ID: 1195607052

View in Genome Browser
Species Human (GRCh38)
Location X:106817946-106817968
Sequence ACTTTGTTCTAGGAAATAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 172}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195607050_1195607052 17 Left 1195607050 X:106817906-106817928 CCTATGGGAGAAATTAACTGGTT 0: 1
1: 0
2: 0
3: 16
4: 173
Right 1195607052 X:106817946-106817968 ACTTTGTTCTAGGAAATAGTAGG 0: 1
1: 0
2: 2
3: 22
4: 172
1195607049_1195607052 18 Left 1195607049 X:106817905-106817927 CCCTATGGGAGAAATTAACTGGT 0: 1
1: 0
2: 0
3: 8
4: 122
Right 1195607052 X:106817946-106817968 ACTTTGTTCTAGGAAATAGTAGG 0: 1
1: 0
2: 2
3: 22
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195607052 Original CRISPR ACTTTGTTCTAGGAAATAGT AGG Intronic
901568623 1:10140749-10140771 AGTATCTTCTAGGACATAGTTGG + Intronic
902993842 1:20208611-20208633 ACTTTATTCTAGGAAATACTTGG - Intergenic
904990845 1:34591302-34591324 ACTTCATCCTAGGAAAGAGTAGG + Intergenic
908868941 1:68585411-68585433 ATTCTGTCCTAGAAAATAGTAGG - Intergenic
909007378 1:70292539-70292561 GTTTTGTTTTAGGAAAGAGTAGG - Exonic
909011807 1:70343284-70343306 ACTTAGTTTTATGATATAGTTGG - Intronic
909509991 1:76441684-76441706 CCTTTATTCTATCAAATAGTAGG + Intronic
911875625 1:103159012-103159034 ACTTTGTTCTAGCAACTGATTGG + Intergenic
914385005 1:147160201-147160223 ACTTTGTTCAAGGATAGAGAGGG - Intronic
916919841 1:169453151-169453173 GTTTTGTTCTTGGATATAGTAGG - Intronic
917502995 1:175602968-175602990 CCTTTATTCTAGGAAAGATTTGG - Intronic
918905470 1:190486933-190486955 ACTTTTTTCTAGGAAGTGCTTGG - Intergenic
919341146 1:196308474-196308496 ACTTTGGTGTAGGCAAAAGTGGG - Intronic
1064653257 10:17530915-17530937 AATTAGTTCTAGGAACTTGTTGG - Intergenic
1064822203 10:19350042-19350064 AGATTGTGCTAGGAAATATTGGG + Intronic
1068616248 10:59121020-59121042 ACTTTGTAATAGCAAATATTTGG - Intergenic
1070080416 10:73180821-73180843 CCTTTGTGCTATGAAATAGTAGG + Intronic
1071186174 10:83048677-83048699 ACTGTGGTCTTGGAAACAGTAGG - Intergenic
1071771517 10:88734135-88734157 AATTTCTACTAGGAATTAGTAGG - Intronic
1072225447 10:93364482-93364504 ACTCTGTTTTAAAAAATAGTGGG - Intronic
1072234163 10:93438798-93438820 AGTTTGTTCTATTAAATAATTGG - Intronic
1073520602 10:104125372-104125394 ACTTCTATCTAGGAAAAAGTAGG - Intronic
1073750126 10:106516021-106516043 ACTTTTTCCTAGGGAATAGTGGG - Intergenic
1075681793 10:124338639-124338661 ACTTTGTTGTATGAACTAGGGGG + Intergenic
1077983861 11:7331111-7331133 TCTTTGTTATAGGAATTAATAGG + Intronic
1078292066 11:10021938-10021960 ACTTTTTTCTGGGAAAGAATGGG - Intronic
1078702454 11:13699790-13699812 AATATGTTCAAGGAAAAAGTTGG - Intronic
1078777584 11:14407929-14407951 ACTTTTTTCTGGGAATTAATTGG + Intergenic
1080073430 11:28117502-28117524 ACTTGGTTTTAGAAAATAGTTGG - Intronic
1081389039 11:42507157-42507179 TCTTTATCCTAGGAAATATTTGG + Intergenic
1084783568 11:71428356-71428378 ACTTTATTATATGAAATAGATGG - Intronic
1084922277 11:72480764-72480786 AGTTTGTTATAGCAAATACTAGG + Intergenic
1085232002 11:74980224-74980246 ACTTTTTTCTAGAAAATAGAGGG + Intergenic
1085501223 11:77026672-77026694 TCATTTTTCTAGAAAATAGTAGG + Exonic
1086226975 11:84523880-84523902 AATTTTTTCTAAGAAATATTAGG - Intronic
1086251931 11:84826265-84826287 CTTTTGTGCTAGCAAATAGTAGG + Intronic
1087641766 11:100762648-100762670 ACTTTGTTCAAGTAAATGTTAGG + Intronic
1087979404 11:104592807-104592829 ATTTTGTTCAATGAAATTGTGGG - Intergenic
1087986254 11:104684485-104684507 ACTTTGTTCCAGGCATTAGTGGG + Intergenic
1088991793 11:114960442-114960464 ACTTGGTTCTAGGCAGTAGTAGG + Intergenic
1092489373 12:8931245-8931267 ACTGTTTTCTAGGAATTACTGGG + Intronic
1095653752 12:44645113-44645135 AATTTCTTCTAGGAAATAAGAGG + Intronic
1095896483 12:47285193-47285215 AATTTGTTCTAGGAAAAAGGAGG + Intergenic
1097350577 12:58544223-58544245 GCTTTGTTCTAGGATATTTTAGG + Intronic
1097591354 12:61579428-61579450 ACTTAGTTCTAGGCAATTTTAGG - Intergenic
1099434372 12:82626050-82626072 ACTTTGTTCTGTTAAATATTTGG + Intergenic
1099825982 12:87778944-87778966 TCTTTGTGCTATGAAATACTAGG + Intergenic
1101601969 12:106217597-106217619 AATTTGTACTAAGAAATATTAGG - Intergenic
1102325999 12:111984527-111984549 ACCTTGTGCTATCAAATAGTAGG - Intronic
1102859256 12:116321225-116321247 ACTTTATTCTAGGAACAAGTGGG - Intergenic
1103111533 12:118283775-118283797 AATTTTTTATAGGAAATGGTGGG + Intronic
1108442024 13:50464438-50464460 ACTTTGTTTTATGAAAAAGAGGG - Intronic
1108847912 13:54697951-54697973 ACTTTGTACAAGGAAATATGAGG + Intergenic
1110361078 13:74626510-74626532 ACTTTCTTCCAGAAAATAGATGG + Intergenic
1111238946 13:85449566-85449588 ACTGAGTTCTAGGAAAAAGTGGG + Intergenic
1112766919 13:102755364-102755386 TCTTTGCTATTGGAAATAGTGGG - Intronic
1112989061 13:105488602-105488624 AATTTGTTCTGGAAAATAATGGG - Intronic
1115554497 14:34533874-34533896 ATTTTGTTCTAAGAAACATTAGG + Intronic
1117637952 14:57766355-57766377 ACTTTGCTGTAGGAAATGGAGGG + Intronic
1118876671 14:69791598-69791620 ACTTTGTTCTTGAAAATCATGGG - Intronic
1119811449 14:77523817-77523839 ACTTTGTTCTTGGAATCAGTAGG - Intronic
1126198769 15:45961573-45961595 ACTTTGATCCAGAAAATAGTTGG + Intergenic
1126216902 15:46165873-46165895 ACTTTGATCAAGAAAATAGTGGG + Intergenic
1126450154 15:48798729-48798751 ATTTTTTTCTAGAAAATAATAGG - Intronic
1126842268 15:52728628-52728650 TCTGTTTTCAAGGAAATAGTTGG - Intergenic
1127111324 15:55674400-55674422 ACTTTCTTCAAGGATATAGAGGG + Intronic
1130769113 15:86906614-86906636 ATTTTCTTCCAGGAAAGAGTGGG - Intronic
1134572116 16:15299931-15299953 CCATTGTGCTAGCAAATAGTAGG - Intergenic
1134730265 16:16456113-16456135 CCATTGTGCTAGCAAATAGTAGG + Intergenic
1134937163 16:18255782-18255804 CCATTGTGCTAGCAAATAGTAGG - Intergenic
1138211746 16:55168878-55168900 ACCTTGTTCTAGGTAATAGGAGG + Intergenic
1138325497 16:56162702-56162724 ACTTTGTTGAAGGAAAGAGAAGG + Intergenic
1141707710 16:85677345-85677367 TCTTTGTTGTAGGTAACAGTGGG - Exonic
1151021030 17:70617664-70617686 TCTTTGTTCTTGGAAATAACTGG - Intergenic
1151253272 17:72854531-72854553 ACTTTATGCTTAGAAATAGTAGG - Intronic
1153613817 18:6915541-6915563 AATTAGTTTTAGAAAATAGTTGG - Exonic
1155792656 18:29994059-29994081 AGTGTATTTTAGGAAATAGTTGG + Intergenic
1158852205 18:61505875-61505897 ACTTAGTTTTAGCAAATAGATGG - Intronic
1160380847 18:78454141-78454163 AATTTGTTCAAGCTAATAGTTGG - Intergenic
926589425 2:14724336-14724358 GCTTTGATCTAGGAAATGGGAGG - Intergenic
929943152 2:46350300-46350322 ACTTTATAATAGGAAATAGCTGG + Intronic
931745068 2:65284753-65284775 AAATTGTGCTATGAAATAGTTGG - Intergenic
933068747 2:77832601-77832623 ACTTTGTTGCAGGAGATAGTGGG - Intergenic
933516643 2:83312184-83312206 ATTTTGTTGTAGGAAAGAGAAGG + Intergenic
934800677 2:97154798-97154820 ATTTTCTTCTAGCAAATAATAGG + Intronic
938590666 2:132733020-132733042 AATTTGTTCTAGAGAATAGTGGG - Intronic
938658553 2:133461870-133461892 ACTTTGATATTGGAAATATTAGG - Intronic
938658680 2:133463489-133463511 ATTATTTTCTAGCAAATAGTTGG + Intronic
939086435 2:137724288-137724310 ATGTTGTGCTATGAAATAGTAGG - Intergenic
939672984 2:145036559-145036581 ACTTTGCTCTAGTTCATAGTTGG + Intergenic
940317420 2:152339766-152339788 ATTTTGTTTTAGGAAGGAGTGGG + Intronic
941264627 2:163345149-163345171 AATTAGCTCCAGGAAATAGTTGG - Intergenic
943510748 2:188824099-188824121 ACTTTGTTCAAGGAATCAGCAGG - Intergenic
945091279 2:206178335-206178357 GGATTGGTCTAGGAAATAGTAGG - Intronic
946132744 2:217619975-217619997 ACTATGTTCCAGGGAATATTTGG + Intronic
947686575 2:232091221-232091243 CTGTTGTGCTAGGAAATAGTAGG + Intronic
1170407958 20:16059345-16059367 ACTGTGTTCTGGGAAACACTTGG + Intergenic
1170697009 20:18668273-18668295 ACCTGGTTGTAGGATATAGTTGG + Intronic
1171230050 20:23476904-23476926 AGTTTGTTCCAGGGCATAGTTGG + Intergenic
1173941739 20:46916689-46916711 CCTTTCTTCTGGGATATAGTGGG + Intronic
1175045113 20:56097576-56097598 ACTGTGTTTTAGGAAAAAATAGG - Intergenic
1177257576 21:18685856-18685878 ACTTTGTTCTAGAACTTAGAAGG - Intergenic
1177937207 21:27364493-27364515 ACTTTATTCAAGGAAATATGTGG - Intergenic
1178305932 21:31489978-31490000 AGTTTGTTCTAGGAAAAAAAAGG + Intronic
1178598271 21:33974261-33974283 ACTCTATTCAAAGAAATAGTCGG - Intergenic
1182248615 22:28981495-28981517 ACTTTCTCCTAAGAAATACTAGG - Intronic
1183955192 22:41375789-41375811 GCTTTGTTCTTGGTACTAGTAGG - Intronic
1184596733 22:45518472-45518494 TCTTTCTTCTAGGAAGGAGTGGG + Intronic
952654623 3:35770284-35770306 AACTTGTCCTAGGAAAGAGTGGG + Intronic
952782461 3:37115259-37115281 ACTTTATACTAGGAAAAAGTAGG - Intronic
954050443 3:47971187-47971209 ACTTTGTTCCAGGAATTTGGTGG + Intronic
955160112 3:56457224-56457246 ACTTTGTCCTAGGTGATATTGGG + Intronic
958937910 3:100277559-100277581 GCTTTGTTCTCTGGAATAGTAGG + Intronic
960429727 3:117554374-117554396 ACTTTCTTTTAGGTAAAAGTAGG + Intergenic
960629376 3:119714035-119714057 AATTTATTCTAGGAAATAACTGG - Intronic
963422828 3:145083237-145083259 ACTTTGTTGAAAGTAATAGTGGG + Intergenic
963481768 3:145884638-145884660 ACCTTGTGCTAGCACATAGTGGG + Intergenic
971824253 4:31600077-31600099 ACTTTATTCTAGAAAAAAATAGG - Intergenic
971926354 4:33014177-33014199 ACTTTGTGCCAGAAAATATTCGG + Intergenic
973669725 4:53203902-53203924 ATTTTGGTCTAGGAATTAATTGG + Intronic
973777250 4:54254939-54254961 AATTTGCCCTAGGAAATTGTGGG + Intronic
974158737 4:58109259-58109281 AATTTGTTTAAGGAAGTAGTGGG - Intergenic
974731639 4:65874373-65874395 ACTTTATTCAAGGATACAGTTGG + Intergenic
974979043 4:68930349-68930371 ACTTTCTTCATGGAAATATTAGG - Intronic
975663352 4:76709125-76709147 TCTGTGTTCCAGGAAATAGAAGG + Intronic
976098219 4:81532003-81532025 TCTTTGTGATAGGAAATAGTTGG - Intronic
976391427 4:84508786-84508808 AATTGGATCCAGGAAATAGTGGG - Intergenic
977300109 4:95257707-95257729 ACTTTGTTCATGGAAATAATGGG - Intronic
977733748 4:100385779-100385801 ACTTTTTTAAAGGAAATAATTGG + Intergenic
980715582 4:136624484-136624506 ACTTAGTTCTAGGAAGTTGGAGG - Intergenic
980823644 4:138047844-138047866 AGATTTTTCTAGGAACTAGTTGG - Intergenic
981776277 4:148371248-148371270 CCATTGTGCTAGGAAATACTAGG + Intronic
983352396 4:166607991-166608013 ACTTTGTTCTGGATCATAGTAGG - Intergenic
983455794 4:167962839-167962861 AGTTTGTTTTAGGAAAAAGGTGG - Intergenic
983967510 4:173831029-173831051 ACAGTGTTCTAGGCAATTGTTGG - Intergenic
986440318 5:7775736-7775758 GCCTTGTGCTATGAAATAGTAGG + Intronic
987205336 5:15619489-15619511 ACATAGTTCTAGAAAACAGTGGG - Intronic
988728982 5:33951323-33951345 ACTTTGCTCTTGGAATCAGTGGG - Intronic
991447668 5:66717454-66717476 ACTGTTTTCTAGCAAATTGTGGG + Intronic
991979148 5:72213523-72213545 ATTTTGCTTTAGGAAATGGTTGG - Intergenic
992838488 5:80664026-80664048 ACTGTGTTCTAGTACATGGTAGG + Intronic
993135932 5:83964369-83964391 ACTTAGTCATAGGAAATAGGTGG - Intronic
993158392 5:84257045-84257067 ACTTGGTTATAGGACAGAGTGGG - Intronic
993890951 5:93472385-93472407 ATCTTGTGCCAGGAAATAGTAGG + Intergenic
995587331 5:113661666-113661688 TGTTTGTTATAGGAAATAATTGG - Intergenic
996459872 5:123729688-123729710 ATTTTGTGCTATCAAATAGTAGG - Intergenic
996459979 5:123731030-123731052 ATTTTGTGCTATCAAATAGTAGG - Intergenic
998678413 5:144436549-144436571 AATATTTTCTAGGAAGTAGTTGG - Intronic
1000496942 5:161995877-161995899 CCTTTATTCTAGGACATAATTGG + Intergenic
1000502724 5:162071958-162071980 ACTGGGTTCTGGGAAATACTGGG - Intronic
1000715244 5:164635365-164635387 ACATTGTTCAATGAAATATTTGG + Intergenic
1000786272 5:165548112-165548134 AGTGTGTTCCATGAAATAGTTGG - Intergenic
1000810301 5:165853373-165853395 AGTTTGTTTTGGGAAATAGTGGG - Intergenic
1008826321 6:55698299-55698321 CCTTTCTTCAAGGAAATACTAGG - Intergenic
1010872209 6:81057558-81057580 ACTTTGTTCTGGAAAACATTTGG - Intergenic
1012217734 6:96608711-96608733 AGTTTGTTCTGTGAAAAAGTGGG - Intronic
1012727028 6:102826461-102826483 TATTTGCTCCAGGAAATAGTTGG - Intergenic
1013940359 6:115653584-115653606 ATTTTCTTCTGGGAAATACTGGG + Intergenic
1014581227 6:123139725-123139747 GATTTGTGCTTGGAAATAGTGGG - Intergenic
1015318961 6:131849627-131849649 ACTTTGTGCTATGAAAAAGTTGG - Intronic
1015641193 6:135334580-135334602 ACTTTATTATAAGAAATAATCGG + Intronic
1017393928 6:153974238-153974260 ACTTTATTCAAAGAATTAGTAGG - Intergenic
1017401896 6:154074047-154074069 AATTTTTTCTATGAAATAGGAGG + Intronic
1020962847 7:14827597-14827619 AATTTCTTCCAGGAAATATTGGG + Intronic
1022277037 7:28865529-28865551 CATTTGTTCCAGCAAATAGTTGG - Intergenic
1028009482 7:85622821-85622843 CTGTTGTTCTAGGAAATACTAGG + Intergenic
1028055552 7:86237234-86237256 ATTTTTTTCAAGGAAATAGTAGG - Intergenic
1032875008 7:136029033-136029055 ATTTTCTTGAAGGAAATAGTTGG + Intergenic
1033423208 7:141220675-141220697 ATTTTGTGCTGGGAATTAGTTGG + Intronic
1035087788 7:156276011-156276033 ACTTAGTTCTAGGAAGTTGGTGG - Intergenic
1035338653 7:158146419-158146441 ACATTATTCTAAGAAATAATAGG + Intronic
1042023401 8:64396330-64396352 ACATTGTGCTAGAAAAAAGTAGG + Intergenic
1043141685 8:76597889-76597911 TCTTTAATCTAGGAAATAGGAGG - Intergenic
1044704089 8:94991898-94991920 TATTTGTTGTAGGAAATATTTGG - Intronic
1045293350 8:100852225-100852247 TCTATGTTCTAGTAAATAGAGGG - Intergenic
1046580005 8:116080570-116080592 ACTTTGTTGTAGGTTATATTTGG - Intergenic
1047025831 8:120823515-120823537 AGTTTGTTTTAGGAAAGAGAGGG - Intergenic
1048724891 8:137372417-137372439 ACCTTGTCCTAGGAAAGAGGTGG - Intergenic
1050764692 9:9117678-9117700 AGTTTATTCTAGGAAAGACTAGG - Intronic
1050823252 9:9910421-9910443 ATTTTCTTCTAGAAAATCGTGGG - Intronic
1052977772 9:34424314-34424336 ATTTTGTTCTAAGAAATTATGGG + Intronic
1053086528 9:35228274-35228296 ACTTTTTTCTGAGAAAAAGTCGG - Intronic
1054970244 9:71077496-71077518 TCTTTCTTCCAGGAAACAGTGGG + Intronic
1055814932 9:80193912-80193934 ACTATGTTATTGGAAATAGTTGG + Intergenic
1056341036 9:85632071-85632093 ACTTTTTTTTAGTACATAGTAGG + Intronic
1058027619 9:100159556-100159578 AGTGTGTTCTAGCAAATAGGAGG - Intronic
1058657907 9:107241519-107241541 ATTTTTTTGTAGTAAATAGTAGG - Intergenic
1059859343 9:118441044-118441066 ACTTTGTTGTAGGAATTAGTTGG - Intergenic
1192165842 X:68827304-68827326 ACTTGGTTCTTGACAATAGTAGG + Intergenic
1194052249 X:89084255-89084277 ACTTTTTTCTTTGAAATATTTGG + Intergenic
1194289072 X:92046485-92046507 AATTTGTTCCAAGAAATAGACGG - Intronic
1195607052 X:106817946-106817968 ACTTTGTTCTAGGAAATAGTAGG + Intronic
1196280202 X:113815221-113815243 AATGTTTTCGAGGAAATAGTTGG - Intergenic
1198237940 X:134753776-134753798 ACTTTGTTCCAGGATGTGGTGGG - Intronic
1199835653 X:151587498-151587520 GCTTTGGTCTAGGAAAGACTGGG + Intronic
1200050913 X:153431224-153431246 ACTTTGTTCAAGGCATCAGTGGG - Intergenic
1201912393 Y:19146077-19146099 ACTTTGGTTTAGGAAAGAGAGGG + Intergenic