ID: 1195598704

View in Genome Browser
Species Human (GRCh38)
Location X:106722131-106722153
Sequence GTTTGGAAGAGGAGGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 770
Summary {0: 1, 1: 2, 2: 2, 3: 61, 4: 704}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195598691_1195598704 10 Left 1195598691 X:106722098-106722120 CCAGGGAGTAGCATGGAAACTCT 0: 1
1: 0
2: 1
3: 13
4: 103
Right 1195598704 X:106722131-106722153 GTTTGGAAGAGGAGGGTGGAAGG 0: 1
1: 2
2: 2
3: 61
4: 704

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195598704 Original CRISPR GTTTGGAAGAGGAGGGTGGA AGG Intronic
900055883 1:630372-630394 CCTAGGGAGAGGAGGGTGGATGG - Intergenic
900457611 1:2785132-2785154 CTTTGGGAGAGGAGGGTGAGGGG + Intronic
900650202 1:3726694-3726716 GGTTGGATGGGGTGGGTGGATGG + Intronic
900657218 1:3764520-3764542 GATACGAGGAGGAGGGTGGATGG - Intronic
900819353 1:4874228-4874250 GGTTGGATGAGGTGGGTGCAAGG + Intergenic
901053547 1:6437922-6437944 GTTGGGAACAAGAGGGTGGGTGG + Intronic
901501926 1:9657765-9657787 GTTGGGCAGAGGTGGGGGGAGGG + Intronic
901636067 1:10670762-10670784 GTGAGGTAGAGGAGGGAGGAGGG - Intronic
901768374 1:11518119-11518141 GTTGGGAAGATGGAGGTGGATGG + Intronic
902044114 1:13512847-13512869 GTTTGGAAGAGGAGGCTTGGGGG - Intronic
902480728 1:16710222-16710244 GTTGGGAACAAGAGGGTGGGTGG - Intergenic
902652261 1:17844559-17844581 GCTGGGAGGAGGAGGGAGGAGGG + Intergenic
903131215 1:21280579-21280601 TTTGGGAAGGGCAGGGTGGAGGG + Intronic
903208245 1:21799166-21799188 GTTTGGAAGACCAAGGTGGGTGG - Intergenic
903380835 1:22895961-22895983 CTTAGGAGGAGGAGGGGGGAGGG + Intronic
903805060 1:25999383-25999405 GGCTGCAAGAGTAGGGTGGAGGG - Intergenic
903814469 1:26054592-26054614 GCTTGGGAGAGGAGCGGGGAAGG - Intronic
904909298 1:33922094-33922116 GTGGGGAAGAGCAGGGAGGAAGG - Intronic
905362814 1:37431962-37431984 GTTTGGGAGTGGAGGTTGGCTGG - Intergenic
905399741 1:37692610-37692632 GTAGGGACGAGGAGGGCGGACGG - Exonic
905941658 1:41867923-41867945 TTTTGGAAGGGGAGGGGGGAGGG - Intronic
906197381 1:43937280-43937302 GTTGGGAAGAAGAGGCTGGATGG + Intergenic
907295210 1:53447070-53447092 GATTGGTAGAGGAAAGTGGAGGG - Intergenic
907944609 1:59123869-59123891 GTTTGGAAAAGGAGGCTCTAGGG + Intergenic
908415789 1:63912041-63912063 CTTTGGAAGACCAAGGTGGAAGG + Intronic
908673076 1:66570295-66570317 GTTTGGAAGTGGGGTGTAGAGGG + Intronic
910304108 1:85741958-85741980 GTTTGCCAGAGGAGGAGGGAGGG - Intronic
910772454 1:90843887-90843909 GTCTAGATGAGGATGGTGGAAGG - Intergenic
910806340 1:91192676-91192698 GTGCAGAAGAGGATGGTGGAGGG + Intergenic
910852902 1:91666103-91666125 GTTGGGAGAAGGAGGCTGGATGG + Intergenic
911223279 1:95275219-95275241 GTTTGGAAGGGGAGGGGAAAGGG + Intergenic
911344622 1:96681526-96681548 GTGAGGAAGAGGAGGAAGGAAGG - Intergenic
912631505 1:111250164-111250186 GTGTGGAATGTGAGGGTGGAGGG + Intergenic
912725811 1:112058012-112058034 GGCTGGAAGATCAGGGTGGAGGG - Intergenic
912884208 1:113451913-113451935 GTTAGGTAAATGAGGGTGGATGG + Intronic
913088275 1:115458828-115458850 TATTGGAGCAGGAGGGTGGATGG - Intergenic
913962586 1:143351876-143351898 GGTAGGAAGAGGAGGGGAGAAGG + Intergenic
914056941 1:144177461-144177483 GGTAGGAAGAGGAGGGGAGAAGG + Intergenic
914122205 1:144788905-144788927 GGTAGGAAGAGGAGGGGAGAAGG - Intergenic
914258466 1:145979295-145979317 GTCTGGAAGAGGAGGGAGTATGG - Intergenic
914334084 1:146699423-146699445 GATTGGAAGAGGAGGGTGGAAGG + Intergenic
914718061 1:150267857-150267879 GTTTGGAAGAGGAGGCACTAAGG - Intronic
914992493 1:152510977-152510999 TTCTGGAAGGGGAGGGTGGAAGG + Exonic
915042089 1:152977114-152977136 GATTGGCAGAGGAGGATGGAAGG + Intergenic
915943431 1:160133480-160133502 GTTGGGATGGGGAGGGTGGCTGG - Intronic
915955444 1:160216886-160216908 GCTGGGAAGAGGTGGGAGGAGGG - Exonic
916070685 1:161168007-161168029 GTTTGGAGAAGGGGGGTGAAGGG - Exonic
916600941 1:166292966-166292988 GTCTGGAGGAGGAGTGTTGAAGG + Intergenic
917284472 1:173410019-173410041 ATTTGGAAGGCCAGGGTGGATGG + Intergenic
917392358 1:174552314-174552336 GGGTGGAGGCGGAGGGTGGAAGG - Intronic
917471604 1:175330536-175330558 GTTTGGCAGAGGAGGTGAGAGGG - Intronic
918469910 1:184861515-184861537 GGGGGGAAGAGGAGGGAGGAAGG + Intronic
918855337 1:189747470-189747492 GTTGGGGAGGGGAGGGGGGAGGG + Intergenic
918938224 1:190952902-190952924 GTTTGAGAGTGGAGGGTTGAAGG + Intergenic
919982043 1:202647826-202647848 ATTTGGAGGGGGAGGGAGGAGGG - Intronic
920508680 1:206534917-206534939 GTTTGGATGAGGAAGGAGGGAGG - Intronic
920655003 1:207868512-207868534 GTGTGGAGGAGGAGGCGGGAAGG - Intergenic
920668823 1:207987330-207987352 GGGTGGAAGAGGAGGGTGTCAGG - Intergenic
920840562 1:209550365-209550387 GTGGGGAAGAGGGGGCTGGAAGG - Intergenic
921308110 1:213817195-213817217 GTTTGGAAGACTAAGCTGGAGGG - Intergenic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
922108675 1:222535711-222535733 GTTTAGAAGAGGAAGGTAGGGGG - Intronic
922374740 1:224951267-224951289 CTTTGGAAGACCAAGGTGGATGG - Intronic
922433606 1:225581431-225581453 GAGTGGGAGTGGAGGGTGGAGGG + Intronic
923226019 1:231939660-231939682 GCTTGGAAGAAGAGGGAGGATGG - Intronic
923406533 1:233666666-233666688 GTCAGGAACAGGAGGGTGAAGGG - Exonic
924268612 1:242308934-242308956 GTGTGGGAGGGGAGGATGGAAGG + Intronic
924659430 1:246002856-246002878 CTTTGGGAGAGGGAGGTGGAAGG - Intronic
1063126744 10:3142612-3142634 GTTCGGAAGAAGGGGCTGGAGGG + Intronic
1063387045 10:5622344-5622366 GTTGGGAAGAGTAGGCTGCAGGG + Intergenic
1063401625 10:5751993-5752015 GTTGGGAGGAGGATGGGGGAGGG - Intronic
1064668280 10:17680648-17680670 CTTTGGGAGATGAAGGTGGAAGG - Intronic
1064863115 10:19848810-19848832 TTTTGGAAGGGGAGGATGGCAGG + Intronic
1065508737 10:26456403-26456425 GTCTGAAAGATGAGGTTGGAGGG + Intronic
1066716293 10:38289834-38289856 GTGTGGGAGGGGAGGATGGAAGG - Intergenic
1067214564 10:44291890-44291912 TTTTCAGAGAGGAGGGTGGAAGG - Intergenic
1068665276 10:59668367-59668389 GGTTGGAAGGGGAGTGGGGATGG - Intronic
1069640762 10:69954108-69954130 GGATGGAGGAGGAGTGTGGAGGG - Intronic
1070039707 10:72763907-72763929 GTGTGGAAGGGGAGTGTGAAGGG - Intronic
1070098811 10:73365625-73365647 GCTGGGAAGAGGAGGGAAGAGGG + Intergenic
1070386265 10:75927467-75927489 GTTGGGAAGAGTGGGCTGGAAGG - Intronic
1070399585 10:76041667-76041689 GTTTGGAGCATGAGGGAGGAGGG - Intronic
1070707187 10:78648241-78648263 GTTAGGAACAGGAAGGTGGAAGG - Intergenic
1070716726 10:78727850-78727872 GTTTGGAGGGGGAGGGTGGGTGG - Intergenic
1071091566 10:81924878-81924900 GTTTTGAGGATGAGGGAGGAGGG + Intronic
1071502531 10:86213873-86213895 GTTAGGAACTGGTGGGTGGATGG - Intronic
1071601188 10:86959451-86959473 GTCTGGAAGAAGTGGATGGATGG - Intronic
1071671548 10:87613622-87613644 GTTGGGAAGCTGAGGCTGGAGGG + Intergenic
1071734066 10:88278688-88278710 TTTTGGAAGAGGTTGGGGGAAGG - Intronic
1072093446 10:92152495-92152517 GTTTAAAAGGGGAAGGTGGAAGG - Intronic
1072334860 10:94388941-94388963 GTTGGGAAACGGAGGCTGGATGG - Intergenic
1072683410 10:97522807-97522829 GCTTGGAAGAGGGGTCTGGAGGG + Intronic
1073104955 10:101027257-101027279 GTGAGGGAGGGGAGGGTGGAGGG - Intronic
1073105297 10:101029459-101029481 GTTCAGAAGAGGAGGGTTGAGGG - Intronic
1073267141 10:102234568-102234590 GCTGGGAAGATGAGGGAGGAAGG + Intronic
1073491139 10:103854473-103854495 GTTTGGGGGAGGAAGGGGGAGGG + Intronic
1073545016 10:104340368-104340390 GTTTGGAGGAGGAGGTGGGGTGG - Intergenic
1073597693 10:104817343-104817365 GGGTGGAAGAGGGGGGAGGAGGG - Intronic
1073634837 10:105187205-105187227 GGGGGGAAGAGGTGGGTGGAAGG - Intronic
1073734522 10:106330558-106330580 TTTTGGGAGGGGAAGGTGGATGG + Intergenic
1074228794 10:111513411-111513433 GTAGGGAAGAGGGGGGTGGCAGG + Intergenic
1074394937 10:113089737-113089759 GTTTACAAGGAGAGGGTGGAGGG + Intronic
1075079885 10:119376232-119376254 ATTTGGAAGAGGAAGGTGACTGG - Intronic
1075107758 10:119553209-119553231 GCCTGGGAGAGGAGGGTGAAAGG + Intergenic
1075448692 10:122531942-122531964 GTTGGCAAGAGGGGGGAGGAAGG + Intergenic
1075786060 10:125050941-125050963 ATCTGGATGAGGAGGGTGGATGG + Intronic
1076166232 10:128284885-128284907 GCTTGACAGAGGAGGGTGCAGGG + Intergenic
1076445787 10:130512856-130512878 GTTGGGAAGAGGAGGCAGGTGGG + Intergenic
1076795253 10:132795128-132795150 GGCTGGAAGAGGAGGCTGGGGGG - Intergenic
1076996679 11:300461-300483 GCTTGGCAGAGGAGGTTGGGAGG - Intergenic
1078430104 11:11281813-11281835 GGTTGGGGGAGGCGGGTGGATGG + Intronic
1078634367 11:13035120-13035142 ATTTGGAAAAGGAGAGGGGATGG + Intergenic
1079368654 11:19831292-19831314 ATTTGGAAGAACAGGATGGAGGG + Intronic
1080117362 11:28636051-28636073 GTTTGGAAAAGGTTGATGGATGG + Intergenic
1080749282 11:35138149-35138171 GTGGAGAAGAGGATGGTGGATGG + Intergenic
1081110910 11:39132059-39132081 GTTTTAAAGGGGATGGTGGAAGG - Intergenic
1081489177 11:43554135-43554157 GTTGGGTTGAGGAGGGAGGAGGG + Intergenic
1081641102 11:44755139-44755161 GGTGGGATGAGGAGGGTGGAAGG - Intronic
1081716798 11:45256232-45256254 GTGGAGAAGAGGAGGGAGGAAGG - Intronic
1083111258 11:60410100-60410122 GTTTGGAAGGCCAAGGTGGAAGG - Intronic
1083209832 11:61176386-61176408 GTTTTGAAGGGAAGGGAGGAGGG - Intergenic
1083719071 11:64595203-64595225 GTTTGGAATAGATGGATGGATGG + Intronic
1083719119 11:64595417-64595439 GTTTGGAATAGATGGATGGATGG + Intronic
1083719128 11:64595466-64595488 GTTTGGAATAGATGGATGGATGG + Intronic
1084149112 11:67279915-67279937 GTGTGGGAGAGGAAGGGGGAGGG + Intronic
1084208855 11:67611691-67611713 AGGTGGAAGAGGAGGGAGGAAGG + Intronic
1084726250 11:70944277-70944299 GGTGGGCACAGGAGGGTGGATGG - Intronic
1084803592 11:71564017-71564039 GCTAGAAAGAGGAGGGTGGCTGG + Intronic
1084854163 11:71970415-71970437 CTTTGGAAGACTAAGGTGGAAGG + Intronic
1084972643 11:72780264-72780286 GTTGGGAAGAGCAGGGGAGATGG + Intronic
1084987701 11:72891173-72891195 CTTTGGAAGACCAGGGTGGGAGG - Intronic
1085079880 11:73625303-73625325 GTTTGGATGGGGAGTGGGGAGGG - Intergenic
1085129554 11:74026401-74026423 GGTTGGAAGAGGATGGGGAAAGG + Intronic
1085297736 11:75440356-75440378 CTATGGGAGAGGAGGGTGAAGGG - Intronic
1085306306 11:75488020-75488042 GAATGGAAGGGGAGGCTGGATGG - Intronic
1085716367 11:78877265-78877287 GGGAGGAAGAGCAGGGTGGAAGG - Intronic
1085822443 11:79807064-79807086 GGTTGGAGGAGCAGGGAGGACGG + Intergenic
1085990970 11:81843873-81843895 GCTTGGAAGAGTAGTGTGGAAGG + Intergenic
1086855440 11:91860106-91860128 ATGTGGAAGAGGAAAGTGGAGGG - Intergenic
1087437335 11:98138236-98138258 GTTTAGCAGAGGAGAGTGGTTGG - Intergenic
1088072692 11:105809895-105809917 GCTTGGAAGAGTAGTGAGGAGGG - Intronic
1088098982 11:106132914-106132936 ATGTGGAAAAGGAAGGTGGAAGG + Intergenic
1088821636 11:113461984-113462006 GTTTGGAGGAAGAGAGGGGAAGG - Intronic
1089098937 11:115944202-115944224 GTTTGGAAAAGGATGTTGGAGGG + Intergenic
1089379079 11:118014832-118014854 GTCTGGAGGAGTAGGGTGGCTGG + Intergenic
1089400731 11:118162939-118162961 GGTTGGAAGGGGTGGTTGGAAGG - Exonic
1090070254 11:123538161-123538183 GATGTGAAGAGGAGGTTGGATGG - Intronic
1090273762 11:125405493-125405515 TTTTGGAAGTGGGGGGTGCAGGG - Intronic
1091590542 12:1840433-1840455 ATGTGGAAGAGGGGGGTGGGTGG + Intronic
1092305126 12:7292492-7292514 GTTTGGAAGAGGGGCCTGGTGGG - Intergenic
1093228194 12:16511394-16511416 GTATTGAAGAGGAGGCTAGATGG - Intronic
1093462745 12:19421099-19421121 CTTTGGAAGACCAAGGTGGAAGG + Intronic
1093938512 12:25027205-25027227 GTTGGGGAGAGGACGGTGGGTGG - Intronic
1095578447 12:43766352-43766374 GGTTGGAGTAGGAGGTTGGAAGG - Intronic
1095726996 12:45464804-45464826 GTAAGTAAAAGGAGGGTGGATGG - Intergenic
1095960339 12:47830499-47830521 TTTTGGAAGAGGAAAGAGGAAGG - Intronic
1096745018 12:53721176-53721198 ATTTGGAAGAAGAGAATGGATGG - Intronic
1096918794 12:55061621-55061643 TTTAGGAAGAGAAGGGAGGAGGG - Intergenic
1097755339 12:63401298-63401320 GTCTGAGAGAAGAGGGTGGATGG - Intergenic
1097939452 12:65287741-65287763 GCCAGGAAGAGGAGGGTTGAGGG + Intronic
1098384956 12:69908910-69908932 TTTTGAAGGTGGAGGGTGGAGGG - Intronic
1099248045 12:80217299-80217321 GATGGGAAGGGGAGGGAGGATGG + Intronic
1099443393 12:82725199-82725221 GTTTGGAAGTGGAGGGTTAGGGG + Intronic
1099924727 12:89003492-89003514 ATTTGGGGGAGGAGGGTGGTAGG + Intergenic
1100114743 12:91290874-91290896 ATTTGAAGGTGGAGGGTGGAAGG - Intergenic
1100143837 12:91653085-91653107 TTTTGTAAGAGCAAGGTGGAAGG - Intergenic
1101201043 12:102436602-102436624 TTGTGGCAAAGGAGGGTGGAAGG + Intronic
1101660903 12:106764825-106764847 ATCTGGATGAGGAGGATGGACGG + Intronic
1101661092 12:106766264-106766286 GTTTAGAACTTGAGGGTGGAAGG - Intronic
1103037957 12:117671786-117671808 GTTTGGGGGAGGTGGGTGGGAGG - Intronic
1103960421 12:124605942-124605964 GTAGGGAAGAGGAGGGAAGAGGG - Intergenic
1104774816 12:131384872-131384894 GCTTGGACGAGGAGGGAAGAGGG - Intergenic
1105208147 13:18240337-18240359 GTTTGGAAGTTCAGAGTGGAAGG + Intergenic
1105338058 13:19493302-19493324 GTGTTGAAGAGAAGTGTGGATGG + Intronic
1105871971 13:24513023-24513045 CTTTGAGAGAGGTGGGTGGATGG + Intergenic
1105917639 13:24931859-24931881 CTTTGGGAGAGGTGGGTGGATGG - Intergenic
1105978358 13:25493800-25493822 GTCAGGAAAAGGAGTGTGGAGGG + Intronic
1106111417 13:26780878-26780900 GTGTGGAATTGGAGGGTGGCAGG + Intergenic
1106304863 13:28500652-28500674 GAGGGGAAGAGGAGGGTGCAGGG + Intergenic
1106774492 13:32995456-32995478 TTTTGGTAGAGGAGGGGAGATGG - Intergenic
1107630011 13:42333700-42333722 GATTGGAGGAGGAGAGTGCAGGG + Intergenic
1107830107 13:44367589-44367611 CTTGGGAAGAGGGGGGTGGGAGG - Intergenic
1108717839 13:53099455-53099477 GTCTGGAAGAGGATGTTGGAGGG + Intergenic
1108942282 13:55971640-55971662 CCTAGGGAGAGGAGGGTGGATGG + Intergenic
1109305093 13:60630204-60630226 GTTTGGAAGATGATGGTCAAAGG - Intergenic
1110329185 13:74251611-74251633 GGTAGGAAGATGAGGGAGGATGG - Intergenic
1110333566 13:74300481-74300503 GTGTGGTAGGGGTGGGTGGATGG + Intergenic
1110556533 13:76866023-76866045 GCTGGGAAGGGGAGGGTGGAGGG - Intergenic
1110653654 13:77972077-77972099 GTTGGGAAGCGGAAGCTGGATGG + Intergenic
1112025257 13:95405743-95405765 ATTTGGAAAAAGAGGCTGGAAGG + Intergenic
1112065736 13:95790783-95790805 TTTGGGCAGAGGAGGGTGGGTGG - Intronic
1112317799 13:98379954-98379976 GTTTGGAAAAGGAGGGTTGCAGG - Intronic
1112926433 13:104680441-104680463 CCTTGGAAGAGGAAAGTGGAAGG - Intergenic
1113662746 13:112118236-112118258 GTGTGGTAGAGGAGAGAGGACGG + Intergenic
1113954344 13:114089240-114089262 GTTCGGAGGAGGAGAGAGGAGGG + Intronic
1114517606 14:23309820-23309842 GAGTGGGAGAGGAGGGTGGCAGG - Exonic
1114561002 14:23590407-23590429 CTTTGGGAGATGAAGGTGGAAGG + Intergenic
1114829710 14:26125919-26125941 GTTTGGAAGAGGACGGAAGGAGG + Intergenic
1114847729 14:26344007-26344029 GGTTTGAAGAGGGAGGTGGAAGG + Intergenic
1115181776 14:30635421-30635443 GGATGGAAGAGGATGGGGGAGGG - Intronic
1115196234 14:30803011-30803033 CTATGGAAGAGGAAGGTGGGAGG - Intergenic
1115452709 14:33566451-33566473 ATTTGGAAGGGTGGGGTGGAAGG - Intronic
1115879499 14:37899265-37899287 GTTTGCAAGAGGAAGGGGGCTGG + Intronic
1115884631 14:37957779-37957801 GTTGGGAATAGGATGATGGAAGG + Intronic
1115886324 14:37975614-37975636 GTTAGGGAGGGAAGGGTGGAAGG + Intronic
1116109421 14:40558249-40558271 GTGAAGAAAAGGAGGGTGGAAGG - Intergenic
1117349305 14:54865677-54865699 GTATGGAAGAGGAAGGAGAACGG + Intronic
1117558622 14:56912077-56912099 GTTAGGAACAGGAAGGAGGAAGG - Intergenic
1117831136 14:59752070-59752092 GTGTGGATGTGGAGGTTGGAAGG - Intronic
1118762873 14:68891146-68891168 GTCTAGAAGGGGAGGGTGAAAGG - Intronic
1118882467 14:69841240-69841262 GGTAGGAAGTGGAGGGTGAAGGG - Intergenic
1121450534 14:94004387-94004409 GTTTGGAAGACGAGGCTTGGGGG + Intergenic
1122091416 14:99343420-99343442 GGTGGGAAGAGGTGGGAGGAGGG - Intergenic
1122854362 14:104553051-104553073 GTTTGGCAGAGATGAGTGGAGGG - Intronic
1122943344 14:104993367-104993389 GTGTGGATGACGAGGCTGGAAGG + Intronic
1122961316 14:105094723-105094745 GCATGGAAGATGAGGCTGGAGGG + Intergenic
1123148947 14:106163145-106163167 GTGTGAGAGAGGAGGGAGGAAGG + Intergenic
1125358719 15:38843605-38843627 GTTTGGAAAAGGATGGTAGTGGG + Intergenic
1125637979 15:41205259-41205281 CATTGGAACAGGAGGGTAGAGGG + Intronic
1126098618 15:45106495-45106517 GCTGGGCAGAGGAGGGAGGAGGG - Intronic
1126356689 15:47803534-47803556 ATTTGGAATAGAAGGGAGGAAGG + Intergenic
1126634085 15:50765277-50765299 GTGGAAAAGAGGAGGGTGGAAGG + Intronic
1126675323 15:51155592-51155614 GCCGGGAAGAGCAGGGTGGAGGG + Intergenic
1127130322 15:55855557-55855579 GTTAGGAAGAGGATGGAGGCAGG + Intronic
1127647373 15:60971980-60972002 GAATGGGAGAGGAGAGTGGATGG + Intronic
1127732972 15:61817142-61817164 GTTGGGAAGAGGAGGTTCGGGGG - Intergenic
1128220312 15:65964227-65964249 CTTTGGAAGTGGGGGGTGGAGGG + Intronic
1128783357 15:70377414-70377436 GGTTGGAGGAGGAAGGTGGAGGG - Intergenic
1129115366 15:73362657-73362679 GCATGGGAGAGAAGGGTGGATGG + Intronic
1129405035 15:75311316-75311338 GTTTGGAGCAGAAGGATGGAGGG - Intergenic
1129879860 15:78999362-78999384 AGCTGGAAGAGGAGGGTGCAGGG + Intronic
1131229166 15:90647470-90647492 GTGTGGAGGAGGAGGGGTGAGGG - Intergenic
1131668816 15:94597893-94597915 TTGTGGAAGTGGTGGGTGGATGG - Intergenic
1131869568 15:96747956-96747978 GTTTGGAAGCTGAGGGTGTTTGG - Intergenic
1131920976 15:97328299-97328321 GATAGGAAGAGGAAAGTGGAAGG + Intergenic
1132266655 15:100478928-100478950 ATTTGAAGGAGGAGGGTGTATGG + Intronic
1132873566 16:2125988-2126010 GGTAGGAAGAGGATGGTGGGGGG + Intronic
1132999123 16:2840423-2840445 GTTGAGAAGAGCAGGGTGGGTGG - Intergenic
1133302812 16:4793169-4793191 GCCTGGAAGCAGAGGGTGGAGGG + Intronic
1134739377 16:16529180-16529202 GGTTGGAGGAGGAGCGTTGATGG + Intergenic
1134928123 16:18182971-18182993 GGTTGGAGGAGGAGCGTTGATGG - Intergenic
1135166825 16:20146486-20146508 GTATGGAAGGGGAGGAAGGAGGG + Intergenic
1135275783 16:21111411-21111433 GGTTGGAGTAGGCGGGTGGAGGG - Intronic
1135948587 16:26889837-26889859 CTCAGAAAGAGGAGGGTGGAAGG - Intergenic
1135995104 16:27241681-27241703 GCTGGGAAGAGCCGGGTGGAAGG + Intronic
1136681277 16:31964437-31964459 GTGTGAGAGAGGAGGGAGGAAGG - Intergenic
1136781589 16:32905949-32905971 GTGTGAGAGAGGAGGGAGGAAGG - Intergenic
1136888204 16:33947891-33947913 GTGTGAGAGAGGAGGGAGGAAGG + Intergenic
1136945875 16:34650379-34650401 ATTTGGAAGACCAAGGTGGAAGG - Intergenic
1137027459 16:35492298-35492320 GTTGGGAGGCGGAGGGTGGAGGG - Intergenic
1137238563 16:46635324-46635346 GTTGGGAACAGGAAGGAGGAAGG + Intergenic
1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG + Intergenic
1138458321 16:57133652-57133674 TTTTCAATGAGGAGGGTGGAGGG - Intronic
1139173932 16:64663891-64663913 GTCTGGAAGAGAAGGGTACATGG + Intergenic
1139692921 16:68652482-68652504 TGATGGAAGAGGAGGGAGGAAGG + Intronic
1139999534 16:71011826-71011848 GATTGGAAGAGGAGGGTGGAAGG - Intronic
1140053213 16:71501476-71501498 GTTTGGGAGGTGAGGGTGGTTGG + Intronic
1141105388 16:81229232-81229254 GTTTGCACTGGGAGGGTGGAAGG - Intergenic
1141224173 16:82099671-82099693 GTTTGGAAGAGCATTGAGGATGG + Intergenic
1141608517 16:85169060-85169082 GCTTGGAGGAGGAGGGCGGGGGG + Intergenic
1141775718 16:86121601-86121623 GGAGGGAGGAGGAGGGTGGAAGG - Intergenic
1141776406 16:86125870-86125892 GTATGGAACAGGAGACTGGATGG + Intergenic
1141860148 16:86710872-86710894 GTGGGGCAGAGGAGGCTGGAGGG + Intergenic
1142234538 16:88915520-88915542 GTGTGGAGGGGGAGCGTGGAGGG + Intronic
1142234577 16:88915630-88915652 GTGTGGAGGAGGAGCGTGGAGGG + Intronic
1203084244 16_KI270728v1_random:1169931-1169953 GTGTGAGAGAGGAGGGAGGAAGG - Intergenic
1142666943 17:1468651-1468673 GTCAGGAAGTGGAGGGTTGATGG - Intronic
1143473428 17:7190370-7190392 GTGTGGGAGAGGATGGGGGAGGG + Exonic
1143587295 17:7856574-7856596 GGTTGGGAGAGGAGGGTTGAGGG + Intergenic
1143704353 17:8686943-8686965 GGTAGGAAGAGAAGGGTGGACGG - Intergenic
1143772638 17:9178450-9178472 ATTAGGAAGAGGAGGGAGGGAGG - Intronic
1143818632 17:9541293-9541315 ATGTGGAAGAGGAGAATGGAGGG + Intronic
1144037709 17:11382320-11382342 CTTTGGGAGGGGAAGGTGGAAGG - Intronic
1145748878 17:27341224-27341246 GCTGGGAAGAGGTGGGTGGGAGG - Intergenic
1146677034 17:34780779-34780801 GATCAGAAGAGGAGGGTGGGAGG + Intergenic
1146725976 17:35156177-35156199 GTTTGGCAGAGGATGGAAGAGGG + Intronic
1146834578 17:36099985-36100007 GTCTGAATGAGCAGGGTGGAGGG - Intergenic
1146849187 17:36207170-36207192 GTCTGAATGAGCAGGGTGGAGGG - Intronic
1147044923 17:37744926-37744948 GTGCGAGAGAGGAGGGTGGAGGG + Exonic
1147139968 17:38455343-38455365 AGTTGGAAGAGGTGGGAGGAAGG + Intronic
1147322044 17:39652505-39652527 ATTTGGAGCAGGAGGGTGGGAGG + Intronic
1147613252 17:41813431-41813453 GTTTGGAAGTGGGGGCAGGAGGG - Intronic
1147878599 17:43639364-43639386 GTTTCCAGCAGGAGGGTGGACGG + Intergenic
1148019466 17:44543596-44543618 GTTTGGAAGAGTTTGGAGGAGGG + Intergenic
1148104004 17:45109652-45109674 GTTTGGGACAGGAGGGTTGGGGG - Exonic
1148321370 17:46756864-46756886 TTTTGGAAGAAGTGTGTGGAGGG - Exonic
1148856951 17:50584096-50584118 GTTTGGGAGAGGAGGCGAGAGGG + Intronic
1149099028 17:52882298-52882320 GTTAGGTAGAGGAGAGTAGATGG - Intronic
1150198070 17:63321912-63321934 CTGTGGAAGAGAAGGGTGAAGGG - Intronic
1151629767 17:75302475-75302497 CTATGGAAGAAGAGGGGGGAAGG + Intergenic
1151889315 17:76942858-76942880 GTTTGCAAGGGGAGGGGAGAGGG - Intronic
1151973771 17:77472429-77472451 GAATGAAAGAGGAGGCTGGATGG + Intronic
1152214435 17:79024332-79024354 GTGCAGAAGAGGAGGGTGGGGGG - Exonic
1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG + Intronic
1152598436 17:81249448-81249470 GGAGGGAAGAGGAGGGAGGAGGG + Intronic
1152598454 17:81249509-81249531 GGAGGGAAGAGGAGGGAGGAAGG + Intronic
1152720220 17:81919958-81919980 GTGTGGAAGAGGAGGGTGTAAGG - Exonic
1152825758 17:82463715-82463737 GTCAGGAAGGAGAGGGTGGAGGG + Intronic
1153500181 18:5741074-5741096 GTGAGGAAAAGGAGGCTGGAAGG + Intergenic
1153624828 18:7013785-7013807 GGATGAAAGAGGAGGATGGATGG + Intronic
1153959515 18:10128868-10128890 TTTTGGGAGAGGAGGCTTGAAGG - Intergenic
1154336565 18:13470760-13470782 GTGTGGCTGAGGAGGGTGGCTGG - Intronic
1154347301 18:13552599-13552621 GTTAGGAAGTGGAGGGAGGAGGG - Intronic
1154431725 18:14313758-14313780 GTTGGAGAGAGGAGGTTGGATGG + Intergenic
1154493840 18:14941529-14941551 GTTCTGAAGAGGAGGCTGTAAGG + Intergenic
1155366068 18:25050263-25050285 TGTGGGAAGAGGAGGGTGGTTGG + Intergenic
1155605760 18:27604096-27604118 GTTTTGAAGAGGAGAGTGTATGG + Intergenic
1156205556 18:34882296-34882318 TTTTGAAAAGGGAGGGTGGAAGG - Intronic
1156272302 18:35547002-35547024 GTCTAGAAGAGGAGGTTGGGAGG + Intergenic
1157110404 18:44815367-44815389 GATTTGAAGAGGAGGCTGTACGG + Intronic
1157640840 18:49212738-49212760 CTTTGGAAGGCCAGGGTGGATGG - Intronic
1157966068 18:52209754-52209776 GTGGAGAAGAGGAGGGTGAAAGG - Intergenic
1158240042 18:55367342-55367364 GTTTGCAGAAGGAGGGAGGATGG - Intronic
1158522058 18:58179901-58179923 GGTTGGAGGAGTGGGGTGGATGG - Intronic
1160025916 18:75215998-75216020 GGTTGGAAGGGGAGGGGGGCTGG + Intronic
1160174517 18:76581639-76581661 GTGTGCATGAGGAGGGAGGAAGG - Intergenic
1160211116 18:76880746-76880768 GTGTGGGAGAGGAGGGGGGCAGG + Intronic
1160308014 18:77759371-77759393 CTTTGGAGGAGGAGGATGCAAGG + Intergenic
1160532435 18:79573425-79573447 ATCTAGAAGAGGAGGCTGGAAGG + Intergenic
1160678609 19:403422-403444 ACTTGGAAGTGGAGGGGGGAGGG + Intergenic
1161404075 19:4082046-4082068 GCATGGAGGAGGAGGGAGGAGGG - Intergenic
1162138814 19:8572937-8572959 GTTTGGAAGACGGAGGTGGGAGG - Intronic
1163995310 19:21040079-21040101 ATTTGGAAGATGAAGGTGGGAGG - Intronic
1164001905 19:21108180-21108202 ATTTGGAAGATGAAGGTGGGAGG - Intronic
1164441692 19:28284449-28284471 GGGAGGAAAAGGAGGGTGGAGGG + Intergenic
1164740542 19:30572451-30572473 GTTAGGGAGTGGAGGGTAGAGGG - Intronic
1164908169 19:31984587-31984609 GTTTGGAGGAGGAAAGTGGTAGG - Intergenic
1164916752 19:32058217-32058239 GGAAGGAAGAGAAGGGTGGAAGG - Intergenic
1164916785 19:32058375-32058397 GGAAGGAAGAGAAGGGTGGAAGG - Intergenic
1165064444 19:33220891-33220913 GTTTGGAAGATGAGAGCCGAAGG - Intronic
1165383962 19:35499765-35499787 GTTTGGAAGTGGAGGGCAGGAGG - Intronic
1165658495 19:37554140-37554162 GCTTGAGAGTGGAGGGTGGAAGG - Intronic
1166386256 19:42383225-42383247 GTGTTGAAGAGGAGAGTGGCTGG + Intergenic
1166919250 19:46217596-46217618 GTTTGGTCGAGGTGGGTGGATGG - Intergenic
1166925341 19:46263169-46263191 GTTTGGAGGGGGAGGATGGGAGG + Intergenic
1167134934 19:47610194-47610216 GGATGGAGGAGGAGGGAGGAGGG + Intronic
1167338068 19:48898715-48898737 TGTTGGAAGTGGAGAGTGGAGGG - Exonic
1167573375 19:50304940-50304962 ATTTGGAGGAGGAGTGTGGTTGG + Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167775472 19:51551815-51551837 GTGAGGAAGAGGAGGAAGGAAGG - Intergenic
1202696424 1_KI270712v1_random:130134-130156 GGTAGGAAGAGGAGGGGAGAAGG + Intergenic
1202714765 1_KI270714v1_random:36127-36149 GTTGGGAACAAGAGGGTGGGTGG - Intergenic
925818431 2:7776074-7776096 CTTAGGAAGATGAGGGTGGTCGG + Intergenic
925972936 2:9120038-9120060 TGTTGGAAGAGGAGGATAGATGG + Intergenic
926148190 2:10409654-10409676 GGGTGGAACAGGAAGGTGGAAGG - Intronic
926549118 2:14279772-14279794 GTCTCAAAGAGGAGGATGGATGG - Intergenic
926783015 2:16492760-16492782 ATTTGAAGGAGGAGGGTGGGAGG + Intergenic
927747994 2:25640379-25640401 GTATGGAGGCGGGGGGTGGAGGG + Intronic
928101429 2:28439787-28439809 GTGTGGCAGAGGAGTGTGGAGGG - Intergenic
928139678 2:28717757-28717779 GTTTGGATGAGGAGGGATGTAGG + Intergenic
928405256 2:31009879-31009901 GATGGGAAAAGGAGGGTGGCTGG - Intronic
929055925 2:37875833-37875855 GGCTGGCAGAGGAGGGAGGAGGG - Intergenic
929056842 2:37885684-37885706 GTAGGGAGGAGGAGGTTGGAGGG - Intergenic
929249552 2:39737906-39737928 GGTGGGAAGTGGAGGGAGGAGGG + Intronic
929729562 2:44473074-44473096 GTTTGGGTGAGAGGGGTGGAAGG + Intronic
930057834 2:47265519-47265541 GTGTGGAGGAGGAGGGGAGAGGG - Intergenic
930380594 2:50622863-50622885 GTTGGGAGGAGGAGGGAGTAGGG + Intronic
930707719 2:54520981-54521003 TTTAGGAAGAGAAGGGAGGAAGG - Intronic
930852513 2:55975622-55975644 GGTGGGAAGAGGAGGGTGGGGGG + Intergenic
931667151 2:64617699-64617721 TTTTGGAAGGGGAGATTGGAGGG - Intergenic
931964599 2:67519250-67519272 TCTTGGATGAGGAGGGTGGTGGG + Intergenic
931967422 2:67549069-67549091 GAATGAAAGATGAGGGTGGATGG + Intergenic
932191577 2:69745217-69745239 GTTTGGCAGAGCTGGGTGGTGGG + Intronic
932873677 2:75428982-75429004 CTGTGGAAGAGGAGGCTGGCTGG + Intergenic
933234315 2:79848529-79848551 GGTTGGGAGAAGAGGGTGTAGGG - Intronic
933307875 2:80624677-80624699 GTTTGGAAGTCGAGGATTGATGG + Intronic
934277587 2:91587159-91587181 GGTAGGAAGAGGAGGGGAGAAGG + Intergenic
934898306 2:98138096-98138118 ATGTGGAAGAGGAAAGTGGATGG - Intronic
935116776 2:100143752-100143774 GTTTGGATGAGGATAATGGAGGG - Intergenic
935178280 2:100668439-100668461 TTTGGGAAGAGGAGGGAGAATGG + Intergenic
936444242 2:112584050-112584072 GCTTGGAACAGGAGGGAAGAGGG - Intergenic
936896483 2:117433565-117433587 GTTTGTAAGAAGATGGTGAATGG + Intergenic
937054874 2:118926123-118926145 GTTTTTAAGAGCTGGGTGGAGGG - Intergenic
937249241 2:120512762-120512784 GTGTGGAAGTGAAGGGTGGGTGG - Intergenic
937397981 2:121555499-121555521 ATTTTGAGGAGGAGGATGGAGGG + Intronic
938207091 2:129432990-129433012 TCTTGTAAGAGGATGGTGGATGG + Intergenic
938279976 2:130056941-130056963 GTTTGGAAGGTGGGGGTGGTTGG - Intergenic
938330934 2:130447656-130447678 GTTTGGAAGGTGGGGGTGGTTGG - Intergenic
938338058 2:130516660-130516682 GGCTGGAAGTGGAGGGTGTAGGG + Intergenic
938351780 2:130604078-130604100 GGCTGGAAGTGGAGGGTGTAGGG - Intergenic
938359015 2:130673847-130673869 GTTTGGAAGGTGGGGGTGGTTGG + Intergenic
938435408 2:131280496-131280518 GTTTGGAAGGTGGGGGTGGTTGG + Intronic
938800593 2:134759871-134759893 GCTGGGAAGAGGAGGCGGGAGGG + Intergenic
938906190 2:135838170-135838192 TATAGGAAGAGGAGGGGGGAGGG - Intergenic
938962564 2:136356346-136356368 GGTTAGAAGAGGAGGGAGGATGG + Intergenic
939362888 2:141196760-141196782 GTTTGGAACAGGAAGATGGTAGG - Intronic
940230129 2:151442315-151442337 ATTTGGAAGAGCAAGGCGGAGGG - Intronic
940638747 2:156327559-156327581 ATATGGAAGAGGAGGGGCGATGG + Intronic
940696028 2:156979564-156979586 TTTGGAAAGAGAAGGGTGGAAGG - Intergenic
941489687 2:166127580-166127602 GGTTGAGAGAGGAGGGGGGAGGG + Intronic
942636738 2:178015773-178015795 GAGAGGAAAAGGAGGGTGGAAGG + Intronic
942656366 2:178218200-178218222 CTTTTGAAAAGGAGGTTGGAAGG + Intronic
943179158 2:184521310-184521332 AAATGGAAGAGGAAGGTGGATGG + Intergenic
943470783 2:188291950-188291972 ATTAGGAAGAGGAGGGAGGGGGG + Intronic
943893216 2:193318607-193318629 GTTTGCCAGAGGATGGTGGCTGG - Intergenic
943936804 2:193929192-193929214 GATTGGAAGGTGGGGGTGGAGGG - Intergenic
944230029 2:197383227-197383249 CTTTGGAAGACCAAGGTGGAAGG + Intergenic
944417530 2:199493535-199493557 GCTTGGACTAGGAGGGTGGCAGG + Intergenic
945158677 2:206865651-206865673 GTTTGGAAAAGGAGGCTGGAAGG - Intergenic
945289035 2:208109841-208109863 CTTTGGAAGGCCAGGGTGGAAGG + Intergenic
946286892 2:218710826-218710848 GTCTGGAAGAAGAGGGCGGGAGG - Intronic
946372554 2:219289840-219289862 GTATGGAAGAATGGGGTGGAGGG - Exonic
946666647 2:222057483-222057505 GGTGGGAAATGGAGGGTGGAGGG - Intergenic
946881901 2:224185012-224185034 GTGAGGCAGAGGAGGGTGGATGG - Intergenic
947342647 2:229156305-229156327 GTTTGGAAGAGGATGTTATAGGG + Intronic
947428989 2:230009224-230009246 GTTTGGGATAGGAGGTAGGATGG + Intronic
947587031 2:231362629-231362651 GTGAGGAAGAAGAGGATGGAAGG + Intronic
948020849 2:234732101-234732123 CTTTGGGAGAGCAAGGTGGACGG - Intergenic
948223203 2:236289658-236289680 GTGAGAAGGAGGAGGGTGGAGGG + Intergenic
948458416 2:238117935-238117957 GGTGGAAGGAGGAGGGTGGATGG + Intronic
948458693 2:238118948-238118970 GATTGATGGAGGAGGGTGGATGG + Intronic
948458708 2:238119005-238119027 GATTGATGGAGGAGGGTGGATGG + Intronic
1168751059 20:281733-281755 CTTTGGAAGAGCAAGGTGGAAGG + Intronic
1169023333 20:2347249-2347271 GAGTGGAAGAGGAGTGGGGAAGG - Intergenic
1169669462 20:8080102-8080124 TTTTGTAAGTGGTGGGTGGAAGG + Intergenic
1169894076 20:10483786-10483808 CTTTAGAAGAGAAGGGTGGGGGG - Intronic
1171166195 20:22974093-22974115 GTTTTTAAGAGGACTGTGGAGGG - Intergenic
1171335833 20:24384617-24384639 GTTAGGGAGAGGAGGAAGGAAGG + Intergenic
1171907583 20:30912447-30912469 GTTGGGAGGCGGAGGGTGGGGGG - Intergenic
1172113937 20:32562925-32562947 GAGTGGAGAAGGAGGGTGGAGGG + Intronic
1172847384 20:37938063-37938085 TTGTGGAAGAAGAGGCTGGAAGG + Intronic
1173183027 20:40818923-40818945 GGGTGGAAGAGGAGAGAGGATGG - Intergenic
1173438846 20:43057305-43057327 GAATGGAGGAGGAGGGGGGAAGG + Intronic
1173750044 20:45469661-45469683 GCGGGGAAGGGGAGGGTGGAGGG - Intergenic
1174514695 20:51082852-51082874 GTCGGGAAGGGGAGAGTGGAGGG + Intergenic
1174646321 20:52089000-52089022 GTTTGGAAGAAGTGAGAGGAAGG - Intronic
1175378839 20:58548803-58548825 GTTTGGGGGAGGGGGTTGGAGGG - Intergenic
1175638279 20:60603648-60603670 GATGGTAAGAGGAGGGTGCAGGG - Intergenic
1175667941 20:60876386-60876408 GATTGGAGGATGATGGTGGAGGG - Intergenic
1176291039 21:5044786-5044808 GTTGGGAAGAGGATGGTGGCGGG + Intergenic
1177656210 21:24020403-24020425 GTGTGGAAGAGGAATGTGGGGGG + Intergenic
1177904737 21:26961848-26961870 GTTTGGAAGAGGGAGAGGGATGG - Intronic
1179203522 21:39250004-39250026 TTCTGGAAGAGGAAGCTGGAAGG + Intronic
1179866216 21:44218855-44218877 GTTGGGAAGAGGATGGTGGCGGG - Intergenic
1180738205 22:18034599-18034621 GTTTGGAAGTGGCGGGAGGCGGG + Intergenic
1180758709 22:18182226-18182248 GTTTGGAAGTTCAGAGTGGAAGG + Intergenic
1180768996 22:18366018-18366040 GTTTGGAAGTTCAGAGTGGAAGG + Intergenic
1180777316 22:18496377-18496399 GTTTGGAAGTTCAGAGTGGAAGG - Intergenic
1180810036 22:18753687-18753709 GTTTGGAAGTTCAGAGTGGAAGG - Intergenic
1180826871 22:18869242-18869264 GTTTGGAAGTTCAGAGTGGAAGG + Intergenic
1181196182 22:21187939-21187961 GTTTGGAAGTTCAGAGTGGAAGG - Intergenic
1181213347 22:21305185-21305207 GTTTGGAAGTTCAGAGTGGAAGG + Intergenic
1181294779 22:21828155-21828177 GTATGGGAGAGCAGGCTGGAAGG + Intronic
1181523993 22:23468172-23468194 GTTTGGAAGTTCAGAGTGGAAGG + Intergenic
1181582083 22:23834120-23834142 GCCTGGAAGAGGAGTGGGGAGGG - Exonic
1181674847 22:24444869-24444891 GGTTAGAGGAGGAGGGTGAAAGG - Intergenic
1181984367 22:26789387-26789409 GTCTGGAGGATGAGGGTGGATGG - Intergenic
1182253165 22:29018071-29018093 GTGTGGGAGGGGAGGGCGGACGG + Intronic
1182836562 22:33346715-33346737 GTTAGGAAGAATGGGGTGGAGGG - Intronic
1183348235 22:37319607-37319629 GTGCGGAAGAGGAGGTGGGAAGG - Intergenic
1183533635 22:38380823-38380845 GTGTTGAAGAGAAGTGTGGACGG + Intronic
1184017016 22:41793968-41793990 GGCTGGAGCAGGAGGGTGGAAGG - Intronic
1184414145 22:44342356-44342378 CTTTGGAAGAGGAGAAAGGAAGG + Intergenic
1185093453 22:48790772-48790794 GATTGGAAGGGGAGGGAGGAGGG - Intronic
1185162012 22:49235741-49235763 GTTTGAAAGAGGGGATTGGAAGG - Intergenic
1203230618 22_KI270731v1_random:106902-106924 GTTTGGAAGTTCAGAGTGGAAGG + Intergenic
1203277011 22_KI270734v1_random:95152-95174 GTTTGGAAGTTCAGAGTGGAAGG + Intergenic
949491212 3:4590874-4590896 TTGTGGAGGGGGAGGGTGGAAGG - Intronic
950233499 3:11297112-11297134 CTTTGGGAGACCAGGGTGGAAGG + Intronic
950279534 3:11694734-11694756 GTTTGCAAGATGAAAGTGGAGGG + Intronic
950577441 3:13840921-13840943 ATTTGGTAGAGGAGTGTGTAGGG - Intronic
950718344 3:14865244-14865266 GCTTGGAAGGGGAGGGATGATGG - Intronic
951398301 3:22199202-22199224 GGATGGAAAAGCAGGGTGGAGGG - Intronic
951778741 3:26339859-26339881 TGTTGGAAGAGGAGGCTGGTGGG - Intergenic
952192967 3:31043197-31043219 GTCAGGGAGGGGAGGGTGGAGGG - Intergenic
952603226 3:35109772-35109794 GTGGGGAAGAGGAGGGGGGAGGG + Intergenic
954249798 3:49358637-49358659 GTTTGGCATAGGAGGCTGGTGGG + Intergenic
954645856 3:52131132-52131154 ATTTGGGAGAGGATGGTGGGCGG - Intronic
954996724 3:54888473-54888495 TTTCTGAAGTGGAGGGTGGAGGG + Intronic
955952568 3:64257293-64257315 GTTGGGAACAGAAGGGTGGAGGG - Intronic
956208968 3:66783652-66783674 TTTTTGAAGAGGAGGCTGGGTGG - Intergenic
956321972 3:68007709-68007731 GATTTGGAGAGGCGGGTGGAGGG - Intronic
957219814 3:77367375-77367397 GTTGGGAAGGGGAGAGTGGAAGG - Intronic
957751140 3:84417495-84417517 GCTAGGAAGAGTAGGGTGGAGGG + Intergenic
957819931 3:85359111-85359133 GCTTGACTGAGGAGGGTGGAAGG + Intronic
958459375 3:94375045-94375067 GTTTGGAAGATGGTGGTGGAAGG + Intergenic
959128242 3:102317612-102317634 GCTTGAAAGTGGAGGGTGGGAGG - Intronic
959250662 3:103939442-103939464 TTTTGGAAGGGTAGGGAGGAGGG - Intergenic
959572556 3:107900511-107900533 GTTTGCAGGTGGAGGCTGGAGGG - Intergenic
959574461 3:107919402-107919424 GCCTGGAAGAGGAAGGAGGAAGG + Intergenic
960422371 3:117462881-117462903 GATTGAAGGAGGAGGGTGGTGGG + Intergenic
961232853 3:125334805-125334827 GTCTGAAAGATGAGGGTGGGTGG - Intronic
962174214 3:133135850-133135872 GTTTGGGAGTGGAGGGAGGGTGG + Intronic
962277124 3:134023964-134023986 GTTGGGAAACGGAGGCTGGATGG - Intronic
962748232 3:138413382-138413404 GTTTGGAGGAGGAGGGGTGGTGG - Intergenic
962816054 3:139001845-139001867 GGCTGGAGGAGGAGGGTGGATGG - Intergenic
963390914 3:144663130-144663152 ATTTGTAAGAGGAGGGAGGCAGG - Intergenic
963560087 3:146854123-146854145 GTTTGGAAGATGGAGGAGGAGGG + Intergenic
964607243 3:158571986-158572008 GTTTGGGGGAGTAAGGTGGAGGG + Intronic
965461871 3:168975797-168975819 GTTTGGATAAGGAGGGGAGAGGG + Intergenic
966185220 3:177221062-177221084 GTCTAGAAGAGGAAGGGGGAAGG - Intergenic
966284958 3:178284716-178284738 GTTTAGAGGTGGTGGGTGGATGG + Intergenic
967201293 3:187074689-187074711 ATTTGGCAGAGGAAGATGGAGGG + Intronic
967215554 3:187206985-187207007 GCCTGGAAGAGCTGGGTGGACGG - Intergenic
967681391 3:192368091-192368113 TTTTGGAAGGGGAGGGAGGTGGG - Intronic
967945655 3:194801927-194801949 GGAGGCAAGAGGAGGGTGGAGGG + Intergenic
968082128 3:195853868-195853890 GTTTGGAGGACGTGGGTGGAGGG + Intergenic
968136854 3:196226071-196226093 CTTTGGGAGACCAGGGTGGAAGG + Intronic
968426309 4:525838-525860 GTGAGGAAGCGGAGGGGGGACGG + Intronic
968962240 4:3751537-3751559 GTGAGGAAGAGGAGCGAGGATGG - Intergenic
969033156 4:4229189-4229211 GGTAGGAAGAGGAGGGGAGAAGG - Intergenic
969325017 4:6438423-6438445 GTTTGGAAGAGTTTGGTGGACGG + Intronic
969327352 4:6451728-6451750 GCCGGGAGGAGGAGGGTGGAAGG - Intronic
970248869 4:14093239-14093261 GGGTGGAAGAGGAAGCTGGATGG + Intergenic
970572047 4:17392892-17392914 GGGTGGAAGGAGAGGGTGGAAGG + Intergenic
970887146 4:20999566-20999588 GTTTGGGGGAAGAGGGTGGCTGG + Intronic
971439331 4:26663030-26663052 GATTGGAGCAGGAGGTTGGAAGG + Intronic
971521635 4:27559738-27559760 GCTTGGAAGCTGAGGGAGGATGG + Intergenic
974716168 4:65670541-65670563 GCTGGGAAGAGGAGGAGGGAAGG - Intergenic
974729829 4:65847824-65847846 GTTTGGAAAAGGAGGAGGTAGGG - Intergenic
975809052 4:78146449-78146471 GATAGGAAGAGGAGGCAGGAAGG - Intronic
976149942 4:82081583-82081605 GTTCTGAAGAGGAGGGGGCATGG - Intergenic
976892858 4:90071611-90071633 ATATGGGAGAGGAGAGTGGATGG - Intergenic
977132006 4:93251662-93251684 GCCTGGAAGTGGAGGGTGGTGGG - Intronic
977482985 4:97602351-97602373 GATTGGAGCAGGAGGATGGATGG - Intronic
977837312 4:101660356-101660378 GATTAGAGGAGAAGGGTGGAAGG - Intronic
978008045 4:103642651-103642673 GCTGGGAAGGGTAGGGTGGAGGG + Intronic
978777282 4:112516391-112516413 GGTGGGAGGAGGAGGATGGATGG - Intergenic
978807694 4:112817998-112818020 GTGTGGAAGAGGCTGGCGGATGG + Intergenic
979076879 4:116282389-116282411 CTTTGGAAGAGGAGGCAGTATGG - Intergenic
979677230 4:123423262-123423284 GGTGGGAAGGGGAGGGTGGGTGG + Intergenic
980790142 4:137609810-137609832 GCTTTGAAGAGGAGGGGGGAAGG + Intergenic
981344077 4:143655008-143655030 GTGTGGAAATGGAGGATGGAGGG - Intronic
981813907 4:148806732-148806754 GCTTGGACCAGAAGGGTGGAGGG + Intergenic
981829963 4:148988062-148988084 AGTTGGAAGGGGTGGGTGGAAGG + Intergenic
981953999 4:150447853-150447875 TTTGGGAAAAGGAGTGTGGATGG - Intronic
982110641 4:152050460-152050482 GTTGGGAAGAGGAGGCAGCAAGG + Intergenic
982235633 4:153249089-153249111 GTGGGGAAGAGGAGGGAGTAAGG - Intronic
982467447 4:155748210-155748232 GTATGGAAATGGAGGGTGGGAGG - Intergenic
982476075 4:155852719-155852741 GGTTGGAAAAGGAGGGTAAAAGG - Intronic
982623251 4:157732254-157732276 GTGGGGAAGAGGTGTGTGGATGG - Intergenic
983177499 4:164608208-164608230 GTTCGTAAGCGGAGGGAGGAGGG - Intergenic
983519549 4:168693010-168693032 ATTTGGATGAGGAGGGAGGAAGG + Intronic
984760317 4:183357531-183357553 GTCTGGAGGAGCAAGGTGGACGG + Intergenic
984886576 4:184455191-184455213 GGTTAGAAGAAGAAGGTGGAGGG - Intronic
985054621 4:186025590-186025612 GAGTGTGAGAGGAGGGTGGATGG + Intergenic
985701520 5:1376078-1376100 GTGTGGGAGAAGGGGGTGGAAGG - Intergenic
985929619 5:3046967-3046989 ATTAGGAAGAGAAGGGTGGGTGG + Intergenic
986522318 5:8633013-8633035 GGTTGGAGGAGGAGGATGAAGGG + Intergenic
986616116 5:9619020-9619042 CTTGGGAAGAGGATGGTAGATGG - Intergenic
986752122 5:10796664-10796686 GGATGGAAGAGGTAGGTGGAGGG - Intergenic
987971072 5:24945305-24945327 ATTTGGCAGGGGAGGGTGGCGGG - Intergenic
988454622 5:31376322-31376344 GTTTGGAAGAGGACTCTGAATGG - Intergenic
988982651 5:36587001-36587023 GCTTGGAGGAGGAGGGAGTAGGG - Intergenic
989203808 5:38791977-38791999 TTTGGGAAGAGGAGGGGGGCAGG - Intergenic
989412847 5:41140312-41140334 GTTTGGGGGAAGAGGGAGGATGG + Intergenic
990011182 5:51000245-51000267 ATTGGGAATGGGAGGGTGGATGG + Intergenic
990149288 5:52798999-52799021 GTTTGGCATAGGCGTGTGGAAGG - Intronic
990350227 5:54908741-54908763 GTTTGGGTGGGGACGGTGGATGG - Intergenic
990598562 5:57334699-57334721 CTTTGGTAGAGGAAGGTGGCTGG - Intergenic
990951876 5:61306417-61306439 TTTTAGAAGTTGAGGGTGGAAGG + Intergenic
991050388 5:62266649-62266671 CCTTGGCAGAGGAAGGTGGACGG + Intergenic
991144398 5:63283832-63283854 GTGGGGACGGGGAGGGTGGAGGG + Intergenic
991410257 5:66338664-66338686 ATTTGGAAGAGGAGGTGGGTGGG + Intergenic
992483376 5:77172892-77172914 GTTTGGGTGATGATGGTGGAGGG - Intergenic
992725876 5:79606838-79606860 GCCTGGAAGATGAGGGTGTAGGG - Intergenic
993234686 5:85289304-85289326 GTGGGGAAGAGGAGGAAGGAAGG + Intergenic
993242627 5:85410492-85410514 GCTTGACAGTGGAGGGTGGAAGG - Intergenic
993588186 5:89759095-89759117 ATTTGGATGAGGAGGTGGGAAGG - Intergenic
993625457 5:90219339-90219361 GTGGGGAAGAGGAGGGGGGGAGG + Intergenic
993926339 5:93870733-93870755 GGGTGGAAGTGGAGGTTGGAGGG + Intronic
994626796 5:102230190-102230212 GGGTGGAGCAGGAGGGTGGAAGG + Intergenic
994833270 5:104813577-104813599 AGTTGGAAGAGGAAGGTGGGAGG - Intergenic
995646695 5:114320696-114320718 GTTTGGAGGGGTAGGGTGCATGG + Intergenic
996553237 5:124751613-124751635 ATTTGGAACAGAGGGGTGGAAGG + Intergenic
996557709 5:124796301-124796323 GATGGGAAGGTGAGGGTGGAGGG - Intergenic
996772320 5:127098355-127098377 GGTTGGAATAGGAGAGGGGAAGG + Intergenic
996810109 5:127506951-127506973 GGTGGGAGCAGGAGGGTGGAGGG + Intergenic
996893604 5:128453913-128453935 GTGAGGTACAGGAGGGTGGAAGG - Intronic
997576055 5:134978146-134978168 GCTGGGAAGAGCAGGGGGGAAGG + Intronic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
997856347 5:137376285-137376307 GTCTGCAGGAGGAGGGTGGTAGG - Intronic
998500614 5:142629405-142629427 ATTTGGAAGGCCAGGGTGGAAGG - Intronic
998535231 5:142924205-142924227 GTTGGAAAGAGGAGGGAGGGAGG - Intronic
998741026 5:145201967-145201989 GTGTAGAAGAGGAGGGGTGATGG - Intergenic
998837753 5:146219827-146219849 GTTGGAAGGAGGAGAGTGGATGG - Intronic
998867189 5:146517215-146517237 GTTTGGTAGAGGTGGGGGCAGGG - Intergenic
1000163159 5:158620615-158620637 GTAAGGTAGAGGAAGGTGGATGG + Intergenic
1000244909 5:159441385-159441407 GTTGGGAAATGAAGGGTGGAGGG + Intergenic
1000502413 5:162068136-162068158 GTTCTGAAGAGGTGGGGGGAAGG + Intronic
1000574374 5:162958449-162958471 CTTTGGCAGAGTATGGTGGAGGG + Intergenic
1001293890 5:170485426-170485448 GTGTGGACGGGGAGGGTGGCTGG + Intronic
1001342744 5:170862277-170862299 GGTTGGAGGCGGCGGGTGGAGGG + Intronic
1002176521 5:177404173-177404195 GTTAGGAAGTGGGGGGGGGAAGG - Intronic
1002999059 6:2314048-2314070 GTTGGGAAATGGAGGCTGGATGG + Intergenic
1003327552 6:5104154-5104176 GATTGGAAGAGGAGGGCTGGTGG - Intronic
1003551309 6:7104501-7104523 GGTGGAAAGAGGAGGGAGGAGGG + Intergenic
1003558119 6:7158547-7158569 GTATGGAGGTGGAGGCTGGAGGG - Intronic
1005352329 6:24948825-24948847 GTTTGAAATAGGAGAGTGGCTGG - Intronic
1005822227 6:29607416-29607438 GTGTGGAAGTAGAGGGTGGATGG - Intronic
1005883483 6:30076756-30076778 GCTAGGAAGAGGAGGGAGCAGGG - Intergenic
1005983535 6:30855856-30855878 GTTAGCAAGATGAGGGAGGAGGG - Intergenic
1005987974 6:30885881-30885903 GGTTGGGAGAGGAGCGTGAAGGG + Intronic
1006457956 6:34142805-34142827 GGTTGGGGGAGGAGGGAGGAGGG + Intronic
1006775868 6:36592120-36592142 GGGAGGCAGAGGAGGGTGGATGG + Intergenic
1006856402 6:37136496-37136518 GTTTGGAAAGGGAGGGAGGAGGG + Intergenic
1006880237 6:37332598-37332620 ATTTGGTAGTGGAGGGTGGGGGG + Exonic
1007112687 6:39322202-39322224 ATTTGGAAGAAGAGTGTGGTGGG - Intronic
1007219786 6:40269376-40269398 GGTTGGAAGAGGGGGCAGGAAGG - Intergenic
1007704206 6:43781173-43781195 GTCTGGAAGCTGAGGGTGGTGGG + Intronic
1007896708 6:45369554-45369576 CTTTGGTGGAGGAGAGTGGAGGG - Intronic
1008494278 6:52116922-52116944 GTTTGGATGGTAAGGGTGGAGGG - Intergenic
1008723473 6:54387533-54387555 GATGGGGAGTGGAGGGTGGATGG + Intronic
1009002752 6:57739275-57739297 GTTGGAAAGTGGAGGGTGGGAGG + Intergenic
1009437649 6:63636195-63636217 GTGTGGAAGGGGATGGGGGAGGG - Intronic
1011227198 6:85120393-85120415 GGTGGGAAGAGGAGGGAGGTGGG - Intergenic
1012056513 6:94419080-94419102 GCTGGGAAGTGGAGGGCGGATGG - Intergenic
1013639628 6:112060507-112060529 GTGTGGAAGAGCAGAGTGGAAGG + Intronic
1014426533 6:121313507-121313529 ATTTGGAAGAGGAATGTGTAGGG - Intronic
1014942504 6:127459450-127459472 GGTTGGAAGAGGTGGCTTGAAGG - Intronic
1015526043 6:134175870-134175892 ACTTGGAAGAGGAGGAAGGAAGG + Intronic
1016445630 6:144129267-144129289 ACTTGAAGGAGGAGGGTGGAAGG + Intergenic
1016940963 6:149482553-149482575 GCCTGGAAGAGCAGGGAGGAAGG + Intronic
1017420910 6:154271738-154271760 GTTTGGAAGACCAAGATGGAAGG + Intronic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1019057935 6:169236346-169236368 GTGTGGATGGGGAGTGTGGATGG - Intronic
1019057942 6:169236375-169236397 GTGTGGATGGGGAGTGTGGATGG - Intronic
1019335905 7:482642-482664 GGTTGGAACAGTTGGGTGGATGG + Intergenic
1019853941 7:3585693-3585715 GTTTGGTAGGGGAGGGAAGAAGG + Intronic
1020136665 7:5591842-5591864 CTTTGGGGGAGGAGGATGGAGGG + Intergenic
1020143033 7:5622803-5622825 GTTTGGGGTAGGAGTGTGGATGG - Exonic
1020535004 7:9386541-9386563 GATTGAAAGAGGAGGATGGCAGG - Intergenic
1021293965 7:18880646-18880668 ACTTGAGAGAGGAGGGTGGAAGG + Intronic
1021476955 7:21073143-21073165 TTTTTGAAGAGGAGGGTTGCAGG + Intergenic
1021775784 7:24054090-24054112 GTCAGGGAGAGGTGGGTGGAGGG - Intergenic
1021912232 7:25397555-25397577 GTTTGGTGAAGGAAGGTGGAGGG - Intergenic
1022367119 7:29732349-29732371 AATTGGAAGAGGAGGTAGGATGG + Intergenic
1022404480 7:30074819-30074841 GCTGGGAAGAAGAGGGTGGTGGG - Intronic
1022461970 7:30617809-30617831 GTTTGGTGGTGGAGGCTGGAGGG - Intronic
1023058320 7:36307250-36307272 GTTTGGAAGAGGGAGGAGGGAGG - Intergenic
1024213730 7:47228814-47228836 GTTTGGAGGTGGAGGGAGGCGGG - Intergenic
1024740133 7:52344479-52344501 GTTTTAAAGAGGAGGGTGACAGG + Intergenic
1026290569 7:69002193-69002215 TATTGGAAGTGGAGAGTGGATGG + Intergenic
1026571754 7:71537405-71537427 GTTTGGAAGTGGGTGGCGGACGG + Intronic
1026776035 7:73231638-73231660 GGATGGAGCAGGAGGGTGGAGGG + Intergenic
1027016892 7:74785009-74785031 GGATGGAGCAGGAGGGTGGAGGG + Intronic
1027071135 7:75160927-75160949 GGATGGAGCAGGAGGGTGGAGGG - Intergenic
1027396350 7:77758941-77758963 GTTTGGAAGTGGAGGAAGGGTGG - Intronic
1028118405 7:87028353-87028375 GTGTTGAAGAAGAGGGTTGATGG - Intronic
1028759060 7:94474424-94474446 TTTTGGAAGAACAGGGTGGCAGG + Intergenic
1028842317 7:95441751-95441773 GTCTGGAAGATGAGGGTTGCTGG - Intergenic
1028950205 7:96626147-96626169 GTTTGGAAGGGGAGGTGGGATGG - Intronic
1029661257 7:101963514-101963536 GGTGGGAAGTGGAGGCTGGAGGG + Intronic
1029746099 7:102516612-102516634 GCCTGGAGGAGGAGGGTGGGAGG - Intronic
1029764037 7:102615591-102615613 GCCTGGAGGAGGAGGGTGGGAGG - Intronic
1029880799 7:103807608-103807630 GCTTGAGAGGGGAGGGTGGAAGG - Intronic
1030651028 7:112116162-112116184 GCTGGGGAGAGGAGGGTGGAGGG - Intronic
1030865832 7:114700676-114700698 GTTGGAATGAGGAGGCTGGATGG + Intergenic
1031002827 7:116437194-116437216 GTTTGAGGGTGGAGGGTGGAAGG + Intronic
1031192863 7:118576841-118576863 GATTTGCAGAGTAGGGTGGAGGG + Intergenic
1032238605 7:130144142-130144164 GCTAGGAAAAGCAGGGTGGAGGG + Intergenic
1032338160 7:131045448-131045470 GCTTGGGAGAGGAGGGAGAAAGG - Intergenic
1032845144 7:135745732-135745754 TTTTGGAGCAGGAGGGTGGGAGG + Intronic
1033603068 7:142902988-142903010 ATTTGGAAGAACAGGGTGGGAGG - Intergenic
1034077562 7:148247361-148247383 GTTTGGTGGAGAAGGGTCGAGGG - Intronic
1034514039 7:151559839-151559861 GATGGGAAGAGGAGGAGGGAAGG + Intronic
1035416886 7:158696719-158696741 CTTAGGAGGAGGAGGGTGGCAGG - Intronic
1035657363 8:1320119-1320141 GTGAGGAAGAGGAGGGCTGAAGG + Intergenic
1035681639 8:1492927-1492949 GGATGGCAGTGGAGGGTGGAGGG - Intergenic
1035695270 8:1591289-1591311 GTTAGGAAGAGGGAGGGGGAGGG - Intronic
1036433257 8:8708930-8708952 TTTTGGAGGAGGATGGTGGGAGG - Intergenic
1037748215 8:21663016-21663038 GCTTGGTAGGGGAGGGTGGGGGG - Intergenic
1038182571 8:25242844-25242866 GTTTGTCACTGGAGGGTGGATGG + Intronic
1038300027 8:26335994-26336016 GAATGGAAGAGGAAGGTGAAGGG - Intronic
1038302003 8:26360226-26360248 ACTTGAAAGAGGAGGATGGAAGG + Exonic
1038414173 8:27381336-27381358 GCTGGGAAGGGCAGGGTGGAAGG - Intronic
1038659380 8:29483500-29483522 TTTTGGCTGAGGAGGGAGGATGG + Intergenic
1039267905 8:35847254-35847276 GGTAGTAAGAGGTGGGTGGAGGG + Intergenic
1039367374 8:36944456-36944478 GTTTGAGTGGGGAGGGTGGAAGG + Intergenic
1039378496 8:37061690-37061712 GCTTGGGAGATGAGGGTGGGAGG + Intergenic
1039456822 8:37712701-37712723 TTTGGGAACAGGTGGGTGGAGGG + Intergenic
1039563461 8:38531515-38531537 CTTGGGAAGAGGAAGGAGGAAGG + Intergenic
1039816169 8:41096293-41096315 GTTGGGGAAAGGAGGCTGGAAGG - Intergenic
1040532971 8:48280867-48280889 GTGTGGAATGGGTGGGTGGATGG - Intergenic
1040584477 8:48726646-48726668 GGATGGATGAGGTGGGTGGATGG - Intronic
1041007290 8:53507962-53507984 GGTGGGAAGTGGAGGGTGGGAGG - Intergenic
1041206222 8:55500577-55500599 GGTTGGAAGAGGACAGAGGAGGG - Intronic
1041746367 8:61212570-61212592 TTTTGGAGGAAGAGGGAGGAAGG + Intronic
1041794529 8:61732769-61732791 GTTAGGAAAGGGAGGGTGTACGG + Intergenic
1041846154 8:62331126-62331148 GGGTGGAAGAGGAGGGAGGAAGG - Intronic
1042209620 8:66366742-66366764 GTAAGGAAGGGGAGGGTGGCAGG - Intergenic
1042877656 8:73454619-73454641 GTGTTGAAGAAGAGAGTGGATGG - Intronic
1043394326 8:79822010-79822032 TTTTGGAAGAGCAGAGTGGAGGG - Intergenic
1045281126 8:100750554-100750576 TTTAGGAAGAGGAGGGAAGAGGG + Intergenic
1045484890 8:102623139-102623161 GTTTGGGGGAGAAGGGTAGATGG - Intergenic
1046055491 8:109073427-109073449 GCTTGGAAGAGCAGGGAGGCAGG - Intergenic
1046522759 8:115346340-115346362 ATTTGGCAGAGGTGAGTGGAAGG + Intergenic
1047358262 8:124143771-124143793 CATTGGAAGAGGTGGTTGGATGG + Intergenic
1047945337 8:129870994-129871016 GTTTGGGAGAGGAAAGTTGAGGG + Intronic
1048019218 8:130523015-130523037 GGGTGGAAGAGGTCGGTGGATGG + Intergenic
1048167619 8:132077338-132077360 GTCTAGAGGAGGAAGGTGGAGGG + Intronic
1048519791 8:135142857-135142879 GTTTGAAAGAGGAAGATGAAGGG + Intergenic
1048564628 8:135582288-135582310 GTATGGAAGAGGAGTTTGGGTGG + Intronic
1048600572 8:135915172-135915194 GTTTGAAGGTGGAGGGTGGGAGG + Intergenic
1049141568 8:140959835-140959857 TGTTGGAAAAGGAGGGTGGTGGG - Intronic
1049521269 8:143092638-143092660 GTTTGCAGGAGGAGGGGTGAGGG - Intergenic
1050610437 9:7346867-7346889 GGATGGAGGAGGAGGATGGAAGG - Intergenic
1052072331 9:24096868-24096890 CTTGGGAAGAGGTGGGAGGATGG + Intergenic
1053422695 9:37989798-37989820 GTTTTAAAGAGGAGTGGGGAAGG + Intronic
1053526733 9:38837768-38837790 GGTGGGAAGAGGAGGCTGGGGGG - Intergenic
1053665900 9:40317345-40317367 GGTTGGAAGATGGGGGTGTAGGG + Intronic
1053915478 9:42942390-42942412 GGTTGGAAGATGGGGGTGTAGGG + Intergenic
1054198961 9:62062197-62062219 GGTGGGAAGAGGAGGCTGGGGGG - Intergenic
1054377054 9:64457373-64457395 GGTTGGAAGATGGGGGTGTAGGG + Intergenic
1054518711 9:66058938-66058960 GGTTGGAAGATGGGGGTGTAGGG - Intergenic
1054639393 9:67526160-67526182 GGTGGGAAGAGGAGGCTGGGGGG + Intergenic
1054840483 9:69733201-69733223 GTTTGGAAAGGGATGGTGGCAGG - Intronic
1055277944 9:74640873-74640895 TATTGGAGGAGGAGGGTGAATGG + Intronic
1055592518 9:77832435-77832457 ACTTGGAAGAGGATGGAGGAAGG + Intronic
1056009590 9:82313133-82313155 GGTTGGAAGAGAAGTGGGGATGG + Intergenic
1056802606 9:89703364-89703386 GTTTGGAAAAGGAGACTTGATGG + Intergenic
1057172562 9:92971948-92971970 GTGTGGGGGAGGGGGGTGGATGG - Intronic
1057540443 9:95963527-95963549 ATTTTGGAGAGGAGTGTGGAGGG - Intronic
1057583563 9:96309179-96309201 GGCTTGAAGAGCAGGGTGGATGG - Intergenic
1057820671 9:98328139-98328161 GTTTGTGAGATGAGGCTGGAGGG - Intronic
1058125034 9:101182232-101182254 GGCTGGAAGAGGGGGATGGATGG + Intronic
1058268895 9:102943944-102943966 GTTTGGTAGGGGAGGTGGGAAGG + Intergenic
1058802263 9:108556029-108556051 GCTTGGAAGAGAAGAGTGCAGGG + Intergenic
1059838206 9:118181222-118181244 GTGGGGAAGAGGAGGGAGAAAGG - Intergenic
1060924906 9:127449569-127449591 TTTCGGGAGAGGAGGGTGGGGGG - Intronic
1060986092 9:127819791-127819813 GTTTGGGAGAGCAGGCTGCAGGG - Intronic
1061166493 9:128925734-128925756 GGGTGGAAGAGGAGGCAGGAGGG - Intronic
1061376295 9:130226637-130226659 GCTGGGAGGAGGAGGCTGGAAGG + Intronic
1061580819 9:131534786-131534808 GCTTGAAGGAGGAGGGAGGAGGG - Intergenic
1061930277 9:133828822-133828844 GTGTGGAAGGCGAGGCTGGAGGG - Intronic
1062099271 9:134719748-134719770 GTTGGTAAGAGGACGGAGGATGG + Intronic
1062109873 9:134776455-134776477 ACTTGGAAGCAGAGGGTGGAAGG + Intronic
1062129699 9:134885768-134885790 GTTTTCCAGCGGAGGGTGGATGG + Exonic
1062478422 9:136740798-136740820 GGATGGCAGAGGATGGTGGAGGG - Intronic
1062572095 9:137190447-137190469 CCTTGGGAGAGGAGGGAGGAGGG + Intergenic
1062683689 9:137799041-137799063 GTGTGGAAGAGGACGCTGGAGGG - Intronic
1062683708 9:137799121-137799143 GTGTGGAAGAGGACGCTGGAGGG - Intronic
1202629531 M:5202-5224 CCTAGGGAGAGGAGGGTGGATGG - Intergenic
1185915483 X:4029775-4029797 CTTTGCAGGAGGAGAGTGGAAGG + Intergenic
1186024650 X:5296033-5296055 ATTTGGAAGACGAAGGTGGGAGG + Intergenic
1186514489 X:10156444-10156466 ATTTGAAAGGCGAGGGTGGAGGG + Intergenic
1187090338 X:16089490-16089512 GTTTGATAGAGGAGGGTCAAGGG - Intergenic
1187268480 X:17759088-17759110 GTATGGAAGAGGACGGTATATGG - Intergenic
1187492028 X:19761098-19761120 GAGTGGAACAGGAGGTTGGAAGG + Intronic
1187841166 X:23490059-23490081 GCTGGGAAGGGGAGGGGGGAGGG + Intergenic
1187882887 X:23862878-23862900 GGATGGAAGGGGAGGGAGGAGGG + Intronic
1190128385 X:47725124-47725146 GTGAAGGAGAGGAGGGTGGAGGG - Intergenic
1190246076 X:48691235-48691257 GCCTGGAAGAGGAGAGTGGAGGG - Exonic
1190280862 X:48928921-48928943 GTTTGCAGGAAGAGGGAGGAAGG + Intronic
1190461320 X:50678867-50678889 CTTTAGAAAAGGAGGGTGGCAGG - Intronic
1190712008 X:53078214-53078236 ACTTGGAAGGGGAGGGTGCATGG - Exonic
1191791572 X:64976937-64976959 GTGGGGAAGAGGAGGATGGGAGG + Intronic
1192224329 X:69217860-69217882 GTTTGGAAGTAGAGGCTGGATGG + Intergenic
1192573539 X:72225096-72225118 ATTTGCAATAGGAGGGTGTAGGG - Intronic
1193085783 X:77447212-77447234 TTTTGGGAGAGGGGGGTGGAGGG - Intergenic
1193424584 X:81326924-81326946 GTTTGAAAGAGCAGGCTAGAAGG + Intergenic
1193552162 X:82907877-82907899 GTTTGTAAGAGGTTGGAGGAAGG + Intergenic
1195047055 X:101063731-101063753 GTCTGGTGGTGGAGGGTGGAGGG - Intergenic
1195339373 X:103891259-103891281 GTGTGGTGGGGGAGGGTGGAGGG - Intergenic
1195420631 X:104671487-104671509 GCCTGGAAGAGGTGGGTCGATGG - Intronic
1195598704 X:106722131-106722153 GTTTGGAAGAGGAGGGTGGAAGG + Intronic
1195670460 X:107465525-107465547 GTCTGGGAGAGTAGTGTGGAGGG - Intergenic
1195679288 X:107531719-107531741 GTGTGGTAGCAGAGGGTGGAGGG - Intronic
1196898072 X:120357675-120357697 TTTTGGGAGTGGAGGGTGTAGGG - Intergenic
1197705470 X:129631534-129631556 GAGTGGAAGAGGAGGGTACAGGG + Intergenic
1197790451 X:130248955-130248977 GTATGGCAGAGGAGGGTGGGCGG - Intronic
1198244952 X:134821519-134821541 CTTTGGAAGAGGAGGGGGTGGGG - Intronic
1199067712 X:143440146-143440168 GCTTGGAAGAAGTGGGGGGATGG - Intergenic
1199132834 X:144213467-144213489 GATTGGAAGAGCTGGGTAGATGG + Intergenic
1199496801 X:148461167-148461189 GTTTGGATGTGGAGTGTGAAAGG - Intergenic
1199599223 X:149531875-149531897 CTTTGAAAGAGAAGGGTGGGTGG - Intronic
1199736718 X:150692935-150692957 GTATGGAGGGGGAGAGTGGAGGG + Intergenic
1200311441 X:155082380-155082402 GGTTGGCAGTGGAGCGTGGAGGG + Intronic
1200763166 Y:7058373-7058395 GTTGGGAAACGGAGGCTGGATGG + Intronic
1202593818 Y:26515239-26515261 GTGTTGAAGAGAAGTGTGGATGG - Intergenic