ID: 1195598641

View in Genome Browser
Species Human (GRCh38)
Location X:106721613-106721635
Sequence TATATGGGCCAGGATATATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195598641_1195598644 -8 Left 1195598641 X:106721613-106721635 CCATATATATCCTGGCCCATATA 0: 1
1: 0
2: 0
3: 17
4: 127
Right 1195598644 X:106721628-106721650 CCCATATATATCTCCCTCAATGG 0: 1
1: 0
2: 0
3: 14
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195598641 Original CRISPR TATATGGGCCAGGATATATA TGG (reversed) Intronic
910076665 1:83288458-83288480 TATGTGTGCCAGGATATACATGG - Intergenic
911744296 1:101423040-101423062 TATATATGACAGTATATATATGG + Intergenic
911815917 1:102350687-102350709 TATATTTGCCAGGATATAATTGG - Intergenic
912101825 1:106217312-106217334 TAAATAGGCCCGTATATATATGG + Intergenic
914575155 1:148959684-148959706 TATATGGGACAATTTATATATGG - Intronic
914891616 1:151629421-151629443 TATATGTGCGTGTATATATATGG - Intronic
920630988 1:207651350-207651372 AATATTGGACAGTATATATATGG + Intronic
924452752 1:244193302-244193324 TATATGTACCAGGATGTTTAAGG - Intergenic
1062962219 10:1581122-1581144 TGTATTGGCGAGGATATAGAGGG - Intronic
1064387939 10:14914626-14914648 TTTATGGTCCAGAATATTTACGG - Intronic
1065889632 10:30109973-30109995 TATATGGGCCAGCTGATATATGG + Intronic
1065889729 10:30110659-30110681 TGTATGGGCCAGGTGATGTATGG + Intronic
1069209978 10:65744525-65744547 TCCATGGGCAAGGATATATCCGG + Intergenic
1070090942 10:73284722-73284744 TATATGTGGCAGGTCATATATGG - Intronic
1071000397 10:80824935-80824957 TGTGTGTGACAGGATATATAGGG + Intergenic
1071770242 10:88721485-88721507 TATATGGATCTGGATATAGAAGG - Intergenic
1073325307 10:102641179-102641201 TATATGGTATAGTATATATATGG + Intergenic
1091573254 12:1710184-1710206 GATATGGGCGGGGATAAATAAGG + Intronic
1091644218 12:2261711-2261733 TATATGGGCCAAGCTCTAGAAGG + Intronic
1092032261 12:5297053-5297075 TATAGGGGCCAGGACACAGATGG - Intergenic
1094095492 12:26699696-26699718 TATATGGCCCTGGATTTATTTGG - Intronic
1094209035 12:27870926-27870948 TATATTGTCCAGGATATTGAAGG - Intergenic
1105357873 13:19676170-19676192 TATATGGGTAAGGAAATATATGG - Intronic
1107435721 13:40379113-40379135 TATATATGCCAGTATATAAAAGG - Intergenic
1109559795 13:64031843-64031865 TATTTTGGCCATGCTATATAAGG + Intergenic
1111442526 13:88298552-88298574 TATATGGGCAAAAATATATATGG + Intergenic
1112726477 13:102310582-102310604 TTTCTGGGCCAGGAGATAGAGGG + Intronic
1113375689 13:109763627-109763649 TATTTGGGCCAAGTGATATAAGG + Intronic
1118502284 14:66372955-66372977 TATATGGGAGAGGATTTATTAGG - Intergenic
1123497001 15:20837117-20837139 TATATGACCAAGGATATACAGGG + Intronic
1123554233 15:21410703-21410725 TATATGACCAAGGATATACAGGG + Intronic
1123590480 15:21848072-21848094 TATATGACCAAGGATATACAGGG + Intergenic
1126312298 15:47331323-47331345 TATATATGCAAAGATATATATGG + Intronic
1126400399 15:48262911-48262933 TATATGTGTCAGGATACATAGGG - Intronic
1127909968 15:63408543-63408565 TGTATGGATAAGGATATATAAGG - Intergenic
1129272429 15:74426338-74426360 TCTATGGGCCAGCATCTTTATGG - Intronic
1129618461 15:77120344-77120366 TCTATGGGTTAGGACATATATGG - Intronic
1130046498 15:80449858-80449880 AAGATGGGTCAGGATACATAAGG - Intronic
1202962581 15_KI270727v1_random:137901-137923 TATATGACCAAGGATATACAGGG + Intergenic
1135816930 16:25643263-25643285 TAAATGGGCCTGGATTGATATGG - Intergenic
1135919261 16:26633892-26633914 TATATTGGCCATGATACATCAGG + Intergenic
1138256474 16:55567730-55567752 TATATGGACTTGCATATATATGG + Intronic
1139868267 16:70081491-70081513 CATATTGACCAGGATATATTAGG + Intergenic
1140387066 16:74550359-74550381 CATATTGACCAGGATATATTAGG - Intronic
1143371919 17:6445544-6445566 TATATGTGCCAGGAACTATCTGG - Intronic
1144119681 17:12139174-12139196 GATATGGGCCAAGATAGATGAGG + Intronic
1149515059 17:57274917-57274939 TAAATGAGCCAGTATAAATAAGG + Intronic
1154455019 18:14513497-14513519 TATATGACCAAGGATATACAGGG + Intronic
1155399837 18:25426056-25426078 TTTATGGGCCTGGATTTGTAGGG + Intergenic
1155693514 18:28655252-28655274 TATATAGGCCAGGAAAAAAATGG - Intergenic
1156606617 18:38673787-38673809 TATATGGGTGTGTATATATATGG + Intergenic
1158793617 18:60813620-60813642 TAAATGTGCCAGGTTGTATAAGG + Intergenic
1159307170 18:66658439-66658461 TATTTGGTTCAGGTTATATAAGG + Intergenic
1160020843 18:75179627-75179649 TATATGGACTATTATATATATGG + Intergenic
1160020845 18:75179653-75179675 TATATGGACTAATATATATATGG + Intergenic
1160020853 18:75179765-75179787 TATATGGACTATTATATATATGG + Intergenic
1167728031 19:51232230-51232252 TATATAGGCCAGGATAGAATGGG - Intronic
1167829842 19:52010615-52010637 AATATGTGCAAGGATATTTATGG + Intergenic
1168014384 19:53560341-53560363 TATATGTGTCTGTATATATATGG - Intronic
925068018 2:944326-944348 TCTATTATCCAGGATATATAAGG - Intergenic
926775354 2:16416835-16416857 TTTATGGGCCAGGCCTTATAGGG - Intergenic
931448972 2:62351622-62351644 TCTATGGGCTCTGATATATACGG + Intergenic
936981541 2:118269611-118269633 TCTATGGGTCAGGCTCTATATGG + Intergenic
937785718 2:125895180-125895202 TATATGGGAATAGATATATATGG - Intergenic
937785720 2:125895196-125895218 TATATGGGAATAGATATATATGG - Intergenic
938044586 2:128106499-128106521 TTTATGAGCCAGAATATAAAAGG - Intronic
938602193 2:132853849-132853871 TAGATGGGTCAGGATAATTAGGG - Intronic
939362384 2:141189659-141189681 TTTATGGGACAGCATAAATATGG - Intronic
940624851 2:156161123-156161145 TAGATGGAGCAGGATTTATAAGG + Intergenic
940946180 2:159621117-159621139 ACTATGGGCCAGAATACATAAGG + Intergenic
942262650 2:174184942-174184964 TATATTAGCTAGGATAAATAAGG + Intronic
945237548 2:207645553-207645575 TATATGGGAAAATATATATATGG + Intergenic
945746222 2:213722466-213722488 TATATAGGGCAGGAAATAGAAGG + Intronic
945900033 2:215527074-215527096 TTTATGGGACAGGTTATATGGGG - Intergenic
946470284 2:219953498-219953520 TATATGTGTTAAGATATATAGGG - Intergenic
946735325 2:222748250-222748272 TGTAGGGGACAGGAGATATATGG - Intergenic
948059738 2:235033922-235033944 TATATGTGCCCAGTTATATAGGG + Intronic
1169269628 20:4189040-4189062 TATGTGGGTGAGTATATATAAGG - Intergenic
1170449741 20:16470427-16470449 CATATGGGCCAGGAAGTATATGG + Intronic
1176819144 21:13639801-13639823 TATATGACCAAGGATATACAGGG - Intronic
1177060500 21:16368124-16368146 TATATGTGCAAGGATAAATAGGG + Intergenic
1182905212 22:33929975-33929997 TATGTGGCCCATGATATATTGGG + Intergenic
1182922259 22:34090730-34090752 TGTATGGTTCAGGATATGTAAGG - Intergenic
955475200 3:59329289-59329311 TTTATGGGCCAGGAAACAAAAGG - Intergenic
956757013 3:72398603-72398625 GATATGGGTCAGGACATATCAGG + Intronic
959400653 3:105898042-105898064 TATATGGGCAAGTTTATACAAGG + Intergenic
961803805 3:129474171-129474193 TAAATGGGACTGGATATTTAAGG + Intronic
962940172 3:140118356-140118378 TATCTGGGCAAGGAGAAATATGG + Intronic
964844470 3:161030714-161030736 TCTATGGGGAAGGAGATATATGG - Intronic
965245325 3:166259034-166259056 TATCATGGCCAGGATATATGAGG + Intergenic
967977527 3:195043885-195043907 TACATGGGCAAGGATATCTAGGG + Intergenic
971534918 4:27736589-27736611 TATAAGGACCAGGAAATAAATGG + Intergenic
971753472 4:30679449-30679471 CAGATAGGCCAGGAAATATAGGG + Intergenic
971863762 4:32142365-32142387 TATAGGTGCCAGGATAAATTTGG + Intergenic
972762604 4:42121815-42121837 TCCATGGGCCAGGGTATGTACGG + Intronic
978414991 4:108465365-108465387 TATGTGGCCCAGGGTATAAAGGG - Intergenic
978941293 4:114438767-114438789 TATATGTACCAGCATATATGTGG - Intergenic
980257107 4:130396025-130396047 TATTTTGGCCATGATATATCCGG + Intergenic
981955452 4:150466992-150467014 TATCTGGGCCAGAAAATGTAAGG + Intronic
982814353 4:159867741-159867763 TAAATGGGACTGTATATATATGG - Intergenic
984993807 4:185408410-185408432 TATGTGGTCCAGGGCATATATGG - Exonic
987288506 5:16485101-16485123 TATATGGCAAAGGAAATATAAGG + Intronic
987498521 5:18674746-18674768 TATATGGTCAAGAATGTATATGG + Intergenic
992984827 5:82217485-82217507 TATATATGACAGGATATATAAGG - Intronic
993679093 5:90852846-90852868 AACATGGGCCTGGATATATAAGG + Intronic
998591897 5:143487377-143487399 TATGTGGGCCAGGATATCTGGGG + Intergenic
998861701 5:146450418-146450440 AATGTGGGCCAGGTTATACAGGG + Intronic
1003652169 6:7970818-7970840 AATAGTTGCCAGGATATATAGGG + Intronic
1004802595 6:19167004-19167026 CATTTGGGCTGGGATATATAGGG + Intergenic
1006066957 6:31468925-31468947 TAAATGTGCCAGGATTTATTAGG + Intergenic
1006819234 6:36877905-36877927 TATTCTGTCCAGGATATATAAGG - Intronic
1008170477 6:48199432-48199454 TATATAAGATAGGATATATAGGG - Intergenic
1011703595 6:89979332-89979354 TGTGTTGGCCTGGATATATAGGG + Intronic
1012099955 6:95070800-95070822 TATATGGGAAAATATATATATGG - Intergenic
1012111968 6:95246217-95246239 GATATGGGACAAGATATTTATGG + Intergenic
1015097757 6:129436320-129436342 TATATGTGTCAGCATATATATGG + Intronic
1015841093 6:137478164-137478186 CATATCAGTCAGGATATATAAGG + Intergenic
1016505805 6:144777747-144777769 CATATGAGCCAGGCTATAAAAGG + Intronic
1021793097 7:24226027-24226049 TATATGTACCATGGTATATATGG + Intergenic
1027174443 7:75894244-75894266 TGTGTGGGCCAGGACATCTAAGG + Intergenic
1027294429 7:76753631-76753653 TATGTGTGCCAGGATATACATGG - Intergenic
1031324057 7:120369980-120370002 CATAGGGGCCAGAGTATATATGG + Intronic
1039033495 8:33333921-33333943 TACTGGGGCCAGGTTATATAGGG + Intergenic
1039384572 8:37122136-37122158 GATATGTGCAAGGATACATATGG + Intergenic
1044685993 8:94826066-94826088 TTTATGGGCAAAGATATTTAAGG - Intronic
1045522829 8:102917980-102918002 CATATGTGCCAGGATATCTGTGG - Intronic
1045988816 8:108282114-108282136 GACATGGGCCAGCATATAAAAGG + Intronic
1050541027 9:6670207-6670229 TATATGCACCAGAATATATTAGG - Intergenic
1053150077 9:35737697-35737719 TTTCTGGGCCAGGATACAGATGG + Intronic
1053336718 9:37280471-37280493 TTTATGGTCCACCATATATATGG - Intronic
1060058638 9:120438866-120438888 TTTATGGGCATAGATATATACGG - Intronic
1203528213 Un_GL000213v1:109759-109781 TATATGACCAAGGATATACAGGG + Intergenic
1185775510 X:2799994-2800016 TATATGGGCCACATTGTATATGG + Intronic
1186546958 X:10460004-10460026 TATTTGGGCCTGGATATACAGGG - Intronic
1189469514 X:41302791-41302813 TATATGGGGAAGGATGTATGTGG - Intergenic
1190628265 X:52358734-52358756 TATATGTTCCATGATATAAAAGG - Intergenic
1190854877 X:54284163-54284185 TGTATAATCCAGGATATATAAGG + Intronic
1191898675 X:66019472-66019494 TAGCTGGTCCAGGAAATATAGGG - Intergenic
1193652387 X:84153308-84153330 TATTTGGCACATGATATATAAGG + Intronic
1194209565 X:91055070-91055092 AATATGGCCCTGGATATATATGG + Intergenic
1195598641 X:106721613-106721635 TATATGGGCCAGGATATATATGG - Intronic
1196900132 X:120374479-120374501 TATATATACCAGGATATATAAGG + Intronic
1196900164 X:120374886-120374908 TATATATACCAGGATATATAAGG - Intronic
1197090689 X:122532771-122532793 TTTAATAGCCAGGATATATAAGG + Intergenic
1197274637 X:124464011-124464033 TATATGGGCTAAGATAAATGAGG + Intronic