ID: 1195611315

View in Genome Browser
Species Human (GRCh38)
Location X:106870488-106870510
Sequence CTTTAGGAAAGTTGGGAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 180}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195611315_1195611319 4 Left 1195611315 X:106870488-106870510 CCTAGTTCCCAACTTTCCTAAAG 0: 1
1: 0
2: 0
3: 16
4: 180
Right 1195611319 X:106870515-106870537 CGTTTTAGTCTAAACAGAAATGG 0: 1
1: 0
2: 0
3: 9
4: 118
1195611315_1195611320 5 Left 1195611315 X:106870488-106870510 CCTAGTTCCCAACTTTCCTAAAG 0: 1
1: 0
2: 0
3: 16
4: 180
Right 1195611320 X:106870516-106870538 GTTTTAGTCTAAACAGAAATGGG 0: 1
1: 0
2: 0
3: 18
4: 256
1195611315_1195611322 29 Left 1195611315 X:106870488-106870510 CCTAGTTCCCAACTTTCCTAAAG 0: 1
1: 0
2: 0
3: 16
4: 180
Right 1195611322 X:106870540-106870562 AAAGTATTCTGAGAGCCAGTGGG 0: 1
1: 0
2: 1
3: 18
4: 177
1195611315_1195611321 28 Left 1195611315 X:106870488-106870510 CCTAGTTCCCAACTTTCCTAAAG 0: 1
1: 0
2: 0
3: 16
4: 180
Right 1195611321 X:106870539-106870561 AAAAGTATTCTGAGAGCCAGTGG 0: 1
1: 0
2: 4
3: 18
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195611315 Original CRISPR CTTTAGGAAAGTTGGGAACT AGG (reversed) Intronic
904350170 1:29899880-29899902 CTTTAGGACAGTTGGGTTCTAGG + Intergenic
906378022 1:45312477-45312499 CTTTAGTAAAAATGGGAACCTGG + Intergenic
907888668 1:58617642-58617664 ATTTGGGAAAGTTGGGAAGTTGG - Intergenic
909115350 1:71527308-71527330 CTTTAGAAAAGTAGGGAAACTGG - Intronic
910830696 1:91458583-91458605 CTTTGAGGAACTTGGGAACTTGG - Intergenic
910955509 1:92699320-92699342 ATTTAGGAAAGATTGGAAATGGG - Intronic
912641177 1:111347105-111347127 TTTTACGAAACTTGGAAACTTGG - Intronic
914976978 1:152375009-152375031 CTTGAGGAAAGTTGGGGTCAGGG - Intergenic
916165565 1:161964326-161964348 CTTCAGGAAAGTGGGTTACTCGG + Intergenic
917052345 1:170938529-170938551 CTTTAGGATGGTGGGGAACATGG + Intronic
917696127 1:177525927-177525949 CTTTAGGAAAATGGGAAAGTAGG + Intergenic
918653711 1:186998611-186998633 CTTAAGAAAAATTGGGAAGTGGG + Intergenic
920642540 1:207767173-207767195 CTTTAAGACACTTTGGAACTGGG - Exonic
920972645 1:210755772-210755794 CCCTAGGAAAGTGGGGATCTGGG - Intronic
922588501 1:226754023-226754045 CTTTTGGAAAGTTTTGAACACGG + Intergenic
923181756 1:231526947-231526969 GTTTTGGAAAGTTGAGATCTTGG + Intergenic
923193586 1:231643075-231643097 CTTCTGTAAAGTTGGGGACTTGG + Intronic
923334596 1:232956678-232956700 CTTTGGGAATGTTGGTACCTGGG - Intronic
923862223 1:237903132-237903154 ATTTAGGAGAGCTGGGATCTTGG - Intergenic
1063341102 10:5263711-5263733 CTTTAGTAAAAATGGGAAATTGG - Intergenic
1064810971 10:19197658-19197680 TTATAGAAAAGTTGGCAACTGGG - Intronic
1067412921 10:46080276-46080298 CTTTAAGAAATTTTGGAACCAGG + Intergenic
1067785695 10:49244425-49244447 CTTTAGAAAATTAGGGACCTGGG + Intergenic
1068061574 10:52074186-52074208 TTTTAAGTAAGTTGGGAAATTGG + Intronic
1069032612 10:63613487-63613509 CTGTAGAAAAATTGGAAACTGGG - Intronic
1070116257 10:73531629-73531651 ATTAAGGAAAGCTTGGAACTGGG - Intronic
1071807099 10:89135149-89135171 CTTTAGACCAGTTGGGAAATGGG + Intergenic
1073889044 10:108076220-108076242 CATTTGGAAAGTTGGGAAGCAGG + Intergenic
1075806591 10:125193527-125193549 CTTTAGGAAAGCTGCGAGCACGG - Intergenic
1077916401 11:6614564-6614586 CTTCAGCAAAGCTGGGAAGTTGG + Exonic
1079154302 11:17930269-17930291 CTATAGGCAAGTTGGGAAGTGGG - Intronic
1087185490 11:95188525-95188547 GTTTATGTAAGGTGGGAACTGGG - Intronic
1087984726 11:104663703-104663725 CTTTAGGAATCTGGGGAACATGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091244522 11:134080851-134080873 ATGTGGGAAAGTTTGGAACTCGG + Intronic
1091929092 12:4380201-4380223 CTTCATGAAAGATGGGAGCTAGG + Intergenic
1093402913 12:18768150-18768172 CTTTAGGAAACTTGTAAAATTGG - Intergenic
1093569223 12:20646629-20646651 CCTTATGAAAGATGGGAACAAGG + Intronic
1094297531 12:28925245-28925267 TCTTAGGAAATTTGTGAACTTGG - Intergenic
1095166096 12:38973828-38973850 ATTTAGTCAAGTTGGGAATTTGG - Intergenic
1095602712 12:44032273-44032295 CTTTAGTAAAGATGGAAAATTGG + Intronic
1096191934 12:49624925-49624947 GTCCAGGAAAGTTGGAAACTAGG + Intronic
1099014368 12:77326259-77326281 TTTTAGGAAAGTTGGGAGACAGG + Intergenic
1100153543 12:91770643-91770665 CTTCAGGAAAGATGTGAAGTGGG + Intergenic
1101796511 12:107979849-107979871 CTTGAGGAAAGTTGGACTCTTGG + Intergenic
1101926258 12:108973728-108973750 CTGTAGGGAAGTTGAAAACTTGG - Intronic
1105428797 13:20318400-20318422 CTTTAGGATGGTGGGGAACACGG - Intergenic
1106320159 13:28630251-28630273 CTTTAGGACATTTAGGAAATAGG + Intergenic
1106809194 13:33342976-33342998 CTTTATAAAACTTGGGAACTGGG - Intronic
1106846677 13:33744453-33744475 CTTCAGAAAAGATGGGACCTTGG + Intergenic
1107833816 13:44397768-44397790 CTCAAGGAAAGTTGGGAGGTGGG + Intergenic
1109559981 13:64034125-64034147 CATTAGGAAGGCTGGGAACTAGG + Intergenic
1110755371 13:79167785-79167807 AGTTCGGAAAGTTTGGAACTGGG + Intergenic
1111834900 13:93375845-93375867 CTTTAGGAAAGTTAGAAATAGGG - Intronic
1115517384 14:34199478-34199500 TATTAGGAAAGTTGGTAAGTTGG - Intronic
1116043605 14:39715959-39715981 CTTTAGGGAAGTTGGAATGTGGG - Intergenic
1116808640 14:49518274-49518296 CTTTTGGAAAGTTGGAAAGTTGG - Intergenic
1118331461 14:64818824-64818846 CTTTTGGAAGGATAGGAACTTGG + Intronic
1119105756 14:71922031-71922053 CTTTGGGAGAGATGGGGACTAGG - Intergenic
1120919863 14:89744976-89744998 CTTCAGGAATGTGGGGAACATGG - Intergenic
1123672363 15:22672013-22672035 CTTGAGGGAAGTTGGCAAATAGG + Intergenic
1124324409 15:28745306-28745328 CTTGAGGGAAGTTGGCAAATAGG + Intergenic
1124528288 15:30478348-30478370 CTTGAGGGAAGTTGGCAAATAGG + Intergenic
1124670424 15:31633994-31634016 CTTTAGGACAGTTCTGAATTTGG - Intronic
1124770369 15:32529355-32529377 CTTGAGGGAAGTTGGCAAATAGG - Intergenic
1126274492 15:46861034-46861056 CTTTAAGGAAGTTGGAAACTGGG - Intergenic
1126752215 15:51888136-51888158 CTTCAGAAAAGTTGGGAAGGTGG - Intronic
1128806239 15:70533126-70533148 CTTCAGGAAGGGTGGGACCTGGG - Intergenic
1130978429 15:88795019-88795041 CAACAGGAAAGTGGGGAACTGGG - Intergenic
1133691274 16:8217839-8217861 CTTTAGGTAAGTAGGGAAGGTGG + Intergenic
1134912285 16:18038500-18038522 CTTCAGTAAAGATGTGAACTGGG + Intergenic
1138999975 16:62498195-62498217 CTTTCTGAATTTTGGGAACTTGG - Intergenic
1140538424 16:75732752-75732774 TTTTAAGAAAGTAGGGTACTTGG - Intronic
1143960761 17:10716629-10716651 TTTTATGAAAGTTGGAAAGTAGG + Intronic
1146238203 17:31187508-31187530 CTTCAGGATGGTTGGGAACATGG - Intronic
1147515637 17:41114999-41115021 CTTTAGTAAAAATGGGAAATGGG + Intergenic
1147815637 17:43208013-43208035 CTGAAAGAAAGCTGGGAACTAGG + Intronic
1150524712 17:65910007-65910029 AGTTAGGAAAGTAGGAAACTTGG + Intronic
1151161791 17:72172166-72172188 TGATAGGAAAGCTGGGAACTGGG - Intergenic
1152315334 17:79577198-79577220 CTTTTGGAAAGTTTAGATCTTGG - Intergenic
1152353108 17:79794263-79794285 CTCTAGGGAAGTTGGGCCCTGGG - Exonic
1152682338 17:81675183-81675205 TTGTAGGAAAGTTGACAACTAGG - Intergenic
1153497796 18:5717723-5717745 CTTTAGGAAAGTTATTAAATCGG + Intergenic
1157054476 18:44210317-44210339 CTTCAGGATAGTGGGGAACATGG - Intergenic
1157671728 18:49535606-49535628 CTTTAATAAAATTGGGAAATTGG + Intergenic
1163105462 19:15120584-15120606 CTTCAGGAAAGTTGGGGCCCTGG - Intronic
1163988806 19:20978578-20978600 CTTTAGAATAGTTAGGAAGTTGG + Intergenic
1165826540 19:38708978-38709000 CTTTAGGGTGGTTGGGACCTGGG + Intronic
927277121 2:21271792-21271814 CTTTAGCTAGGTTGGGGACTTGG - Intergenic
927827025 2:26316253-26316275 GGTGAGGAAGGTTGGGAACTTGG - Exonic
929400412 2:41573966-41573988 ATTTAGGAAAGGAGGAAACTGGG - Intergenic
929728320 2:44457347-44457369 CTTAAGGTAAGTTGGCAAGTTGG - Intronic
931232449 2:60386241-60386263 TTTTACCAAAGATGGGAACTTGG + Intergenic
931487772 2:62710214-62710236 CTGTATGAAAGTTGGCAAGTTGG + Intronic
935526995 2:104182642-104182664 CTTCAGGAAGGTGGGGAACATGG - Intergenic
940636825 2:156307618-156307640 CATTATGAAAGTTGAGAAATAGG - Intergenic
941208848 2:162609982-162610004 CTTTAGGAGAATAGGGAGCTTGG + Intronic
941413806 2:165193699-165193721 CCTGAGGAAAATTGAGAACTGGG + Intronic
942657579 2:178230084-178230106 CCTTAGGAAGGTTGGGTGCTGGG + Intronic
943687731 2:190836819-190836841 CTGAAGGAAATTTGGGAATTAGG + Intergenic
943814584 2:192236514-192236536 CTTTAGGAAAGTTGAAACCAAGG - Intergenic
944309681 2:198219525-198219547 CTTCAGCAAAGTTGAGAACAAGG - Intronic
944894156 2:204146793-204146815 CTTTAGGAAGGAAGGGAAATTGG + Intergenic
945539872 2:211072208-211072230 CTTTAGACAAGATGGGACCTTGG + Intergenic
947804148 2:232953563-232953585 CTTTATGAAAATTAGGAAATGGG + Intronic
948251220 2:236531498-236531520 GTTTAGGAAAGTGGGGAGATGGG - Intergenic
1169741138 20:8895675-8895697 GGTTAGGAAAATTGGGAACTAGG - Intronic
1169883560 20:10373390-10373412 CTTTAAGCAATTTGGGAATTTGG - Intergenic
1171343494 20:24448208-24448230 TTTTAGGAAAATGGGGTACTCGG + Intergenic
1172539548 20:35700000-35700022 CTTTAGGCAAGTTGGAGACTGGG + Intronic
1173435453 20:43028385-43028407 CTTCAGGGAAGTTGGGAGGTGGG - Intronic
1173980117 20:47217517-47217539 CTTTAGGAAGGATACGAACTTGG - Intronic
1174312076 20:49665103-49665125 ATTAAATAAAGTTGGGAACTTGG - Intronic
1179183449 21:39064203-39064225 TTTTAGCAAAGATGGGATCTTGG - Intergenic
1182873143 22:33666156-33666178 ATTCAGGAAAGTAAGGAACTTGG + Intronic
1185010498 22:48310189-48310211 CTTTTGGAAAGAGGGGAAATGGG - Intergenic
949297868 3:2547621-2547643 CATTTAGAAAGTTGGGAACTGGG + Intronic
949312099 3:2711494-2711516 CTTCAGAAAAGTAGGGAATTTGG - Intronic
955373356 3:58372967-58372989 CTGTTGAAATGTTGGGAACTGGG + Intronic
957275673 3:78088363-78088385 TTTTAGAAAAGTTGGAAAGTAGG - Intergenic
957448324 3:80344114-80344136 GTTTGGGAAAGTTGGGAAGCAGG - Intergenic
959943888 3:112107395-112107417 ATTTAGAAAACTCGGGAACTAGG - Intronic
960307450 3:116079194-116079216 ATCTGGGAAAGTTGGGACCTTGG - Intronic
961769222 3:129236429-129236451 CTTTAGGAAGCTTGAGAACATGG - Intergenic
964387670 3:156165982-156166004 CTTTTGCGATGTTGGGAACTGGG + Intronic
964546127 3:157835563-157835585 CTTTGGGCAAGAGGGGAACTAGG - Intergenic
966678683 3:182617334-182617356 CTTTAGGAAAATTCTGAACTGGG + Intergenic
969910710 4:10442960-10442982 CTGTAGGAATATTGGGAGCTAGG - Exonic
972123209 4:35731728-35731750 CTCAAGGAAAGTTGAGTACTAGG + Intergenic
972332299 4:38075342-38075364 TCTTAGGCAAGTGGGGAACTCGG - Intronic
975104004 4:70548226-70548248 CTTTAAGAATGTTGGGGAATTGG - Intergenic
977112509 4:92976586-92976608 CAATAGGCAAGTTGGGAAGTGGG - Intronic
979049604 4:115912794-115912816 ATTTAGGAAAATTAGGAAGTTGG - Intergenic
982666310 4:158268905-158268927 CTTTATGAAAGTAGGGAAGATGG - Intergenic
985501476 5:250352-250374 CTGTAGGTATGCTGGGAACTAGG - Intronic
988924472 5:35975613-35975635 CTTTAGGATGGTGGGGAACATGG - Intronic
989704265 5:44309393-44309415 CTATAATAAAGTTGGGAACTAGG - Intronic
992260600 5:74966493-74966515 TTTTAGGAAAATGGGGTACTTGG - Intergenic
992554773 5:77892493-77892515 CTTTTGGAAAGTTAGGTGCTTGG + Intergenic
992992076 5:82294073-82294095 CTATAGGAAAGCTGGGGTCTTGG - Intronic
994093988 5:95832414-95832436 CTTTATCAAAGTTGGGGACTGGG - Intergenic
996446141 5:123553731-123553753 CTTTGGAAAAATTGGGATCTAGG + Intronic
996452835 5:123646479-123646501 CTTTAAGAAACTTGGCGACTGGG - Intergenic
999020511 5:148160753-148160775 CATTAAGAAAGTAGGGATCTTGG + Intergenic
1000718200 5:164673569-164673591 CTTTTGTGAAGTTGAGAACTAGG + Intergenic
1001032465 5:168272709-168272731 CCTTAGGAATGCTGGGATCTTGG - Intergenic
1004118076 6:12790711-12790733 CTTAAGGAAAGTGAAGAACTAGG + Intronic
1005703046 6:28423048-28423070 CTGTAGGAGGGTGGGGAACTGGG + Intergenic
1006077105 6:31540731-31540753 GTTTAGGGAAAGTGGGAACTGGG - Intronic
1008078174 6:47167724-47167746 CTTTGGGAATCTTGGTAACTGGG + Intergenic
1009671680 6:66761447-66761469 CTTTATTAAAATTGGGAATTCGG - Intergenic
1009953083 6:70418988-70419010 ATTTAGGAAAGATGGCAGCTAGG + Intronic
1011423098 6:87195725-87195747 CATTAGAAAAATTGAGAACTAGG + Intronic
1014931027 6:127336463-127336485 CTTTGGGAAAGCAGGGAAATAGG - Intronic
1016750631 6:147627432-147627454 ATTTAGTAAAATTAGGAACTGGG + Intronic
1019823506 7:3264065-3264087 CTTTAGCTAAGTTGGGAATGGGG - Intergenic
1020424218 7:8045543-8045565 CTGTATAAAAGTAGGGAACTGGG + Intronic
1020571581 7:9870347-9870369 CTTTAGGAAAGTGGGGAATAAGG + Intergenic
1021243493 7:18233887-18233909 CTGTAGGAAACTTGGCAAATAGG + Intronic
1027833112 7:83206137-83206159 GTTTAGGAAAGTTAGACACTGGG - Intergenic
1027975826 7:85154227-85154249 CTTGGGGAGAGTTTGGAACTTGG - Intronic
1030169432 7:106586678-106586700 TTTTAAGAAAGATGGGAACACGG - Intergenic
1030422346 7:109323623-109323645 CTTTGGGACAGTTTGGTACTGGG + Intergenic
1032716879 7:134516458-134516480 CTTTAGGAAGATTGGAAACTGGG - Intergenic
1038381459 8:27098582-27098604 CTATAGGCATGTTGGTAACTTGG - Intergenic
1038656709 8:29459407-29459429 TTTTGGGAAAGTGGGGAACATGG + Intergenic
1039415105 8:37386666-37386688 CTTTGGGAAAGGTGGGAAGCTGG - Intergenic
1041296873 8:56366030-56366052 CTTTAGTAAAATTGGGAAGCTGG - Intergenic
1042092814 8:65177634-65177656 CTTTAGGAAACTTGGCTGCTTGG + Intergenic
1042163748 8:65924485-65924507 CTATACTTAAGTTGGGAACTTGG - Intergenic
1046417482 8:113936536-113936558 CTTTAGGATGGTGGGGAACCTGG + Intergenic
1047330209 8:123880165-123880187 GTGGAGGGAAGTTGGGAACTGGG - Intronic
1047873741 8:129112783-129112805 CTTTTGAAATGTTTGGAACTTGG - Intergenic
1047898169 8:129389903-129389925 TTTTAGGAAAGTTGGGTTCTTGG + Intergenic
1051359612 9:16270375-16270397 CATTAGGAGAGTTGGGGGCTAGG + Intronic
1051860592 9:21621375-21621397 TTTAATGAAACTTGGGAACTGGG + Intergenic
1052319199 9:27149791-27149813 CATAAGGGTAGTTGGGAACTTGG + Intronic
1055994118 9:82139182-82139204 GTTGAGGGAAGTTGGGATCTTGG + Intergenic
1056240986 9:84646526-84646548 CTTTAGAATAGTGGGGAACATGG + Intergenic
1056555658 9:87685163-87685185 CTGTAGGAAAGTTGGCAGATAGG - Intronic
1056899586 9:90585257-90585279 TTTCAGGAAAGGTTGGAACTTGG - Intergenic
1057362057 9:94382312-94382334 GTTTAGGGAAGTTGGGCACATGG - Intronic
1058227514 9:102383566-102383588 CTTGAGGAAAGTTGAGAAGATGG - Intergenic
1185848024 X:3457975-3457997 CCTTAGAAAAGTGGGAAACTTGG - Intergenic
1186457665 X:9722739-9722761 CTTTAAGAAACTGGAGAACTGGG + Intergenic
1187807557 X:23137571-23137593 CTTTAGGAGACTTGGGTCCTTGG + Intergenic
1190220686 X:48510502-48510524 CTATAGGAATCTTGGGGACTTGG - Intronic
1190260018 X:48791721-48791743 CTGTGGAAAAGCTGGGAACTTGG + Intronic
1191009159 X:55743087-55743109 CTTTAGGATGGTGGGGAACATGG + Intronic
1191953519 X:66619729-66619751 CTCTGGGCAAGTTGGGAAGTTGG - Intronic
1193573543 X:83173922-83173944 CTTCAGGATAATTGGGAACACGG + Intergenic
1193602940 X:83531143-83531165 CTTTAGGATAGTTAGGTAATGGG + Intergenic
1194072153 X:89339289-89339311 CTTTAGGATAGTGTGGAACATGG + Intergenic
1194676910 X:96805369-96805391 CTTGAGCAAAGATGGGAACAAGG + Intronic
1195002392 X:100654505-100654527 CTTTAGGAAAGATGGGACACTGG + Intronic
1195611315 X:106870488-106870510 CTTTAGGAAAGTTGGGAACTAGG - Intronic
1200726397 Y:6675040-6675062 CTTTAGGATAGTGTGGAACATGG + Intergenic