAGCCACAGACAGCTTTTGG + Intergenic
1128305980 15:66599356-66599378 CAGAAGCCACACATGGCAGGTGG + Intronic
1128767815 15:70261788-70261810 CAATAGCCACACATGGCTGGTGG + Intergenic
1129497705 15:76001521-76001543 CAGTAGCCACACATGGCTCCTGG + Intronic
1129909722 15:79216349-79216371 CAGTAGCTACATATGGCTAATGG - Intergenic
1129920479 15:79315314-79315336 CAATAGTCACAGGTGGCTAGTGG + Intronic
1130003010 15:80064012-80064034 CGGTAGCCACATATGACTAGTGG + Intronic
1130102003 15:80901356-80901378 AAGTAGCCACATGTGGCTCGTGG - Intronic
1130102062 15:80901756-80901778 CAGTAGCCACCGGTGACTAGTGG + Intronic
1130368113 15:83258751-83258773 CAGTATCCATATATGGCTAGTGG - Intronic
1130720879 15:86385046-86385068 CAATAGCCTCAGGAGGCTCGTGG - Intronic
1130911888 15:88276558-88276580 CAGTAGACACATATGGCTAGTGG + Intergenic
1131133507 15:89914826-89914848 AAGTAGCCACATGTGGCTAGTGG - Intergenic
1131610249 15:93953410-93953432 CAATAGCCACAGTTGGCTAGTGG + Intergenic
1131617075 15:94027738-94027760 CACTAACCACATATGGCTCTTGG - Intergenic
1132233920 15:100205197-100205219 GAGTCCCCACAGATGACTCGAGG + Intronic
1132407252 15:101551363-101551385 AAGAATCCACAGATGGCTCCTGG + Intergenic
1202957206 15_KI270727v1_random:88152-88174 CAATAGCCACATGTGGCTAGTGG - Intergenic
1202973571 15_KI270727v1_random:265437-265459 CAGTAACCACATGTGGGTCGTGG + Intergenic
1132546398 16:535288-535310 CAGTGGCCGCAGATGGAGCGGGG + Intronic
1133050899 16:3116724-3116746 CAGTAGCCACACATGGCTTGTGG - Intronic
1133155215 16:3869655-3869677 CAACAGCCACACGTGGCTCGTGG + Intronic
1133176650 16:4020161-4020183 CAGTAGCCACATGTGCCTGGAGG - Intronic
1133260008 16:4542912-4542934 CAGTAGCCACATATGGCTTGTGG + Intergenic
1133444132 16:5845734-5845756 CAGTGGCCACACGTGGCTAGTGG + Intergenic
1133699061 16:8292066-8292088 CAGTGGCCACATGTGGCTCGTGG - Intergenic
1133894172 16:9909546-9909568 AAATAGCCACATATGGCTAGTGG + Intronic
1133930370 16:10227382-10227404 CAATAGCCCCATATGGCTAGTGG + Intergenic
1134076294 16:11294058-11294080 CAGTGGCCACATGTGACTCGAGG + Intronic
1134429638 16:14191238-14191260 CAGCAGCCACATGTGGCTAGTGG + Intronic
1135612906 16:23884104-23884126 CAGTAGCCACATATGGCTAGTGG + Intronic
1135622032 16:23964079-23964101 CAGTAGGCACACATGGCTAGTGG - Intronic
1137499810 16:49001876-49001898 CAGTAGCCACATGTGGCTAATGG - Intergenic
1137575520 16:49597302-49597324 CAGTAGTCACATGTGGCTAGTGG - Intronic
1138083324 16:54112353-54112375 AAGTAGCCACAGCTAGCTAGTGG - Exonic
1138090159 16:54167384-54167406 CAGTTGCCACACGTGGCTCATGG + Intergenic
1138440599 16:57032629-57032651 CAGTGGCCATAGGTGGCTAGTGG + Intronic
1138868062 16:60848261-60848283 CTGTAGCCACAGATAGCTCAGGG - Intergenic
1139148181 16:64347508-64347530 TTGTAGCCATAGATGGCTAGTGG + Intergenic
1139926861 16:70493348-70493370 CAATAGCCACACATGGCTGAGGG - Intronic
1140198574 16:72876268-72876290 CTTCAGCCACAGATGGCTCAGGG + Intronic
1140832239 16:78762589-78762611 CAGTGGGCACAGGGGGCTCGGGG + Intronic
1141009466 16:80383962-80383984 CAGTATTCACACATGGCTGGTGG - Intergenic
1141305367 16:82857864-82857886 CAGTAGCCACCGGTGGTTCATGG + Intronic
1141337895 16:83174588-83174610 AAGTAACCACAGGTGGCTAGTGG - Intronic
1141404798 16:83783032-83783054 CAGAAGCCACACATGGCTGCTGG - Intronic
1142871137 17:2821756-2821778 CAGTAGCCACATGTGGCTGGTGG + Intronic
1143873877 17:9977257-9977279 CAAGAGCCACACATGGCTAGTGG + Intronic
1144230099 17:13193427-13193449 CAGTAGCCACACGTGGGTAGTGG - Intergenic
1144235857 17:13259596-13259618 CAATAGCCACATGTGGCTTGTGG - Intergenic
1146134028 17:30302830-30302852 TAATAGCCACACATGGCTGGAGG + Intergenic
1146435749 17:32845644-32845666 TAATAGCCACATGTGGCTCGTGG - Intronic
1146435762 17:32845730-32845752 CAATTGCCACAGGTGGCTCGTGG + Intronic
1146483763 17:33227100-33227122 CAGTAGCCACACATGGCCAGTGG + Intronic
1147590734 17:41681854-41681876 CAGAAGCCACAGGTGGCTTGTGG + Intergenic
1147765415 17:42832426-42832448 CAGTAGCCACATGTGGCTGCTGG - Intronic
1147907024 17:43830123-43830145 CAGGCGCCACTGATGGCTAGAGG + Intronic
1148429344 17:47629252-47629274 CAGCAGCCACATAAGGCTAGTGG + Intergenic
1149072616 17:52560648-52560670 CATTAGCCACATATGGCTTGTGG + Intergenic
1149579301 17:57737329-57737351 CAATAGCCACATATGCCTGGTGG + Intergenic
1149971680 17:61224855-61224877 CAGTAGCCACATGTTGCTAGTGG + Intronic
1150426818 17:65083714-65083736 CAGTAGCCACATGTGGCTAGTGG + Intergenic
1150572094 17:66395503-66395525 CAGTAGGCACACTTGGCTAGTGG + Intronic
1150813551 17:68375615-68375637 CAGTAGCCATATGTGGCTAGTGG + Intronic
1151111002 17:71677796-71677818 CAGTAGCCACATATGGCTAGCGG + Intergenic
1151388401 17:73769596-73769618 CAATAGCCACATGTGGCTCAGGG + Intergenic
1151712732 17:75816114-75816136 CAGTAGCCACATGTGGCTTTCGG + Intronic
1152311192 17:79550998-79551020 CAGTAGCCACATGGGGCTAGCGG - Intergenic
1153230928 18:2935084-2935106 CAGTAGCCACATGTGGCTGGTGG - Intronic
1153235568 18:2983590-2983612 CAGTAGCCACACGTGGCTAATGG - Intronic
1153274430 18:3354022-3354044 CAGTAGCCACATGTGGTTGGTGG + Intergenic
1153520005 18:5942753-5942775 CAATAGCCACGTGTGGCTCGTGG - Intergenic
1153746556 18:8185571-8185593 CAGTGGCCTCAGGTGGCTCTGGG + Intronic
1154423201 18:14252503-14252525 CTGCAGCCCCAGATGGCTCCTGG + Intergenic
1154449911 18:14466388-14466410 CAATAGCCACATGTGGCTAGTGG - Intergenic
1155297663 18:24399993-24400015 CAATAGCCACATGTGGCTAGTGG - Intergenic
1155334007 18:24746532-24746554 CAGTAGCCACACATAACTAGTGG + Intergenic
1156123371 18:33872751-33872773 CAATAGCCACATATGGATAGTGG + Intronic
1156286196 18:35698570-35698592 CAATAGCCACACATGACTAGTGG + Intronic
1156813385 18:41279040-41279062 CACTAGCCACATCTGGCTAGTGG - Intergenic
1156969813 18:43140481-43140503 CAGTTGCCACTGCTGGCTCCAGG - Intergenic
1157136323 18:45059733-45059755 CAGTAGCCACAAGTGGCTAGTGG + Intronic
1157157691 18:45283869-45283891 CTGTAGTCACAGAGGGCTAGTGG - Intronic
1157167650 18:45372999-45373021 CAATAGCCACACCTGGCTAGTGG + Intronic
1157423085 18:47562434-47562456 CAATAGCCACAGGTGCCTAGTGG + Intergenic
1157647292 18:49287873-49287895 CAGTAACCACAAGTGGCTAGTGG - Intronic
1157674109 18:49555785-49555807 CAGTAGCCACAGGGGGCCCGTGG + Intergenic
1158418983 18:57275823-57275845 CTGTAGCCCCAGATGCCTCTTGG - Intergenic
1158474432 18:57767383-57767405 TAATAGCCACACATGGCTCGTGG - Intronic
1158926832 18:62273731-62273753 AAGTAGCCACATGTGGCTAGTGG + Intronic
1158995605 18:62915777-62915799 CAATAGCCACAGACGGCCAGTGG - Intronic
1159773143 18:72572371-72572393 CTGTAGCAACAGATGACTAGTGG + Intronic
1160571086 18:79818146-79818168 CAGCAGCCACACATGGATCCAGG - Intergenic
1160911631 19:1476580-1476602 CAGGAGCCACACATGGCTGGTGG - Intronic
1161536720 19:4823944-4823966 CAGTAGACACAGGTAGCTGGGGG - Intronic
1161974603 19:7601025-7601047 CAGTAGCCACATCTGGCTGGTGG - Intronic
1162255347 19:9484361-9484383 CAGTAGCCACACATGTCTAGTGG - Intronic
1162846460 19:13396520-13396542 CATTAGCCACACGTGGCTCTTGG - Intronic
1163040328 19:14597378-14597400 CAACAGCCACATATGGCTTGTGG - Intronic
1163114776 19:15182108-15182130 CAGTAGCCACATGTGGCTAATGG - Intronic
1163717819 19:18882260-18882282 CAGTGGCCACAAGTGGCTGGTGG - Intronic
1163862669 19:19750334-19750356 CTGCAGCCCCAGATGGCTCCTGG + Intergenic
1164847618 19:31448167-31448189 CAGTAGCCACATGTGGCCAGTGG + Intergenic
1165989580 19:39802032-39802054 CAATAGCCACATGTGGCTAGTGG - Intergenic
1167218702 19:48183038-48183060 CAGTAGCCACTTGTGGCTGGGGG - Intronic
1167274280 19:48526976-48526998 CAATAGCCACATGTGGCTAGTGG + Intergenic
1167714583 19:51133763-51133785 CAGTAGCCACATGTGGCTAGTGG - Intronic
1168364819 19:55777256-55777278 CAGTAGCCACATGTGGCTGGTGG + Intergenic
1168679044 19:58300484-58300506 CACTGGCCACAGATGGGTCAGGG + Exonic
925440146 2:3878677-3878699 AAATAGCCACATATGGCTGGTGG + Intergenic
925810894 2:7699362-7699384 TAGTAGCCACATGTGGCTGGTGG - Intergenic
925953844 2:8941473-8941495 CACTAGCCACATGTGGCTAGTGG - Intronic
925985637 2:9212734-9212756 CAGTAGCCACACGTGGCTGGTGG + Intronic
926022423 2:9508193-9508215 AAGTAGCCACATATGGTTGGTGG - Intronic
926278864 2:11428343-11428365 TAGTAGCCACATATGGCTAGTGG - Intergenic
927218539 2:20684662-20684684 CACAAGCCACAGAGGGCTTGTGG + Intronic
927706853 2:25301762-25301784 CAGGAGCCAAAGATGGCTTTTGG + Intronic
927893965 2:26769561-26769583 CAGGGGCCAGAGAGGGCTCGAGG - Intronic
928000677 2:27520570-27520592 CAATAGCCACATGTGGCTGGTGG - Intronic
928016918 2:27665993-27666015 CAGTAACCACATGTGGCTAGTGG - Intronic
928056323 2:28058959-28058981 CAGCAGCCACAGAAGGCACAGGG - Intronic
928376935 2:30782864-30782886 AAGTATCCACATATGGCTTGTGG - Intronic
928576008 2:32655864-32655886 AAGTAGCCATACATGGCTAGTGG - Intronic
929487873 2:42370886-42370908 CAGTAGCCACATGTGGATGGTGG - Intronic
929546635 2:42859362-42859384 CAAAAGCCACACATGGCTAGTGG - Intergenic
929813188 2:45209070-45209092 CAGAAGGCCCAGATGGCTCCGGG + Intergenic
929823769 2:45294010-45294032 CAATAGCCACATGTGGCTAGTGG - Intergenic
929884534 2:45866678-45866700 AAATAGCCACAGGTGGCTAGTGG - Intronic
930220196 2:48738657-48738679 CAGTGGCCACATATGGCTAATGG - Intronic
930604650 2:53480944-53480966 CAGTAGCCACATGTGGCTATTGG - Intergenic
930703457 2:54482669-54482691 CAGTAGCCACACATGGCTCATGG + Intronic
931164268 2:59729479-59729501 CAATAGCCACACATGGCTCGTGG + Intergenic
931267535 2:60673789-60673811 CAGTGGCCACACGTGGCTGGTGG - Intergenic
931322336 2:61183209-61183231 CAGTAGCCACATGTGACTAGTGG + Intronic
931460491 2:62446404-62446426 CAGTAGCCACATGTGTCTAGTGG + Intergenic
931488477 2:62718395-62718417 CACTAGCCACATGTGGCTAGCGG + Intronic
932121820 2:69108065-69108087 CAGCAGCCACATGTGGCTTGTGG - Intronic
933600197 2:84321104-84321126 CAGTAGCCACATGTGGCTAGAGG + Intergenic
933917064 2:87006232-87006254 CAATAGCCACATGTGGCTAGTGG - Intronic
934005931 2:87763682-87763704 CAATAGCCACATGTGGCTAGTGG + Intronic
934215345 2:90026740-90026762 CAGTAGCCACATATGACTAATGG + Intergenic
934474706 2:94586576-94586598 AAGGAGCCACAGCTGGATCGGGG - Intergenic
934518794 2:95006372-95006394 CAGTTGCCACACATGGGTCTCGG - Intergenic
935239350 2:101164943-101164965 AAATAGCCACACATGGCTAGTGG - Intronic
935768887 2:106397782-106397804 CAATAGCCACATGTGGCTAGTGG + Intronic
935856855 2:107283833-107283855 CAATAACCACATATGGCTAGTGG - Intergenic
935911215 2:107898142-107898164 CAATAGCCACATGTGGCTAGTGG - Intergenic
935957209 2:108389310-108389332 CAGTAGCCATGAATGGCTAGAGG + Intergenic
935969325 2:108514979-108515001 CAATAGCCACATGTGGCTAGTGG - Intergenic
936132988 2:109863184-109863206 CAATAGCCACATGTGGCTAGTGG - Intergenic
936211709 2:110508301-110508323 CAATAGCCACATGTGGCTAGTGG + Intergenic
936420848 2:112362878-112362900 CAATAGCCACATGTGGCTAGTGG + Intergenic
936482982 2:112902379-112902401 CAATAGCTACACATGGCTAGTGG + Intergenic
936951448 2:117981808-117981830 CAATAGCCACATATGGATAGTGG + Intronic
937443533 2:121937069-121937091 CAGTAGCCACAAGTGGCAAGTGG - Intergenic
938324101 2:130386118-130386140 AAATAGCCACACATGGCTAGTGG - Intergenic
938324156 2:130386528-130386550 CAGTAAGCACACATGGCTTGTGG + Intergenic
938422352 2:131155265-131155287 CAGTAGCAACAGAGGGCGCGGGG + Intronic
938481514 2:131666371-131666393 CAATAGCCACATGTGGCTAGTGG + Intergenic
939004766 2:136773659-136773681 CAGTAGCCACATGTGGCTGGTGG + Intronic
939457468 2:142455863-142455885 CAATAGCCACATGTGGCTAGTGG - Intergenic
940751807 2:157634387-157634409 CAGTAGCCACAAGTGGCTGGTGG - Intergenic
940858001 2:158744770-158744792 CAGTAGCCACATTTGGCCAGTGG - Intergenic
941591280 2:167423240-167423262 CAGTACCCCCATATGGATCGGGG - Intergenic
941764617 2:169283456-169283478 CAATAGCCACATATGACTAGTGG + Intronic
941945356 2:171090934-171090956 CAGTAGCCACATGTGGCCAGTGG + Intronic
942300938 2:174561784-174561806 CAGTAGCCACATGTGGCTGGTGG - Exonic
942366022 2:175228756-175228778 CAGTAGCCACATGTGGCTAGTGG - Intergenic
942503390 2:176616046-176616068 CAATAGCCACATGTGGCTAGTGG - Intergenic
943601632 2:189927789-189927811 AAATAGCCACATATGGCTAGTGG - Intronic
943949518 2:194114128-194114150 CAGAAGCCAGAGATGGCTGTGGG + Intergenic
943966108 2:194334847-194334869 CAGTAGCTACATATGACTGGTGG + Intergenic
944161571 2:196666487-196666509 CAGTAGCCACTTGTGGCTAGTGG + Intronic
944287659 2:197970026-197970048 CAATAGCCACATATAGCTGGTGG - Intronic
944894908 2:204153864-204153886 CAGTAGCCACATGTGACTGGTGG - Intergenic
944920081 2:204403665-204403687 CAATAGCCACACGTGGCTAGTGG - Intergenic
944975899 2:205050489-205050511 CAATAGCCACATGTGGCTAGTGG - Intronic
945491371 2:210459545-210459567 CAATAGCCACATGTGGCTAGTGG + Intronic
946275312 2:218627357-218627379 CAGTAGCCACATGTGGCTAGAGG + Intronic
946342252 2:219077894-219077916 TAGTAGCCACATGTGGCTGGTGG - Intronic
946614612 2:221496290-221496312 CAATAGCCATATATGGCTAGTGG - Intronic
946883888 2:224203745-224203767 CAATAGCCACATGTGGCTAGAGG + Intergenic
947029218 2:225773783-225773805 CAATAGCCACATGTGGCTAGTGG + Intergenic
947108490 2:226693256-226693278 CAGTAACCACATGTGGCTTGTGG + Intergenic
947860186 2:233353152-233353174 AAGTAGCCACATGTGGCTAGTGG + Intergenic
947923253 2:233897721-233897743 CAGTAGCCACATGTGGCTAGAGG + Intergenic
948004893 2:234600054-234600076 CACCAGCCACAGGTGGCTCCTGG + Intergenic
948460963 2:238129801-238129823 CTGTAGCCACAGGTGGCTCCTGG + Intronic
948750826 2:240131939-240131961 CAGTATCCAGAGATGCCTCAGGG - Intronic
1169322997 20:4650582-4650604 CAGTAACCACATATGGCTAGTGG - Intergenic
1169794037 20:9442247-9442269 CAAGAGCCACAGATGGCTAGAGG + Intronic
1169822772 20:9731470-9731492 CAGTAGCCACATGTGGTTAGTGG + Intronic
1169833460 20:9851768-9851790 TAGTAGCCACACATGGCTAGTGG - Intergenic
1169899823 20:10541580-10541602 CAGTAGCCACATGTGGCTTGAGG + Intronic
1169932541 20:10850262-10850284 CAATAGCCACATGTGGCTAGTGG + Intergenic
1170171294 20:13416059-13416081 AAATAGCCACATGTGGCTCGTGG - Intronic
1170395647 20:15922514-15922536 CACTAGCCACACATGGCTATGGG - Intronic
1170565591 20:17601614-17601636 CAGTAGCCACATCTGACTAGTGG + Intronic
1170711702 20:18797255-18797277 CAGTAGCCACATACAGCTAGTGG + Intergenic
1170851226 20:20006219-20006241 CAATAGCCACATGTGGCTGGTGG + Intergenic
1171052754 20:21875415-21875437 CAGTGGCCACATGTGGCTGGTGG - Intergenic
1171886028 20:30652981-30653003 CTGCAGCCCCAGATGGCTCCTGG - Intergenic
1172132823 20:32667100-32667122 CAGCAGCCACAGATGGTCAGTGG + Intergenic
1172280815 20:33706730-33706752 CAGTAGCCACATGTGGCTAGTGG - Exonic
1172354162 20:34268172-34268194 CAGTAGCCACAGATGACCAGTGG + Intronic
1172395348 20:34599884-34599906 GAATAGCCACATATGGCTAGGGG - Intronic
1172522487 20:35576998-35577020 CAGTAGCCACGTGTGGCTGGTGG - Intergenic
1172627921 20:36359055-36359077 CAATAGCCACATGTGGCTCATGG - Intronic
1172627947 20:36359341-36359363 CAGTAGCCACACGTGGCTCACGG + Intronic
1172636694 20:36414778-36414800 CAGTGGCCACAAATGGCTAGTGG - Intronic
1172742166 20:37177731-37177753 CAGTAGCCACAGATAACTAGTGG - Intronic
1172859564 20:38036885-38036907 CAATAGCCACACGTGGCTAGTGG + Intronic
1172986248 20:38993258-38993280 CAATAGCTACAGGTGGCTAGTGG - Intronic
1172986312 20:38993725-38993747 CTATAGCCACAGGTGGCTAGTGG + Intronic
1173007241 20:39149843-39149865 CAATAGCCACATGTGGCTGGTGG + Intergenic
1173137490 20:40452168-40452190 CAGTAGCCACATGTAGCTAGTGG + Intergenic
1173200395 20:40950527-40950549 CAGTAGCCACATGTGGCTCGTGG + Intergenic
1173261960 20:41444375-41444397 CAATAGCCACACAGGGCTAGTGG + Intronic
1173429412 20:42972870-42972892 CAGTAGCCACACATGGCTAGTGG - Intronic
1173454841 20:43193496-43193518 CAGTAGCCACAGGTGGCCAGTGG + Intergenic
1173495031 20:43512593-43512615 CAATAGCCACATGTGGCTAGTGG + Intronic
1173704986 20:45103521-45103543 CGGTAGCCACACATGGCTCGTGG + Intergenic
1173812734 20:45966124-45966146 CAATAGCTACATATGGCTGGTGG - Intronic
1173896366 20:46553999-46554021 CAGTAGCCACACATAGCAAGTGG + Intergenic
1173955319 20:47027773-47027795 CAGTAGCCACCTGTGGCTAGGGG - Intronic
1173980586 20:47220903-47220925 CAGTAGCCACATGTGGCTAGTGG - Intronic
1174185023 20:48700311-48700333 CAGTAGCTACCTGTGGCTCGTGG - Intronic
1174289871 20:49500468-49500490 CAGCAGCCACGGAAGGCTCTGGG - Intergenic
1174346061 20:49930917-49930939 CAATAGCCACAAGTGACTCGTGG - Intergenic
1174567619 20:51477938-51477960 CAGAAGCCACATGTGGCTAGTGG + Intronic
1174620538 20:51871152-51871174 AAATAGCCACATATGGCTAGTGG - Intergenic
1174842941 20:53916812-53916834 CAGTAGCCACATGTGGGTGGTGG - Intergenic
1175038503 20:56022988-56023010 CAGTAGCCACTGTTGGCTTCTGG - Intergenic
1176446263 21:6823969-6823991 CAATAGCCACATGTGGCTAGTGG + Intergenic
1176824432 21:13688999-13689021 CAATAGCCACATGTGGCTAGTGG + Intergenic
1176893387 21:14346532-14346554 CAGTAGTCACATATTGCTAGTGG + Intergenic
1177079450 21:16620246-16620268 CAGTAGACACATGTGGCTAGTGG - Intergenic
1177633811 21:23760141-23760163 CAGTAGTCACATGTGGCTAGTGG + Intergenic
1177642175 21:23857554-23857576 CAGTAGCCACACGTGGCTAGGGG - Intergenic
1177791493 21:25727044-25727066 CAATAGCCAGATATGGCTAGTGG - Intronic
1177832517 21:26154901-26154923 TAGTAGCCACAGATGGCTAGTGG - Intronic
1178040538 21:28635943-28635965 AAATAGCCACAGGTGGCTGGTGG + Intergenic
1178119934 21:29459236-29459258 CAGTAGCCACATGTGGCTGGTGG + Intronic
1178449862 21:32688045-32688067 CAGTAGCTACATGTGGCTAGTGG + Intronic
1178712248 21:34928176-34928198 CAGTAGCCACATGTGGCTAGTGG + Intronic
1178957120 21:37032514-37032536 GAGTAGCGACAGGTGGCCCGTGG - Intergenic
1179151131 21:38809259-38809281 CTGTAGCCACACATGGCAAGTGG + Intronic
1179201657 21:39228942-39228964 CAGTAGCCACATGTGACTAGTGG + Intronic
1180237567 21:46472931-46472953 CAGTAGCCACATGTGGCTGGTGG - Intronic
1180482738 22:15769966-15769988 CAATAGCCACATGTGGCTAGTGG + Intergenic
1180883086 22:19220308-19220330 CAGTAGCCTCCCATGGCTAGTGG - Intronic
1181319966 22:21996796-21996818 CAGTAGCCACATGTGGCTTGGGG - Intergenic
1181573548 22:23780565-23780587 CAGTACCTACAGATGGGTGGGGG - Exonic
1181668017 22:24411817-24411839 CAGAAGACCCAGATGGCACGAGG - Intronic
1181948099 22:26534126-26534148 CAGGGGCCACACATGGCTAGTGG + Intronic
1182062946 22:27410861-27410883 CAGAAGCCCCAGATGGCAAGTGG - Intergenic
1182408708 22:30162373-30162395 CAATAGCCACATGTGGCTAGTGG - Intronic
1182670728 22:31993532-31993554 CAGTAGCCACATAGGGCTCATGG - Intergenic
1183462946 22:37963572-37963594 CAGTAGCCACATGTGGCTACTGG + Intronic
1183777609 22:39977198-39977220 CAATAGCCACATGTGGCTAGTGG - Intergenic
1183789258 22:40051975-40051997 CAGTAGCCACATGTGGCTAGTGG + Intronic
1183806167 22:40212973-40212995 CAGTTGCCACATGTGGCTAGTGG + Intronic
1184173178 22:42771488-42771510 CAGCAGCCACAGGTGTCTCAGGG - Intergenic
1184336990 22:43859784-43859806 CAGTAGCCACATGGGGCTAGCGG - Intronic
1184887495 22:47355338-47355360 GAGTAGCCACAGATGGCATTTGG + Intergenic
1184984342 22:48119242-48119264 AAGTAGCCACAGAGGACTCCAGG - Intergenic
1185094868 22:48800701-48800723 CAGCAGACACAGGTGGCTGGAGG + Intronic
1185129350 22:49029010-49029032 CAGTAACCACACGTGGCTCATGG + Intergenic
1185309642 22:50146963-50146985 CGGTAGCCACACACGGCTCTCGG - Intronic
949207862 3:1461758-1461780 CAATAGCCACAGGTGGCCAGAGG + Intergenic
949348946 3:3104391-3104413 CAATAGTCACATATGGCTAGTGG + Intronic
949811386 3:8010726-8010748 CAGTAGCCACATGTGGCCAGTGG + Intergenic
950211035 3:11123539-11123561 CAGTAGCCTCATATGGCTGGTGG - Intergenic
950404343 3:12795416-12795438 CAATAGCCACATGTGGCTAGTGG + Intergenic
950770108 3:15304448-15304470 CAGTAGCCACACGTGGCTGGTGG - Intronic
950888798 3:16384820-16384842 CACTAGCCACAAGTGGCTGGTGG - Intronic
950960094 3:17096215-17096237 CAGTAGCCCCATGTGGCTAGTGG + Intergenic
951222233 3:20080692-20080714 CAATAGCCACACATGGCTAGTGG - Intronic
951230083 3:20168586-20168608 CAGTAGCCATATGTGGCTAGTGG - Intronic
951357530 3:21686692-21686714 CAGTCGCCACATGTGGCTAGTGG + Intronic
951462636 3:22968061-22968083 CAGGAGCCACAGCTGGCTGGTGG + Intergenic
951666820 3:25135177-25135199 CAATAGCCACACCTGGCTAGTGG - Intergenic
951695565 3:25442465-25442487 CAATAGCCACACATGGCTAGTGG + Intronic
951863813 3:27284454-27284476 CAATAGCCACATGTGGCTAGTGG + Intronic
951981380 3:28570786-28570808 CAATAGCCACATGTGGCTGGTGG + Intergenic
951985515 3:28615599-28615621 CAACAGCCACACATGGCTAGTGG + Intergenic
952154464 3:30627828-30627850 AAATAGCCACAGGTGGCTCTTGG + Intronic
952234562 3:31465423-31465445 CATTAGCCACATGTGGCTAGTGG + Intergenic
952274616 3:31865283-31865305 CAGTAGCCACATCTGGCTGATGG - Intronic
952783142 3:37124157-37124179 CAGTAGCCACGTGTGGCTAGTGG - Intronic
952887261 3:38019374-38019396 CAATAGCCACAAGTGGCTAGTGG + Intronic
952927351 3:38329765-38329787 CAATAGCCACATGTGGCTAGTGG - Intergenic
953075490 3:39566114-39566136 CAGTAGCCACATATGGCTCATGG - Intergenic
953101353 3:39831817-39831839 CAATAGCCACCTATGGCTGGTGG + Intronic
953143973 3:40256052-40256074 CAGTAGCCACACGTGGCTAGTGG - Intronic
953472059 3:43176068-43176090 CTGTAGCCACATGTGGCTAGTGG - Intergenic
953598789 3:44343612-44343634 CAGTAGCTACATGTGGCTAGTGG + Intronic
954437357 3:50503283-50503305 CAGCAGCCACAGCGGGCGCGGGG + Exonic
954727820 3:52630381-52630403 AAATAGCCACACATGGCTAGTGG - Intronic
954967411 3:54623735-54623757 CATTAGCCACATGTGGCTAGTGG - Intronic
955000799 3:54925702-54925724 CGGTAGCCACACATGGCTATTGG - Intronic
955000805 3:54925799-54925821 CAGTAGCCACATGTGGCTAATGG + Intronic
955042174 3:55328411-55328433 CAGTAGCCACACGTAGCTAGTGG - Intergenic
955102454 3:55863895-55863917 CAATAGCCACATATGGCTCATGG + Intronic
955370681 3:58349028-58349050 CAGTAGCCACATATTGCTTGTGG + Intronic
955545747 3:60027884-60027906 CAGTAGCCACATATGGCTAGTGG - Intronic
955689509 3:61577406-61577428 TACTAGCCACAGGTGGCTGGTGG - Intronic
955877498 3:63508107-63508129 CAATAGCCACATGTGGCTAGTGG + Intronic
956074220 3:65487896-65487918 AAGTAGCCACACATGGCTGGTGG - Intronic
956291351 3:67663374-67663396 GAATAGCCACACATGGCTAGTGG + Intergenic
956347319 3:68294932-68294954 CAGTAGCCACAAATGGCCAATGG + Intronic
956352766 3:68356049-68356071 CAATAGCCACAAGTGGCTAGCGG + Intronic
956391431 3:68777402-68777424 CAGTATCCACATTTGGCTAGTGG - Intronic
956430839 3:69184799-69184821 CAGCAGCCACATGTGGCTAGTGG - Intronic
956620769 3:71219340-71219362 CAGTAGCCACATGTGGCCAGTGG - Intronic
956760031 3:72433622-72433644 CAGTAGCCACCTTTGGCTAGTGG - Intronic
956825493 3:72994075-72994097 CAGTAGCTACATGTGGCTAGTGG - Intronic
957181674 3:76886835-76886857 AAGTAGCCACATATAGCTAGTGG - Intronic
957606797 3:82410146-82410168 CAATAGCCACATGTGGTTCGTGG - Intergenic
958698737 3:97560492-97560514 CAATAGCCACATATGGCTGGTGG + Intronic
958879200 3:99650398-99650420 TAGTAGCCATACATGGCTAGTGG - Intronic
958949828 3:100404401-100404423 CAATAGCCACATGTGGCTAGTGG - Intronic
958962638 3:100524544-100524566 CAATAGCCACATGTGGCTCGTGG - Intronic
959262299 3:104098036-104098058 CAGCAGCTACAGAGGGCTGGTGG + Intergenic
959319562 3:104853958-104853980 CAATAGCCACATATGGCTATTGG - Intergenic
959568509 3:107857387-107857409 CAGTAACCACATGTGGCTAGTGG + Intergenic
960248932 3:115430967-115430989 CAGTAGCCACAAATGGCTAATGG + Intergenic
960624922 3:119673512-119673534 CAACAGCCACATATGGCTAGTGG + Intronic
960855660 3:122099708-122099730 AAGTAGTCACATATGGCTAGTGG - Intronic
961146411 3:124597635-124597657 CAGTAGCCACAAATGGCCAGTGG - Intronic
961884789 3:130089387-130089409 CAGTAGCCACATGTGGCCTGAGG - Intronic
961916496 3:130380609-130380631 CAGTAGTCACACATGGCTGGTGG - Intronic
962108142 3:132414883-132414905 CAGTAGCCACATAGGGCTAGTGG + Intergenic
962459735 3:135599137-135599159 CAATAGCCACAGGTGGCTAATGG - Intergenic
962692638 3:137915576-137915598 CAATAGCCACATGTGGCTAGTGG + Intergenic
963096684 3:141549598-141549620 CAATATCCACACATGGCTAGTGG - Intronic
963118203 3:141751796-141751818 CAGTAGTCACATATGGATAGTGG + Intergenic
963542654 3:146613354-146613376 CAGTAGCCACATATGACTATTGG + Intergenic
963906334 3:150776441-150776463 CAGTAGCCACATGTGACTAGTGG - Intergenic
963947191 3:151159432-151159454 CAGTAGCCACATCTGGCTAGTGG - Intronic
963952217 3:151215258-151215280 CAATACCCACACATGGCTAGTGG - Intronic
964809902 3:160652130-160652152 CAGTAGCCACATGTGACTAGTGG - Intergenic
964863171 3:161224269-161224291 CAGTTGCCACATGTGGCTAGTGG + Intronic
965481235 3:169222070-169222092 CAATAGCCACATGTGGCTAGAGG + Intronic
965598897 3:170435851-170435873 CAGTAGCCACATGTGGCTGGAGG + Intronic
966014522 3:175125096-175125118 CAGTAGCCACATGTGGCTAGTGG - Intronic
966062408 3:175774688-175774710 CAGTAGCCACACATTGCTAGTGG - Intronic
966214188 3:177484375-177484397 CATTAGCCACATAAGGCTAGTGG - Intergenic
966413886 3:179669665-179669687 CAACAGCCAAAGATGGCTAGTGG - Intronic
967008946 3:185413375-185413397 CACTAGCCACATGTGGCTAGTGG - Intronic
967127744 3:186440414-186440436 CAGTAGTCACAAGTGGCTAGTGG - Intergenic
967283643 3:187847716-187847738 CAATAGCCACATATGTCTAGTGG + Intergenic
967770009 3:193324397-193324419 GAGTAGCCACATATGGCTCGTGG + Intronic
967826880 3:193884075-193884097 CAGTGGTCACAGATGGCTCACGG - Intergenic
968377077 4:52544-52566 CAGTAGCTACATATGGCAGGTGG - Intergenic
968384280 4:122650-122672 CAGTAGCTACATATGGCAGGTGG - Intergenic
968393443 4:211920-211942 CAGTAGCTACATATGGCAGGTGG - Intergenic
968402014 4:306138-306160 CAGTAGCTACATATGTCTGGTGG + Intergenic
968410376 4:385160-385182 CAGTAGCTACATATGGCAGGTGG - Intergenic
969254177 4:5991308-5991330 CAATAGCCCCATGTGGCTCGTGG + Intergenic
969320236 4:6407856-6407878 CATTAGCCACCCATGGCTGGTGG - Intronic
969398837 4:6940211-6940233 CAGTAGCCACATGTGGCTTGTGG + Intronic
969623255 4:8289573-8289595 CATTTGCCACAGGTGGCTGGTGG - Intronic
969672042 4:8595236-8595258 CAGTGGCCACGTGTGGCTCGTGG + Intronic
970736681 4:19178514-19178536 CAGTAACCACATGTGGCTGGTGG - Intergenic
970860463 4:20696762-20696784 CAATAACCACAGATGGCTAGTGG - Intronic
971223968 4:24734425-24734447 CAGTAGCCCCAGAGGACTCCTGG + Intergenic
971297004 4:25403730-25403752 CAGCAGCCACAAATGGTTAGTGG + Intronic
971463574 4:26929006-26929028 CAATAGCCAAATATGGCTAGTGG - Intronic
971699461 4:29951419-29951441 CAGTATTCACAGATGGCTAGTGG - Intergenic
972292457 4:37702538-37702560 CAATAGCCACACATGGCTGGTGG - Intergenic
972776613 4:42247226-42247248 TAGTAGCCACATTTGGCTGGTGG + Intergenic
972830904 4:42812517-42812539 CAATAGCCACATGTGGCTAGGGG - Intergenic
973136685 4:46716914-46716936 CAGAAGCCACAGAAGACTCAAGG - Intergenic
973325215 4:48853634-48853656 AAATAGCCACATATGGCTAGCGG - Intronic
973369625 4:49234988-49235010 CTGCAGCCCCAGATGGCTCCTGG - Intergenic
973391406 4:49560428-49560450 CTGCAGCCCCAGATGGCTCCTGG + Intergenic
973813190 4:54593259-54593281 CAATAGCCACATATAGCTAGTGG - Intergenic
973889806 4:55357517-55357539 CAGTAGCCACAGGTGGCGATTGG + Intronic
974941350 4:68472533-68472555 CATTGGCCACAGGTGGCTAGTGG + Intronic
975296326 4:72738487-72738509 CAGTAGCTACAAAGGGCTGGGGG - Intergenic
975794235 4:77989318-77989340 CAGTAGCCACATGTGGCTGGTGG + Intergenic
976198620 4:82558293-82558315 CAATAGCCACATGTGGCTCATGG + Intronic
976396271 4:84559113-84559135 CAGTAGCCACATATGGTTAGTGG + Intergenic
977158542 4:93605284-93605306 CAGTAGCCATATGTGGCTTGTGG + Intronic
977270650 4:94913830-94913852 CAATAGCCACACATGGCTAGTGG - Intronic
977309681 4:95370092-95370114 CAATAGCCACATATGGCTACTGG - Intronic
977481368 4:97581095-97581117 AAATAGCCACAAATGGCTAGTGG - Intronic
977650758 4:99466386-99466408 TAATAGCCACATATGGCTAGTGG + Intergenic
977873701 4:102124153-102124175 CAATAGTCACATATGGCTAGTGG - Intergenic
979226013 4:118285563-118285585 CAGTAACCACAGTTAGCTAGTGG - Intronic
980520741 4:133930342-133930364 AAATAGCCACATATGGCTAGTGG - Intergenic
981251626 4:142609964-142609986 CAGTAGCCAGATATGGGTAGTGG - Intronic
981467018 4:145084729-145084751 AAGTAGCCACATGTGGCTAGTGG - Intronic
981941435 4:150285707-150285729 CAGTACTCACATATGGCTAGTGG - Intronic
981949476 4:150388896-150388918 CAATAGCCACATGTGGCTAGTGG + Intronic
982497983 4:156115553-156115575 CAGTAGTCACAGACAGCTAGTGG - Intergenic
982639597 4:157941684-157941706 CAGCAGTGACAGATGGCTTGGGG - Intergenic
983923133 4:173369266-173369288 GAGTAGCCACATATGGCTAGAGG + Intergenic
983964602 4:173794054-173794076 CAGAAGCCACACATGGCCAGAGG + Intergenic
983991538 4:174125984-174126006 TAGTAGCCACATGTGGCTCATGG + Intergenic
984791679 4:183620530-183620552 CAATAGCCACATGTGGCTAGTGG + Intergenic
986450788 5:7862337-7862359 CAGTAGCCACATGTGGCTCATGG - Intronic
986970730 5:13332929-13332951 CAGTAGCCACATATGGCCAGTGG - Intergenic
986979234 5:13427704-13427726 CAGTAGCCACAAGTGGCTGGTGG - Intergenic
987236636 5:15949259-15949281 CAGTAACCACACATGGCAAGTGG - Intergenic
987364325 5:17135255-17135277 CGATAGCCACAGGTGGCTAGTGG - Intronic
987425433 5:17767493-17767515 CAGTAGCCACAGATGGCTTATGG - Intergenic
988427064 5:31076086-31076108 CAGTAGCCACATGTGGTTAGTGG + Intergenic
988474438 5:31570947-31570969 CAGTATCCACACATGGCCTGTGG + Intergenic
988478224 5:31606876-31606898 AAGTAGCCACATGTGGCTCGTGG + Intergenic
989135044 5:38145334-38145356 CAGTAGCCACACGTGGCTGGTGG + Intergenic
989347013 5:40440331-40440353 CAGTAGCCACATGTGACTAGTGG + Intergenic
989564420 5:42887593-42887615 AAATAGCCACATATGGCTAGGGG - Intergenic
989677574 5:43989693-43989715 CAATAGCCACTCATGGCTAGTGG - Intergenic
990145908 5:52759982-52760004 TAATAGCCACACATGGCTAGTGG - Intergenic
990170374 5:53041589-53041611 CAGTAGTCACATGTGGCTCGTGG - Intronic
990291697 5:54358504-54358526 CAGTAGCCACATGTGGCTGATGG - Intergenic
990439142 5:55826841-55826863 CAATAGCCACATGTGGCTAGTGG + Intergenic
990952187 5:61309530-61309552 CAGTAGCTACATGTGGCTAGTGG - Intergenic
990968334 5:61474647-61474669 CAGTAGCCACATGTGGCTAGTGG + Intronic
991188268 5:63837007-63837029 AAGTAGCCACATATGGCTGGTGG + Intergenic
991266014 5:64719143-64719165 CAGTAGCCACATGTGACTGGTGG - Exonic
991312920 5:65264705-65264727 CACTAGCCACAGGTAGCTAGTGG + Intronic
991605802 5:68399589-68399611 CAGTAGCCACATATGGCTAAGGG + Intergenic
992126488 5:73647649-73647671 CAGTAGCCACATGTGGCAAGTGG + Intronic
992244543 5:74806629-74806651 CAGTAGTCACATGTGGCTAGTGG - Intronic
992882349 5:81123037-81123059 CAGCAGCCACATGTGGCTAGTGG - Intronic
993326007 5:86537486-86537508 CAATAGACACATATGGCTCGTGG - Intergenic
993520228 5:88890542-88890564 CAATAGCCACATGTGGCTAGTGG + Intronic
994025870 5:95082786-95082808 CAATAGCCACACATGGCTAGTGG + Intronic
995453545 5:112329071-112329093 TAGCAGCCACACATGGCTAGTGG - Intronic
995657849 5:114446993-114447015 CAGTAGACACATGTGGCTAGTGG + Intronic
997338992 5:133127692-133127714 CAATAGCCACATGTGGCTAGTGG - Intergenic
998432652 5:142079730-142079752 CAGTAGCCACAGATGGCAGGTGG - Intergenic
999642675 5:153687630-153687652 CAGTAGCCACATGTGGCTAGTGG + Intronic
1000022423 5:157329780-157329802 CAGTAGGCACATGTGGCTGGTGG + Intronic
1000141982 5:158414198-158414220 AAATAGCCACATATGGCTAGGGG - Intergenic
1000224594 5:159248201-159248223 CAATAGCCACATGTGGCTAGTGG - Intergenic
1000272640 5:159701288-159701310 CAGTATCCACATGTGGCTGGAGG + Intergenic
1000733429 5:164866482-164866504 CAGTAACCACACATGGATAGTGG + Intergenic
1001234693 5:170019759-170019781 CAGTTGCCACAATTGGCTCCCGG + Intronic
1002282019 5:178136577-178136599 CAGTGGCTACAGATGGGTCAAGG + Intronic
1002362507 5:178684011-178684033 TAATCGCCACAGCTGGCTCGTGG - Intergenic
1002631351 5:180581814-180581836 CAAAAGCCACACATGGCTAGAGG - Intergenic
1002966631 6:1972746-1972768 CAGTCGCCGCAGATGCCTGGAGG + Intronic
1003130751 6:3393352-3393374 AAGTAACCACGTATGGCTCGTGG - Intronic
1003442512 6:6156846-6156868 CAAAAGCCTCATATGGCTCGTGG + Intronic
1003484835 6:6566662-6566684 CAATAGCCACATGTGGCTAGTGG - Intergenic
1003689156 6:8335850-8335872 CAATAGCCACATGTGGCTCGTGG + Intergenic
1003829814 6:9995424-9995446 CAATAGCCACATGTGGCTCATGG - Intronic
1004134643 6:12954921-12954943 CAGTAGCCACATGTGGTTAGTGG - Intronic
1004973726 6:20941148-20941170 CATCAGCCACATATGGCTTGTGG + Intronic
1005195544 6:23279381-23279403 CAGTAGCCACCTGTGGCTAGTGG + Intergenic
1005479074 6:26238263-26238285 CAGTAGCCACATATGGTTAGTGG - Intergenic
1005887714 6:30109493-30109515 CAGTAGCCACATGTGGTTGGTGG - Intronic
1005893919 6:30162390-30162412 CAGTAGACACATGTGGCTGGTGG + Intergenic
1006600879 6:35224980-35225002 CAATAGCCACATGTGGCTAGTGG - Intronic
1006706068 6:36022450-36022472 CAACAGCCACATATGGCTAGTGG + Intronic
1006826531 6:36940004-36940026 CAGCAGCCACAGACGGCACATGG - Intergenic
1007343644 6:41209873-41209895 CAGGAGCCACAGAGGTCTCTGGG + Intergenic
1007346653 6:41236321-41236343 CAGGAGCCACAGAGGTCTCTGGG - Intronic
1008068004 6:47071169-47071191 CAGTAGCCACATGTGGCTAATGG - Intergenic
1008089420 6:47278421-47278443 CAGTAGCCGCACATAGCTTGTGG - Intronic
1008874289 6:56308799-56308821 CAGTAGCCTCATGTGGCTAGTGG + Intronic
1009034837 6:58104463-58104485 CAGTAGCCACATGTGGTTTGTGG - Intergenic
1009918093 6:70021814-70021836 TAGTAGCCACATGTGGCTAGTGG + Intronic
1010227022 6:73499599-73499621 CAGTAGCCACATATGACTAGTGG + Intronic
1010890403 6:81302039-81302061 CAGTAGCCACACATGGCTAGTGG + Intergenic
1011133795 6:84077913-84077935 CAGTAACCACACATGGCCAGTGG - Intronic
1011531473 6:88326929-88326951 CAGTAGGTACATATGGCTGGTGG - Intergenic
1012508870 6:99979413-99979435 CAGTAGCCACATGTGGCTAGTGG - Intronic
1013448684 6:110257453-110257475 CAATAGCCATATATGGCTAGTGG + Intronic
1014079653 6:117271394-117271416 CAGTAGCCCCAAGTGGCTAGCGG - Intronic
1015161958 6:130162859-130162881 CAGAAGCCACATGTGGCTAGTGG - Intronic
1015424156 6:133045867-133045889 CACTAGTCACATATGGCTAGTGG - Intergenic
1015464023 6:133527666-133527688 CAATAGCCACATGTGGCTGGTGG + Intronic
1015564700 6:134556886-134556908 CAGTAGCCACATGTGGTTAGTGG - Intergenic
1015573166 6:134643119-134643141 CAGGAGGCACATATGGCTAGTGG - Intergenic
1016710155 6:147161769-147161791 CAATAGCCACAAATTGCTAGTGG - Intergenic
1017033404 6:150244598-150244620 CCATAGCCACAGATGGCTAGTGG - Intronic
1017698610 6:157044734-157044756 AAATAGCCACACATGGCTGGTGG - Intronic
1017794441 6:157830723-157830745 CAGTAGCCACATGTGGCTAATGG + Intronic
1018693612 6:166371061-166371083 CAGTAGCCACCTGTGGCTAGTGG + Intronic
1019289335 7:242731-242753 CAGTGGCCACACATGGCTGTGGG - Intronic
1019417674 7:934788-934810 CACCAGCCACAGATGCTTCGTGG - Intronic
1019971499 7:4544470-4544492 CGGTAGCCACATGTGGCTAGTGG + Intergenic
1020383570 7:7571950-7571972 CAGTAGCTACATGTGGCTAGTGG + Intronic
1021510976 7:21432168-21432190 AAGTAGCCACATGTGGCTAGTGG + Intronic
1022024053 7:26429283-26429305 CAATAGCCACACATAGCTAGTGG + Intergenic
1022180189 7:27911579-27911601 AAGTAGCCACATATGGCTAAGGG + Intronic
1022849606 7:34246627-34246649 CAGTAGCCACATGTGGCCAGTGG + Intergenic
1023002489 7:35824970-35824992 CAGTAGCCACATGTAGCTAGTGG + Intronic
1023256954 7:38322114-38322136 CAATAGCCACAGGTGGCTAGTGG + Intergenic
1023331902 7:39127226-39127248 CAGTAGCCACATGTGGCTTGTGG + Intronic
1023414524 7:39919585-39919607 AAATAGCCACACATGGCTAGTGG + Intergenic
1023426394 7:40041571-40041593 CATTAGCCACATGTGGCTAGTGG + Intronic
1023465416 7:40449053-40449075 CAATAGCCACATGTGGCTAGTGG - Intronic
1023970178 7:44985219-44985241 CAGTAGCCACAGGTGGCCAGTGG - Intergenic
1024190623 7:47003744-47003766 CAGTAGTCATACATGGCTTGAGG - Intergenic
1024553874 7:50586122-50586144 CAGTAGCCACACGTGGCTGGTGG - Intergenic
1024986915 7:55202144-55202166 AAGTAGCCACATGTGGCTAGTGG - Intronic
1024986919 7:55202236-55202258 CAGTAGCCACACGTGGCTAGTGG + Intronic
1026462099 7:70623439-70623461 AAATAGCCACAGGTGGCTAGTGG - Intronic
1026517416 7:71084915-71084937 CAGCAGCCACATGTGGCTGGTGG - Intergenic
1026920844 7:74154146-74154168 AAGTAGCCACATGTGGCTAGAGG - Intergenic
1027542553 7:79486135-79486157 CAATAGCCACACATGGCTAGTGG + Intergenic
1027674114 7:81138391-81138413 CAGTAGCCACATGTGACTAGTGG + Intergenic
1027898085 7:84071198-84071220 CAATAGTCACATATGGCTAGTGG + Intronic
1028420457 7:90627176-90627198 CATTAGCCACATGTGGCTAGTGG + Intronic
1028460837 7:91090398-91090420 CAATAGCCACACGTGGCTAGTGG - Intronic
1028741445 7:94280249-94280271 CAGTAGCCACAAATAGCTACTGG - Intergenic
1028971379 7:96862534-96862556 AAATAGCCACAGGTGGCTAGCGG + Intergenic
1029043249 7:97599604-97599626 CAATAGCCACATATGGCTAGTGG - Intergenic
1029496425 7:100897358-100897380 CAGTGGGCACAGATGGCGAGGGG - Intergenic
1030015351 7:105214095-105214117 CAGTAGTCACATATGGCTGGTGG + Intronic
1030609483 7:111673299-111673321 TAGTAGCCACACATGGCTAGTGG + Intergenic
1030849338 7:114463382-114463404 CAGTAGCCACATGTGGATAGTGG - Intronic
1030858482 7:114591887-114591909 CAATAGCCACATATGGCTAGTGG - Intronic
1031003145 7:116441009-116441031 CAATAGCCACATGTGGCTAGTGG + Intronic
1031017476 7:116591340-116591362 CAGTAGCCACATGTGGCTAGTGG + Intergenic
1031882559 7:127213274-127213296 CAGAAGCCACATATGGCTAGTGG - Intronic
1032203537 7:129841464-129841486 CAGTAGCCACTTATGGCTAGTGG - Intronic
1032344031 7:131103319-131103341 CAATAGCCACAAGTGGCTAGTGG + Intergenic
1032817318 7:135489718-135489740 CAGTAGTCCCATATGGCTAGTGG + Intronic
1032965121 7:137087724-137087746 CAGTAGCCACGTATGGCTAGTGG - Intergenic
1033165672 7:139036420-139036442 CAGCAGCCACATGTGGCTAGTGG - Intergenic
1033295078 7:140125389-140125411 CAGTAGCCACATGTGGCTAATGG - Intronic
1033421189 7:141205958-141205980 CAGTAGCCCCAGGAGGCTGGTGG - Intronic
1033423601 7:141223838-141223860 CAGTAGCCACTTGTGGCTTGTGG - Intronic
1033525501 7:142209812-142209834 CAATAGCCACATGTGGCTAGTGG - Intronic
1033971688 7:147048630-147048652 TAGTAGCCACATATGGTTAGTGG - Intronic
1034000815 7:147410643-147410665 AAATAGCCACATATGGCTAGTGG - Intronic
1034225951 7:149482168-149482190 CAGTAGCTACAGGTGGATAGTGG + Intronic
1034458186 7:151183061-151183083 CGATAGCCACAGGTGGCTAGTGG - Intronic
1034504467 7:151476295-151476317 CAGTAGCCACATGTGGCTGGAGG - Intronic
1034854294 7:154526484-154526506 CAGTAACCACATATAGCTGGTGG - Intronic
1035193188 7:157190494-157190516 CAGTAGCCACATGTGGCCAGGGG + Intronic
1035423599 7:158750873-158750895 CTGGAGCCACAGGTAGCTCGTGG + Intronic
1035475542 7:159141464-159141486 CAGTAGCCACAGGCGGCCAGCGG - Intronic
1037273061 8:17151180-17151202 CAATAGCCACATGTGGCTAGTGG - Intergenic
1037753663 8:21698123-21698145 CTGGAGCCACAGATGCCTCTAGG - Intronic
1038994899 8:32910965-32910987 CAATAGCCACATGTGGCTAGTGG - Intergenic
1039028578 8:33285192-33285214 CAAGAGCCACAGATAGATCGTGG + Intergenic
1039731636 8:40285816-40285838 CAGTAGCCACATCTGGCTAGTGG - Intergenic
1040462887 8:47666250-47666272 CAGTAGCCACATATGGCTAGTGG + Intronic
1041298772 8:56389377-56389399 CAGTAGCCACAGATGACTAGAGG + Intergenic
1041697418 8:60750728-60750750 CAGTGACCACACATGGCTGGTGG + Intronic
1041698597 8:60763364-60763386 CAGTAGCCACACATGGCTGGTGG + Intronic
1042571143 8:70166316-70166338 CACCAGCCACACATGGCTAGTGG + Intronic
1042688091 8:71463173-71463195 CAATAGCCACATGTGGCTAGTGG + Intronic
1042698973 8:71590565-71590587 CAGTAGCCAAATATAGCTAGTGG + Intronic
1042855700 8:73264826-73264848 GAGTAGCCACAGATATCTGGAGG + Intergenic
1043910708 8:85860341-85860363 CAGTAGCCACATGTGTCTGGTGG + Intergenic
1044097927 8:88091763-88091785 AAGTAGCTACACATGGCTAGTGG - Intronic
1044571592 8:93724782-93724804 TAGTAGCCACACATGGCCAGTGG + Intronic
1045127646 8:99110618-99110640 AAATAGCCACATATGGCTGGTGG + Intronic
1045449965 8:102312867-102312889 CAGTAGCCACTTATGGCTAATGG - Intronic
1045818386 8:106304743-106304765 CAGTAGCCACATATGGCTAGTGG + Intronic
1046085209 8:109425795-109425817 CAGTAGCCACATATGACTCATGG - Intronic
1046341072 8:112854942-112854964 CAATAGCCACATATTGCTAGTGG - Intronic
1046359828 8:113136268-113136290 CAATAGGCACATATGGCTAGTGG - Intronic
1046780377 8:118208623-118208645 CAGTAGCCACATGTGGCTAATGG - Intronic
1047000698 8:120569753-120569775 CACTAGCCACAGGTGGCTATTGG + Intronic
1047000708 8:120569843-120569865 AAGTAGCCACATCTGGCTAGTGG + Intronic
1047171222 8:122494847-122494869 CAGTAGCCACCAGTGGCTAGTGG + Intergenic
1047507656 8:125492607-125492629 CAGCAGCCATAGGTGGCTAGTGG + Intergenic
1047634737 8:126748574-126748596 CAGTAGCCACACGTAGCTGGTGG - Intergenic
1048367325 8:133749556-133749578 TAGTAGCCACATGTGGCTGGTGG - Intergenic
1048512345 8:135074310-135074332 CAGTAGCCACATGTGGCCAGTGG + Intergenic
1048552936 8:135450227-135450249 CATTAGCCACATGTGGCTGGTGG - Intergenic
1048892464 8:138959981-138960003 CAATAGCCACATGTGGCTAGTGG - Intergenic
1048998009 8:139806140-139806162 CAGGAGCCACAGCTGCCGCGTGG - Intronic
1049144233 8:140986148-140986170 CATTAGCCACATGTGGCTAGTGG - Intronic
1049396194 8:142402319-142402341 CAGTAGCCACACGTGTCTGGTGG - Intronic
1049905530 9:213658-213680 CAATAGCCACATGTGGCTAGTGG + Exonic
1050039320 9:1472258-1472280 CAGTAGCCATATATGTCTAGTGG + Intergenic
1050267870 9:3909864-3909886 CATTAGTCACACATGGCTAGTGG - Intronic
1051313989 9:15809306-15809328 CAATAGCCACACGTGGCTAGTGG - Intronic
1051951088 9:22633967-22633989 CAATAACTACAGATGGCTAGTGG - Intergenic
1052031884 9:23638137-23638159 CAGTACCCTCAGATAGCTTGTGG - Intergenic
1052106746 9:24527441-24527463 TAGTAGCCACACATGACTAGTGG - Intergenic
1052535080 9:29736101-29736123 CAATAGCCACAGAAGTCTAGTGG + Intergenic
1053284517 9:36841634-36841656 CAGGTGCCACATATGGCTCCAGG - Intronic
1053683356 9:40499525-40499547 AAGGAGCCACAGCTGGATCGGGG + Intergenic
1053732117 9:41068435-41068457 CAGTAGTCACATATGGCTAGTGG + Intergenic
1053933336 9:43127840-43127862 AAGGAGCCACAGCTGGATCGGGG + Intergenic
1054280358 9:63125403-63125425 AAGGAGCCACAGCTGGATCGGGG - Intergenic
1054296460 9:63335023-63335045 AAGGAGCCACAGCTGGATCGGGG + Intergenic
1054394477 9:64639528-64639550 AAGGAGCCACAGCTGGATCGGGG + Intergenic
1054429126 9:65144727-65144749 AAGGAGCCACAGCTGGATCGGGG + Intergenic
1054501257 9:65876808-65876830 AAGGAGCCACAGCTGGATCGGGG - Intergenic
1054696338 9:68363282-68363304 CAGTAGTCACATATGGCTAGTGG - Intronic
1054784131 9:69194577-69194599 CAGTAGCCACATGTGGCTAGTGG + Intronic
1054838686 9:69710165-69710187 CAGTAGTCACATATGGCTAAGGG - Intronic
1054969094 9:71063656-71063678 CAGTAGACAAAGATGGCTGAGGG + Intronic
1055001669 9:71457705-71457727 CAGTAACCATATATGGCTAGTGG + Intergenic
1055139135 9:72855607-72855629 CAATAGTCACATATGGCTAGTGG - Intergenic
1055584109 9:77738665-77738687 CAGTAGCCACATGTAGCTAGTGG - Intronic
1056099772 9:83290207-83290229 CAATAGCCACATGTGGCTGGTGG - Intronic
1056279514 9:85027687-85027709 AAATAGCCACATATGGCTAGTGG + Intergenic
1056402760 9:86244040-86244062 CAGTAACCACATTTGGCTAGTGG - Intronic
1056998403 9:91485078-91485100 AAATAGCCACAGATGGCTGGTGG - Intergenic
1057799732 9:98183200-98183222 CAGTAGCAACAGAGGGTTGGAGG - Intronic
1057859747 9:98630952-98630974 CACTAGCCACACGTGGCTGGTGG + Intronic
1057874404 9:98743037-98743059 CCGTAGCCACAGAGGGCACAGGG + Intronic
1058532447 9:105920098-105920120 CAGTAGGCACACGTGGCTAGTGG + Intergenic
1058888032 9:109337687-109337709 AAATAGCCACAGGTGGCTAGTGG - Intergenic
1058980760 9:110167983-110168005 CAATAGCCACGTATGGCTAGTGG + Intronic
1059245898 9:112849306-112849328 AAATAGCCACATATGGCTAGTGG - Intronic
1059297185 9:113281838-113281860 CAGTAAGCACAGAGGGCTAGAGG - Intronic
1059375918 9:113881614-113881636 CAGCAGCCACATGTGGCTGGTGG + Intronic
1059383233 9:113944884-113944906 CAGTAGCCACAGGGGGCTAGTGG + Intronic
1059767146 9:117394400-117394422 CAATAGCCACATATGGCTAGTGG + Intronic
1060075701 9:120588903-120588925 CAATAGCCACAAGTGGCTAGTGG - Intergenic
1060302378 9:122382633-122382655 CAGTAGCTACACGTGGCTAGTGG + Intronic
1060483468 9:124031813-124031835 CAGCAGCCATACGTGGCTCGTGG + Intronic
1060862824 9:126969454-126969476 CAGTAGCCACATGTGGCTAGTGG + Intronic
1061364404 9:130164124-130164146 CAGTGGCCACATGTGGCTGGGGG + Intergenic
1061743680 9:132724825-132724847 CAATAGCCACCCATGGCTAGTGG + Intergenic
1061963682 9:134001275-134001297 CAGAAGCCACACATGCCTGGTGG + Intergenic
1062379954 9:136282326-136282348 CAGTGGCCACACCTGGCTCCTGG - Intronic
1203522927 Un_GL000213v1:60561-60583 CAATAGCCACATGTGGCTAGTGG - Intergenic
1203572160 Un_KI270744v1:141702-141724 CAGTAGCTACATATGGCAGGTGG + Intergenic
1185851914 X:3497303-3497325 CAGTAGTCCCAAATGGCTAGAGG - Intergenic
1186438374 X:9563683-9563705 CAGTAGCCACATGTGGCCAGTGG + Intronic
1186545996 X:10450111-10450133 CAGTAGCCATATGTGGCTTGTGG - Intronic
1186551414 X:10509655-10509677 CAGTAGCCACAAATCCCTGGAGG - Intronic
1186798639 X:13070842-13070864 CAGTAGCCACATGTGGCTAGTGG - Intergenic
1186846536 X:13536323-13536345 CAGTAGCCACATATGGCTAGTGG + Intergenic
1187094204 X:16129404-16129426 CAGTAGCCACATGTGGCTAGTGG + Intronic
1187142938 X:16611562-16611584 AAGTAGCTACATATGGCTAGTGG - Intronic
1187189024 X:17015180-17015202 CAATAGCCACACATGGCAAGTGG - Intronic
1187683322 X:21791152-21791174 CAATAGCCACACATAGCTAGTGG + Intergenic
1187696357 X:21925304-21925326 CTGTAGCCACATGTGGCTAGAGG - Intergenic
1188335415 X:28926066-28926088 AAGTAGCCACAGGTGGCTAATGG - Intronic
1188483959 X:30662085-30662107 CAGTAGCCACATGTGGCCAGTGG - Intronic
1188605307 X:32021574-32021596 CAATAGCCACAGGTGGCTAATGG - Intronic
1188671917 X:32890737-32890759 CAGTAGCCACATATAACTAGTGG - Intronic
1189123095 X:38415933-38415955 CAATAGCCACATGTGGCTGGTGG + Intronic
1189256461 X:39643533-39643555 CAGTAGCCACATGTGGCTAGTGG + Intergenic
1189281811 X:39824422-39824444 CAGTAGTCACAGGTGGCTAGTGG - Intergenic
1189314785 X:40047256-40047278 CAGTAGCCACATGTGGCTACTGG - Intergenic
1189350764 X:40273881-40273903 CAGTAACCACATGTGGCTGGTGG - Intergenic
1189350771 X:40273968-40273990 AAGTAGCCACATGTGGCTAGTGG + Intergenic
1189508270 X:41635112-41635134 CAGTAACCACAGTTGGCTAGTGG - Intronic
1190096802 X:47487879-47487901 CAGTACCCACATATGGCTAGTGG + Intergenic
1190731650 X:53230454-53230476 CAGTAGCCACATGTGGCTAGTGG + Intergenic
1193114204 X:77760169-77760191 CAATAGCCACAGATAGTTAGTGG + Intronic
1193716232 X:84937501-84937523 CAATAGCCACGCATGGCTAGCGG - Intergenic
1194267659 X:91775393-91775415 CAGTAGCCACATGTGGATAGTGG + Intergenic
1194807544 X:98347955-98347977 CACTAGCCACAAAAGGCTTGTGG + Intergenic
1194807957 X:98353148-98353170 CAATAGCCACATGTGGCTAGTGG - Intergenic
1195020987 X:100828277-100828299 CAGTGGCCACAGGTGACTAGTGG + Intronic
1195043881 X:101038686-101038708 CAGTAACCACATATAGCTAGTGG - Intronic
1195251861 X:103056297-103056319 CAATAGCCAAATATGGCTCATGG + Intergenic
1195597893 X:106713612-106713634 CAGTAGCCACAGATGGCTCGTGG - Intronic
1195652383 X:107298658-107298680 CAATAGCCACATGTGGCTAGTGG + Intergenic
1195762424 X:108261239-108261261 CAATAGCTACATATGGCTAGAGG + Intronic
1195769968 X:108340235-108340257 CAATAGCCATAGATGGCTAGTGG - Intronic
1196011543 X:110893156-110893178 AAATAGCCACACATGGCTAGTGG - Intergenic
1196147626 X:112336680-112336702 CAATAGCCACACGTGGCTAGTGG + Intergenic
1196172343 X:112603551-112603573 AGGTAGCCACTGCTGGCTCGTGG + Intergenic
1196551764 X:117036447-117036469 CAGTAGCCACATGTGGCTAGTGG + Intergenic
1196565584 X:117200512-117200534 CAGTAGCCACACGTGGCTAGTGG - Intergenic
1196624635 X:117864207-117864229 CAGTAGCCACTTGTGGCTAGTGG + Intergenic
1196684797 X:118501543-118501565 CAATAGCCACATGTGGCTAGTGG + Intronic
1196695353 X:118606022-118606044 CAATAGCCACATGTGGCTGGTGG - Intronic
1196754368 X:119145071-119145093 CAGTAGCCACACGTGGCTAGTGG + Intronic
1197142475 X:123131780-123131802 CAGAAGCCAAAGATGGCAAGGGG + Intergenic
1197175672 X:123483564-123483586 CAGTAGTCACACATGGCCAGTGG + Intronic
1197669636 X:129262327-129262349 CAATAGCCACATATAGCTAGTGG + Intergenic
1197791777 X:130262232-130262254 AAGTAGCCACATGTGGCTAGTGG - Intronic
1197804208 X:130383837-130383859 CAGTAGCCACATGTGGCTAGTGG - Intergenic
1197852769 X:130881174-130881196 CAATAGCCACATGTGGCTAGTGG + Intronic
1198061584 X:133050855-133050877 CAGTAACCACATATGGCTTGTGG - Intronic
1198703707 X:139424138-139424160 CAATAGCCACATGTGGCTAGTGG + Intergenic
1200069783 X:153522478-153522500 AGGTAGCCACACATGGCTGGTGG + Intronic
1200584867 Y:4996324-4996346 CAGTAGCCACATGTGGGTAGTGG + Intergenic
1200810917 Y:7483884-7483906 AATTAGCCACAGATGGCTAGAGG - Intergenic
1201701391 Y:16886097-16886119 CTGTAGCCATACATGGCTAGTGG - Intergenic