ID: 1195608217

View in Genome Browser
Species Human (GRCh38)
Location X:106834382-106834404
Sequence CTAGTCCTGCCCTTGACACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2091
Summary {0: 2, 1: 52, 2: 285, 3: 599, 4: 1153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195608213_1195608217 -1 Left 1195608213 X:106834360-106834382 CCCATGATTCAATTATCTCCACC 0: 604
1: 1360
2: 3314
3: 7007
4: 7720
Right 1195608217 X:106834382-106834404 CTAGTCCTGCCCTTGACACGTGG 0: 2
1: 52
2: 285
3: 599
4: 1153
1195608214_1195608217 -2 Left 1195608214 X:106834361-106834383 CCATGATTCAATTATCTCCACCT 0: 674
1: 1377
2: 2628
3: 5091
4: 7303
Right 1195608217 X:106834382-106834404 CTAGTCCTGCCCTTGACACGTGG 0: 2
1: 52
2: 285
3: 599
4: 1153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195608217 Original CRISPR CTAGTCCTGCCCTTGACACG TGG Intronic
Too many off-targets to display for this crispr