ID: 1195601225

View in Genome Browser
Species Human (GRCh38)
Location X:106751277-106751299
Sequence AAGGAGAGCACAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195601218_1195601225 25 Left 1195601218 X:106751229-106751251 CCCTGGTGGTGCAGCTTGGCACA No data
Right 1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG No data
1195601219_1195601225 24 Left 1195601219 X:106751230-106751252 CCTGGTGGTGCAGCTTGGCACAG No data
Right 1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG No data
1195601217_1195601225 26 Left 1195601217 X:106751228-106751250 CCCCTGGTGGTGCAGCTTGGCAC No data
Right 1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195601225 Original CRISPR AAGGAGAGCACAGTGATTGT GGG Intronic