ID: 1195603478

View in Genome Browser
Species Human (GRCh38)
Location X:106774883-106774905
Sequence CAATTTATTTAGGGGGCGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195603472_1195603478 -3 Left 1195603472 X:106774863-106774885 CCAATAAGTGAAAAGGAACTCAA 0: 1
1: 0
2: 0
3: 31
4: 339
Right 1195603478 X:106774883-106774905 CAATTTATTTAGGGGGCGGAAGG 0: 1
1: 0
2: 0
3: 5
4: 101
1195603471_1195603478 0 Left 1195603471 X:106774860-106774882 CCTCCAATAAGTGAAAAGGAACT 0: 1
1: 0
2: 0
3: 12
4: 179
Right 1195603478 X:106774883-106774905 CAATTTATTTAGGGGGCGGAAGG 0: 1
1: 0
2: 0
3: 5
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195603478 Original CRISPR CAATTTATTTAGGGGGCGGA AGG Intronic
905685126 1:39902174-39902196 CAATTTATTTGGGGGGCTACCGG - Intronic
918055918 1:181022361-181022383 CAATTTATTTGGGGGCCGAGGGG - Intronic
920290493 1:204919631-204919653 CACTTTTTTTGGGGGGCAGATGG + Intronic
921998092 1:221443722-221443744 TAATTTTTTTTGGGGGGGGACGG - Intergenic
924319961 1:242838983-242839005 AAATTTTTTTGGGGGGGGGATGG - Intergenic
924379352 1:243447405-243447427 CCTTTTATTTTGGGGGAGGAAGG + Intronic
1062980703 10:1720028-1720050 CAATTTATTTGGTGGGGGGTGGG - Intronic
1063185708 10:3649408-3649430 TAATTAATTTAGGGGCAGGATGG - Intergenic
1064207534 10:13336633-13336655 CAATTTATTTAGATAGGGGAAGG + Intronic
1067513646 10:46916995-46917017 CAATTGATTTAGGAGGGGAAAGG - Intronic
1067648606 10:48134839-48134861 CAATTGATTTAGGAGGGGAAAGG + Intergenic
1070204996 10:74249187-74249209 CAAAGTATTTAGTGGGAGGAAGG + Intronic
1070586058 10:77767185-77767207 CATTTTACTCAGGGGGCAGAGGG - Intergenic
1074113083 10:110436551-110436573 CAATTTTTTTTGTGGGGGGACGG - Intergenic
1074466046 10:113681555-113681577 CAGTTTATTGAAGGGGCTGAAGG + Intronic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1091572090 12:1695795-1695817 CAATTTATTTTGGGAATGGAAGG + Intronic
1094392801 12:29971025-29971047 GAATTTAATTTGGGGGCAGAAGG + Intergenic
1098184630 12:67883345-67883367 CATTTTTTTTGGGGGGCGGGGGG - Intergenic
1100578097 12:95911868-95911890 CAATTTATTTTTGGGGAGGTAGG - Intronic
1103029108 12:117598003-117598025 CAATATATTTTGGGGGCAGGTGG + Intronic
1104269139 12:127266711-127266733 CAATTTCTTAGGGGGTCGGAGGG + Intergenic
1105969211 13:25412823-25412845 CAATTTTTTTTGGGGGGGGATGG + Intronic
1110856101 13:80298598-80298620 AAAATTATTTGGGGGGTGGAGGG + Intergenic
1113598519 13:111551477-111551499 CAATTTAATTAGAGGGCAGTGGG + Intergenic
1115044251 14:28971108-28971130 CATTTTATTTATGGGGCTCAGGG + Intergenic
1117607408 14:57443785-57443807 CTATTTTTTTTGGGGGGGGAGGG - Intergenic
1118388474 14:65276657-65276679 CAGTTAATGTAGGGGGGGGAGGG - Intergenic
1121869436 14:97393751-97393773 TTATTTATTTATGGGGAGGAGGG + Intergenic
1125379200 15:39069499-39069521 GAATTTATTGAGGGGGGGCAGGG - Intergenic
1126000898 15:44208807-44208829 AAAGTTATTATGGGGGCGGAGGG + Intergenic
1127235008 15:57039648-57039670 AAGTTTATTTTGGGGGCTGAGGG - Intronic
1133827980 16:9295892-9295914 CAGTTTGTTTTGGGGGTGGAGGG - Intergenic
1134812804 16:17181730-17181752 CAATTCATTTGGGAGGAGGAAGG - Intronic
1135326346 16:21528169-21528191 CACTTTATTTTGGGGGGGCATGG + Intergenic
1136162790 16:28431662-28431684 CAATTTATGGAGGAGGAGGAAGG - Intergenic
1136200176 16:28683326-28683348 CAATTTATGGAGGAGGAGGAAGG + Intergenic
1136216524 16:28797519-28797541 CAATTTATGGAGGAGGAGGAAGG + Intergenic
1136415565 16:30101278-30101300 CAATTTTTTTGGGGGGTGGGTGG - Intergenic
1140266881 16:73428653-73428675 TAATTTATTTATGGTGGGGAGGG - Intergenic
1140988377 16:80182649-80182671 CAACTTTTTTGGGGGGAGGAGGG + Intergenic
1149329306 17:55565092-55565114 CATTTTATTTTGGAGGAGGAGGG + Intergenic
1150464930 17:65384609-65384631 GAATTTATTTGGGGGGATGATGG + Intergenic
1151802984 17:76388573-76388595 CAATTTTTTTGGGGGGGGGCGGG - Intergenic
1159969760 18:74634968-74634990 GAATTTATTTTGGAGGAGGATGG + Exonic
1162596987 19:11637063-11637085 TAATTTTTTTTGGGGGGGGATGG + Intergenic
1162641245 19:12012013-12012035 AAAATTTTTTGGGGGGCGGAGGG - Intergenic
1163002075 19:14374895-14374917 CAATTTTTTGAGGGGGGGCAGGG - Intergenic
1165203960 19:34168217-34168239 AAGTTTATTTGGGGGGAGGATGG - Intergenic
929189114 2:39123304-39123326 CATTTTATTTGGGGGCAGGAGGG - Intronic
929853642 2:45616193-45616215 CAATTTATTAAGGTGGAAGATGG - Intergenic
930735794 2:54777251-54777273 CAAATTATTTAGGGTGGGGGTGG + Intronic
931008119 2:57876078-57876100 CAATTCATTTAGGGGTCAGTTGG + Intergenic
935359254 2:102233574-102233596 CATTATATTTAGGGAGGGGAGGG - Intronic
936878812 2:117224756-117224778 GAATTATTTTAGGGGGCAGAAGG + Intergenic
937527961 2:122794308-122794330 CATTTTATTTAAGTGGCTGAGGG + Intergenic
938241018 2:129742344-129742366 CAATTTAGTTAGGGCACAGAAGG + Intergenic
940001981 2:148975584-148975606 GAATCTATTTAGGGTGTGGAGGG + Intronic
943836633 2:192522500-192522522 AAATTTATTCAGGGAGCAGAGGG + Intergenic
944313044 2:198256729-198256751 CAACTGATTTAGGGAGCAGATGG - Intronic
944635273 2:201670272-201670294 TAATTTTTTTGGGGGGAGGAGGG + Intronic
1178615348 21:34128361-34128383 CGGTTGATTTGGGGGGCGGAGGG - Intronic
1184627253 22:45745344-45745366 CAATTTCCTTGGCGGGCGGAAGG - Intronic
950834028 3:15902429-15902451 TAATTTTTTTGGGGGGGGGATGG + Intergenic
951651462 3:24955684-24955706 CCTTTTTTTTAGGGGGTGGAAGG + Intergenic
952073388 3:29667113-29667135 CAATTTATTTGGGGAAAGGAGGG - Intronic
959386887 3:105720240-105720262 CTATTTGTTTAGGAGTCGGATGG - Exonic
961583776 3:127905041-127905063 AAATTTATTTTGGGGGGGTAAGG - Intergenic
962303944 3:134269379-134269401 TAATTTTTTTTGGGGGGGGATGG - Intergenic
966599102 3:181757381-181757403 AAATTTATTTAGGTGTGGGAAGG + Intergenic
971007535 4:22391873-22391895 CCATTAATTTTGGGGGCGGGGGG - Intronic
971489485 4:27196119-27196141 CAATTAATATAGGGAGTGGATGG + Intergenic
972585250 4:40431681-40431703 AAATTTATCTAGGAGGTGGATGG + Intronic
974485953 4:62506228-62506250 CAGGTTGTTTAGGGGGCCGAAGG + Intergenic
978562247 4:110045530-110045552 CAATTTTTTTGGGGGGTGGGGGG - Intergenic
981093290 4:140755577-140755599 CAATATTTTTAAGGGGGGGAGGG + Intronic
983850497 4:172574392-172574414 CAATTTATTTATGTGGGGTAAGG - Intronic
983994763 4:174168702-174168724 CAAAATATTTTGGGGGGGGATGG + Intergenic
986597092 5:9435060-9435082 CAATTTATTTATGTGGCAAAGGG + Intronic
992389417 5:76316590-76316612 AAATTTATTTAGGGGCTGGAGGG + Intronic
997868234 5:137483644-137483666 CAATTTATTTTGGGGTTGGAGGG + Intronic
997937736 5:138129124-138129146 CAACTTTTTTGGGGGGCAGAGGG - Intronic
998212856 5:140214426-140214448 CAATTTATTCAGCTGGCTGATGG + Intronic
998467846 5:142360012-142360034 TATTTTATTTAGGGTGAGGAAGG + Intergenic
1001909616 5:175504726-175504748 CAATTTTTTTTGGGCGGGGAGGG + Intronic
1004536819 6:16511195-16511217 TAATTTAGTTAGGGAGAGGAAGG + Intronic
1008284466 6:49630581-49630603 TAATATATTTAGAGGGAGGAAGG - Intronic
1012086462 6:94832019-94832041 CATTTTATTTTGGGTGTGGAAGG - Intergenic
1013072099 6:106738724-106738746 CAGTTTAATTAGGGGGTGGATGG - Intergenic
1015032958 6:128617889-128617911 CAATTCATTTGGGGGTAGGAGGG + Intergenic
1015939369 6:138432707-138432729 CTAGTTATTCAGGGGGCGGAGGG - Exonic
1017821106 6:158049603-158049625 CAACTTGTTTAGGGGATGGAGGG + Intronic
1019928190 7:4206749-4206771 GAATTTATTTAGGAGAAGGATGG - Intronic
1023763950 7:43493417-43493439 CCATTGATGTAGGGGGGGGAAGG + Intronic
1025651736 7:63476169-63476191 CAATTTTTTTTTGGGGCGGGGGG + Intergenic
1028354497 7:89889050-89889072 ATATTTATTTAGGAGACGGATGG + Intergenic
1030562734 7:111111399-111111421 CATTTTTTTTTGGGGGGGGATGG - Intronic
1030884317 7:114919993-114920015 CAATTTACTTATAGGGCCGATGG + Intergenic
1031227580 7:119060255-119060277 CCTTTTATTTTGGGGGTGGAGGG + Intergenic
1034963935 7:155379918-155379940 CAATTAACTTGGGGGGCAGAGGG - Intergenic
1044431028 8:92106878-92106900 CAGTTTATTTGGGGGGATGATGG - Intergenic
1050522209 9:6512709-6512731 CATTTTATGTTGGGGGCGGGGGG - Intergenic
1055042695 9:71892643-71892665 AAATTAATTTGGGGGGGGGAAGG + Intronic
1185751797 X:2616617-2616639 CAATTTATTTTGATGGCGGCGGG + Intergenic
1190789949 X:53689230-53689252 TAATTTTTTTTGGGGGGGGAGGG + Intergenic
1195603478 X:106774883-106774905 CAATTTATTTAGGGGGCGGAAGG + Intronic
1196091580 X:111749628-111749650 CAATTTATTTAGGTTGCGTTTGG + Intronic