ID: 1195598621

View in Genome Browser
Species Human (GRCh38)
Location X:106721410-106721432
Sequence TCTCTATAGAGTCGGTGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 80}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195598618_1195598621 22 Left 1195598618 X:106721365-106721387 CCTTGCAAACATATTAAAAGCTG 0: 1
1: 0
2: 1
3: 31
4: 266
Right 1195598621 X:106721410-106721432 TCTCTATAGAGTCGGTGTGATGG 0: 1
1: 0
2: 1
3: 3
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195598621 Original CRISPR TCTCTATAGAGTCGGTGTGA TGG Intronic
901192837 1:7422723-7422745 TGCCTATGGAGTGGGTGTGAGGG - Intronic
905346695 1:37316005-37316027 TCTTTATAGAGTTGTTATGAGGG + Intergenic
907667673 1:56447591-56447613 TCACTAAAGAGTCAGCGTGAAGG - Intergenic
909363815 1:74796785-74796807 TTTCCATAAAGTTGGTGTGATGG + Intergenic
912568028 1:110602660-110602682 TCTCTGCAGTGTCGATGTGAGGG - Exonic
916661492 1:166926024-166926046 TCTTTTTATAGTCGGTGTGGTGG + Intronic
1070060634 10:72980304-72980326 TTTTTATGGAGTTGGTGTGATGG + Intergenic
1072037241 10:91574782-91574804 GCTCTACAGAGTCTGTGTGAAGG - Intergenic
1073799662 10:107027387-107027409 TGTAAATAGAGTCGGTGTCAAGG - Intronic
1075591998 10:123698740-123698762 TCTCCATAGAGGGGGTGTAAAGG + Intergenic
1076276104 10:129200063-129200085 TCTCTTTACAGGCTGTGTGAGGG + Intergenic
1078791645 11:14548837-14548859 TCAGTATAGACTGGGTGTGAGGG - Intronic
1083538672 11:63495441-63495463 TCTCCATAGAGACAGTGTGCAGG - Intergenic
1083869155 11:65476579-65476601 TCTCCTTAGACTGGGTGTGAGGG - Intergenic
1084644531 11:70447492-70447514 TCTCTGGAGTGTGGGTGTGATGG + Intergenic
1085041656 11:73330522-73330544 TCTTTCTAGGGTGGGTGTGAAGG + Intronic
1087043116 11:93820881-93820903 TCTCTATGGAGTGAGGGTGAGGG + Exonic
1089793724 11:120963493-120963515 TCTCTATGGTGTGTGTGTGAAGG - Intronic
1094337863 12:29380973-29380995 TCTCTAGAGAGCCGGTCGGACGG - Intronic
1103934222 12:124466864-124466886 ACTCTAGAGAGCCGTTGTGAAGG + Intronic
1108740444 13:53331884-53331906 TGTCTAAAGAGTCTGGGTGACGG + Intergenic
1115368926 14:32590080-32590102 TATCTATAGGGTTGTTGTGAAGG + Intronic
1125381128 15:39088135-39088157 TGTCTATGGAATGGGTGTGATGG - Intergenic
1128358522 15:66944573-66944595 TGTCTACAGAGTGGATGTGAGGG + Intergenic
1128974945 15:72145135-72145157 TCTCTCTAAAGTAGGAGTGAGGG - Intergenic
1133037728 16:3043749-3043771 TCTCTATAGAGTGAGGGAGAGGG - Intergenic
1134015485 16:10885102-10885124 TCTATATAGAGACATTGTGATGG + Intronic
1137061247 16:35793362-35793384 TCTCGAAAGAGTCTGTGTGCAGG + Intergenic
1141099036 16:81183580-81183602 TCTCTATAATGTCTCTGTGAAGG + Intergenic
1141892462 16:86935499-86935521 TCTCAATAAAGTTGGTGAGAAGG - Intergenic
1142039148 16:87881462-87881484 TCTCTAGAGGGTCGATGGGAAGG + Intergenic
1144414454 17:15033164-15033186 TCTCTAAAGAGGAGGTGTAAGGG + Intergenic
1153576411 18:6526385-6526407 TCTATATAGATTCGGGGTGGGGG - Intronic
1156109356 18:33705303-33705325 TCTATATAAAGTTGGTGGGATGG - Intronic
1163234133 19:16021195-16021217 TTTCTACAGAGTCAGGGTGACGG + Intergenic
1163861117 19:19743363-19743385 TCTCTACAGAGTCAGGGGGATGG + Intergenic
926708753 2:15857875-15857897 TCTTTATAGAGTTGCTTTGAGGG - Intergenic
928158336 2:28896348-28896370 TCTTCATAGAGTGGTTGTGAAGG + Intronic
928925063 2:36569144-36569166 TCTTTATAGAGTTGTTGTGAAGG + Intronic
937151137 2:119686555-119686577 TCCCTGTAGAGTAGGTGTAAAGG - Intergenic
938222992 2:129587670-129587692 TCTTTGTGAAGTCGGTGTGAAGG + Intergenic
938222995 2:129587701-129587723 TCTCCGTGAAGTCGGTGTGAAGG + Intergenic
938985213 2:136568797-136568819 TCTCTACAGATTTGTTGTGAAGG + Intergenic
939182972 2:138825669-138825691 TCTCTATAGAGTTGTTGTGAGGG + Intergenic
944040147 2:195344412-195344434 TCTCTATGCAGTTGCTGTGAAGG - Intergenic
1174711910 20:52715626-52715648 TCTCCAGAGAGTGGCTGTGACGG - Intergenic
1177354854 21:19995328-19995350 ACTCTAAAGGGGCGGTGTGAGGG + Intergenic
951902186 3:27667747-27667769 CCTCTACAGAGTCACTGTGAGGG - Intergenic
955621704 3:60871247-60871269 TCTCTATAGTTTCACTGTGAAGG - Intronic
960829823 3:121834817-121834839 TCTCTACAGAGTGGGCGTGAGGG + Intronic
964832472 3:160899850-160899872 TTTCTAAAGAGTGAGTGTGAAGG + Intronic
965144239 3:164879050-164879072 TCTCTATTGATTCCGAGTGATGG + Intergenic
969698512 4:8750180-8750202 TCTCTTTAGAGTAGGTCTGCTGG - Intergenic
973930375 4:55787381-55787403 TGTCTATAGAGTGGGAGAGATGG + Intergenic
980177787 4:129367550-129367572 TGTCTTTAGAGTTTGTGTGATGG + Intergenic
984354253 4:178637575-178637597 TCTCTTTAGAGTTGGCGGGAAGG - Intergenic
987752768 5:22063385-22063407 TATTTATAGGGTCTGTGTGATGG - Intronic
993872963 5:93273464-93273486 TCTCTATAAAGTGGGCATGACGG + Intergenic
999399407 5:151252989-151253011 TCTCTCTAGCGTAGGTGTCAAGG - Exonic
1000174853 5:158741916-158741938 TCCTTATAGAGTTGTTGTGAAGG - Intronic
1002804579 6:560608-560630 TCTCTAAAGATTTAGTGTGAGGG + Intronic
1010212523 6:73373424-73373446 TGTCTCTACAGTGGGTGTGATGG - Intronic
1017433228 6:154391736-154391758 TCTCTACAGAGCTGGTGTCAAGG - Exonic
1018849699 6:167578122-167578144 TCTCTGCAGAGTCTGTGTGTGGG + Intergenic
1019025000 6:168952537-168952559 TGTCTATAGAGTGGGAGTCATGG - Intergenic
1028558814 7:92150943-92150965 ACTTTATAGAGTGGATGTGATGG + Intronic
1030248766 7:107417155-107417177 TCTTTATAAAGTTGGTGTGTAGG - Intronic
1030946135 7:115723183-115723205 TCTTTATAGACTCGGAGGGAGGG - Intergenic
1034008972 7:147507162-147507184 TCTCTGGAGAGTAGGTCTGAAGG - Intronic
1036445665 8:8819983-8820005 TCTGTATAGACTGGGTGTGGTGG - Intronic
1045798571 8:106075584-106075606 TATCTATAAAATGGGTGTGATGG + Intergenic
1051060924 9:13044039-13044061 TCTCCATAGACTAGGTTTGATGG + Intergenic
1052596254 9:30561958-30561980 TCTCTTTAGAGCAGGTCTGATGG - Intergenic
1055161367 9:73132462-73132484 TCTCTTTTGAGTCTGTGTGCTGG - Intergenic
1055445756 9:76380837-76380859 GCTCTATAGAGTATGTGTGTGGG + Intergenic
1055993685 9:82134382-82134404 TCTCTAAAGGGTCGGGGTGGGGG + Intergenic
1057569383 9:96192768-96192790 TCTCTATAGAGTCAGACTGTTGG - Intergenic
1058548245 9:106084474-106084496 TGTCTATAGATTCTGTATGATGG - Intergenic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1191176907 X:57513719-57513741 TCTGTATAGAGGAGGTCTGAGGG + Intergenic
1193158464 X:78200120-78200142 TATCTATAGAGTGTGTGTGTGGG - Intergenic
1194825591 X:98558888-98558910 TATCTTTAGAGTCAGTGGGAAGG + Intergenic
1195598621 X:106721410-106721432 TCTCTATAGAGTCGGTGTGATGG + Intronic
1198680393 X:139175573-139175595 TCTCTATAAACTAGGTTTGATGG - Intronic
1198929869 X:141843517-141843539 TCTCTAAAGAATACGTGTGAGGG + Intronic