ID: 1195615069

View in Genome Browser
Species Human (GRCh38)
Location X:106905674-106905696
Sequence GAGAATCAGCAGAAGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 855
Summary {0: 1, 1: 0, 2: 2, 3: 64, 4: 788}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195615063_1195615069 -4 Left 1195615063 X:106905655-106905677 CCACCTGTAAGTGGCCTCCGAGA 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1195615069 X:106905674-106905696 GAGAATCAGCAGAAGGAAGGAGG 0: 1
1: 0
2: 2
3: 64
4: 788
1195615064_1195615069 -7 Left 1195615064 X:106905658-106905680 CCTGTAAGTGGCCTCCGAGAATC 0: 1
1: 0
2: 0
3: 6
4: 57
Right 1195615069 X:106905674-106905696 GAGAATCAGCAGAAGGAAGGAGG 0: 1
1: 0
2: 2
3: 64
4: 788
1195615061_1195615069 22 Left 1195615061 X:106905629-106905651 CCTGTTGTCACACTCAAGGATCT 0: 1
1: 0
2: 0
3: 9
4: 84
Right 1195615069 X:106905674-106905696 GAGAATCAGCAGAAGGAAGGAGG 0: 1
1: 0
2: 2
3: 64
4: 788

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195615069 Original CRISPR GAGAATCAGCAGAAGGAAGG AGG Intronic
900741636 1:4333794-4333816 GAGAATCAACAGAATGAGGAAGG + Intergenic
901185288 1:7368955-7368977 CAGAAGCAGAAGGAGGAAGGTGG - Intronic
901406546 1:9051191-9051213 GAAAAAGAGAAGAAGGAAGGAGG + Intronic
901676311 1:10888049-10888071 GAGAATCACTTGAAGGCAGGAGG + Intergenic
901737542 1:11321998-11322020 CAGGCTCAGCAGAAGGATGGAGG - Intergenic
901859977 1:12068173-12068195 GACAATCATCAGAAGGAAAATGG + Intronic
902176088 1:14652378-14652400 GAGAAACAGGAGGAGGAAGAAGG - Intronic
903393552 1:22982142-22982164 GAGACACTGCAGAAGGAGGGAGG + Intergenic
904062170 1:27720282-27720304 GACAATGAGGAGAAGGCAGGGGG - Intergenic
905235512 1:36543462-36543484 GAGAATGAGAAGAAGGAAGTGGG - Intergenic
905265548 1:36752301-36752323 GAGAATGAGAAGAACCAAGGAGG - Intergenic
906124443 1:43418838-43418860 GAGCAGCAGCAGGAGGAGGGTGG + Intronic
906150698 1:43585810-43585832 GAGCCCCAGCAGAAGGAAGTAGG - Intronic
906228831 1:44143024-44143046 GAGAGTCAGGACAAGGCAGGAGG - Intergenic
907775262 1:57507842-57507864 GGGTATCAGCAAAAGGTAGGAGG - Intronic
907834781 1:58098491-58098513 GAGCATCAGCAGAGGGTTGGAGG - Intronic
907990082 1:59572337-59572359 AAGAATAAGCAGAAGGAAATTGG + Intronic
908067270 1:60420461-60420483 GTGTCTCAGCAGCAGGAAGGTGG + Intergenic
908242881 1:62202771-62202793 GAGAATCAGTTGAAGCCAGGAGG - Intronic
908267633 1:62394880-62394902 CAGAACCACCAGAGGGAAGGTGG - Intergenic
908411242 1:63867841-63867863 GAGAAGCAGATCAAGGAAGGTGG - Intronic
908571868 1:65419897-65419919 GAGAGGCAGGAGAGGGAAGGAGG - Intergenic
908605123 1:65790448-65790470 GAGCAGAAGCAGAAGGAAGAAGG - Intergenic
909493209 1:76248105-76248127 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
909660005 1:78071531-78071553 AAGAAGAAGGAGAAGGAAGGAGG - Intronic
910033321 1:82759024-82759046 GAGAAACAGGAGGAGGAAGCAGG - Intergenic
910036176 1:82791653-82791675 GAGAAGGAGTAAAAGGAAGGAGG + Intergenic
910275696 1:85446814-85446836 GAGAAGGAGAAGAAGAAAGGAGG - Intronic
910626852 1:89316477-89316499 GAGGGTGAGCAGAAGCAAGGTGG + Intergenic
910838694 1:91540902-91540924 AACAGTCAGGAGAAGGAAGGTGG + Intergenic
911015080 1:93323430-93323452 TACAAGCACCAGAAGGAAGGAGG - Intergenic
911031738 1:93496240-93496262 GAAAAAGAGGAGAAGGAAGGGGG - Intronic
911047234 1:93638676-93638698 GGTAAACAGCAGGAGGAAGGTGG + Intronic
911284693 1:95975209-95975231 AAGAATGAGGAGAAGGAGGGTGG - Intergenic
911573344 1:99544225-99544247 GACATTCATCAGAGGGAAGGGGG + Intergenic
912032461 1:105265677-105265699 GAGGGTGAGCTGAAGGAAGGTGG - Intergenic
912407001 1:109447655-109447677 GGGATTGGGCAGAAGGAAGGAGG + Intergenic
913117180 1:115708034-115708056 GAGATTCATCAAAAGGAATGTGG + Intronic
914850192 1:151308453-151308475 AAGAAAAAGCAGATGGAAGGAGG + Intronic
914923726 1:151865372-151865394 GAGTTGCAGCAGGAGGAAGGAGG - Intergenic
915657654 1:157375067-157375089 GGGAATGTGCAGAGGGAAGGAGG - Intergenic
915704584 1:157831907-157831929 GAGAACAAGCAGAGGGCAGGCGG + Exonic
916116967 1:161493605-161493627 GGGAGTCAGCAGAAGGTAGGAGG + Intergenic
916616378 1:166445534-166445556 TAGAAGAAGAAGAAGGAAGGAGG + Intergenic
916875462 1:168963988-168964010 GAGAAACAGGAAAAGGAAGGAGG - Intergenic
917880647 1:179332541-179332563 GAGAAGCGGCAGAAGGGAGGAGG - Intronic
918002434 1:180510084-180510106 GAGACTCAGCAGGGGGAGGGTGG - Intergenic
919197046 1:194299347-194299369 TAGAAACAGAAGAAGGAAAGAGG - Intergenic
919434827 1:197544957-197544979 GAGAAGGAGAAGGAGGAAGGAGG + Intronic
919518274 1:198554751-198554773 GAGAATCCCCAGGAGGAAAGGGG - Intergenic
919799509 1:201344934-201344956 GGGAAGCAGCAGGAGGCAGGAGG - Intergenic
920188270 1:204175979-204176001 GAGGAGGAGGAGAAGGAAGGAGG - Intergenic
920611144 1:207438969-207438991 GAGACTCAGAAGGGGGAAGGTGG + Intergenic
920646497 1:207807752-207807774 GAGTAGCAGGAGGAGGAAGGAGG + Intergenic
920717713 1:208356496-208356518 GGGAATAAGGAGAAGGTAGGTGG - Intergenic
920916595 1:210262578-210262600 AAAAATGAGGAGAAGGAAGGAGG - Intergenic
920947335 1:210542028-210542050 AAGAGAAAGCAGAAGGAAGGAGG - Intronic
922069880 1:222181522-222181544 ATGAATTAGCAGCAGGAAGGGGG + Intergenic
922286967 1:224178673-224178695 GAGAATCACCAGAACTCAGGAGG + Intronic
923688227 1:236169082-236169104 GAGCCTCAGCAGAAGGAAACAGG + Intronic
923703961 1:236327954-236327976 GAGAATTAGAAGAATGGAGGGGG + Intergenic
923831051 1:237557743-237557765 TAGAATCAGCAGAAGGACAAAGG + Intronic
923880900 1:238103173-238103195 GAGACTCAGCAGGGGGAAGGGGG - Intergenic
924116719 1:240754279-240754301 GAGACTGAGCAGAGGGAAGAGGG - Intergenic
924212213 1:241782196-241782218 GAGAATCACCTGAAGCCAGGAGG + Intronic
924549682 1:245063809-245063831 GAGAATCACCTGAAGCCAGGAGG - Intronic
924680364 1:246224882-246224904 CAGAAGCAGAAAAAGGAAGGTGG + Intronic
924719039 1:246605865-246605887 GAGAAGCAGAAGCAGGAAGAGGG - Intronic
924722234 1:246634992-246635014 GAGAAGCAGAAGCAGGAAGAGGG - Intronic
924795644 1:247290488-247290510 GAGAAGCAGAAGCAGGAAGAGGG + Intergenic
924878144 1:248128451-248128473 GAGAGTTAGCAGAAGCAGGGTGG + Intergenic
1062805311 10:415386-415408 GAGAGGCAGCAGGAGGAGGGAGG + Intronic
1062846028 10:706282-706304 GAGAAGGAGAAGAAGGGAGGTGG - Intergenic
1062887836 10:1032510-1032532 GCTACTCAGCAGGAGGAAGGAGG - Intergenic
1063057056 10:2517066-2517088 AAGAAGCAGGATAAGGAAGGAGG - Intergenic
1063330682 10:5155929-5155951 GAGAAGAGGCAGAATGAAGGTGG - Intergenic
1063974305 10:11403104-11403126 GAGGAACATCAGAGGGAAGGGGG - Intergenic
1064662824 10:17623420-17623442 GAGACTCAGAAGCAGGGAGGTGG - Intergenic
1064686512 10:17867312-17867334 AAGAAGAAGAAGAAGGAAGGAGG - Intronic
1064939409 10:20715868-20715890 AAGAAAGAGAAGAAGGAAGGAGG + Intergenic
1065819547 10:29512797-29512819 CAGACTCAGCAGGAGGCAGGAGG - Exonic
1065953308 10:30671608-30671630 CAGACTCAGCAGGAGGCAGGAGG + Intergenic
1066047470 10:31605701-31605723 GAGAAGCAGCAGAGGGTAGAAGG - Intergenic
1068248111 10:54399708-54399730 GAGAATCACCATGAGGAATGAGG + Intronic
1068575076 10:58675980-58676002 GAGAGTGAGCAGAAGCAGGGTGG + Intronic
1068799871 10:61128121-61128143 AAGAATAAGCAAAAGGTAGGAGG + Intergenic
1069917273 10:71795489-71795511 GAGAGTCAGCTGGAGGAAGGGGG - Intronic
1070186375 10:74066759-74066781 GAGAATCAGTAGAACCCAGGAGG - Intronic
1070370552 10:75778165-75778187 GAGAATCACCAGAACCCAGGAGG - Intronic
1070452611 10:76577279-76577301 GAGAATCCACAGGAGGAATGAGG + Intergenic
1070949634 10:80420440-80420462 GAGATTGAGAAGAAGGAAGAAGG - Intronic
1071081232 10:81813989-81814011 AAAAATCAGCAGAGGAAAGGTGG + Intergenic
1071688734 10:87792459-87792481 CAAAATCAGCAAAGGGAAGGGGG - Intronic
1071901742 10:90127961-90127983 GAGAATCAGCTGAAGTCAGGGGG + Intergenic
1072585619 10:96779186-96779208 GAGAATCAGCTGAACCCAGGAGG - Intergenic
1073402055 10:103265801-103265823 GGGAAACAGCAAAAGGTAGGAGG + Intergenic
1074260100 10:111844638-111844660 GAGATTCAGGGGAAGGAGGGAGG - Intergenic
1074376682 10:112946723-112946745 GAGAAGCAGCAGAAGGGCAGTGG + Intergenic
1074540625 10:114362555-114362577 TAGAATCAGCAGAGGGAGCGCGG + Intronic
1074813860 10:117130507-117130529 GAGAAACAGCTGCAGGAGGGGGG - Intronic
1075175387 10:120155855-120155877 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1075187380 10:120275315-120275337 GAGAATCAGTTGAACCAAGGAGG - Intergenic
1075389576 10:122083026-122083048 GAGAGACAGCCGAAGGAAGAAGG + Exonic
1075650069 10:124121919-124121941 AAGAATCAGCAGAATTCAGGTGG + Intergenic
1075661180 10:124197531-124197553 GAGAAGCAGCAAAAGGCAGTTGG - Intergenic
1075696113 10:124436729-124436751 CAGAATGAGATGAAGGAAGGAGG - Intergenic
1077265736 11:1648621-1648643 GGGCATCAGCAGCAGGCAGGAGG - Intergenic
1077760538 11:5091411-5091433 TAGAATCAGAAAAAGGAAGTAGG - Intergenic
1077847300 11:6039524-6039546 CAGAACCAGGAGAAGGAAGGAGG - Intergenic
1077866835 11:6229406-6229428 TAGGATCAGGAGAAGGAAGCAGG - Intronic
1078096993 11:8304810-8304832 AAGAATCAGCAGAAATAAGATGG + Intergenic
1078743803 11:14091975-14091997 GAGGATGAGCAGAAACAAGGTGG - Intronic
1079997744 11:27313500-27313522 GTGCATAGGCAGAAGGAAGGAGG + Intergenic
1080385623 11:31809603-31809625 GAAAATCTGCACAAGGAAAGAGG + Intronic
1080638256 11:34142299-34142321 GAGAAACACAAGAAGGAAGTAGG + Exonic
1081743513 11:45457298-45457320 GAGAAACAGCAGCTGTAAGGGGG + Intergenic
1081789837 11:45774813-45774835 GAACAATAGCAGAAGGAAGGGGG + Intergenic
1081824841 11:46039298-46039320 GAGAATCAGCAGATTGAAAGTGG - Intronic
1082149322 11:48714280-48714302 TAGAATCAGCAAAAGGAATTTGG - Intergenic
1082598508 11:55116251-55116273 TAGAATCAGCAAAAGGAATTTGG - Intergenic
1083034236 11:59621778-59621800 GAGAATCACTAGAACCAAGGAGG - Intergenic
1083859388 11:65411864-65411886 GAGCACCAGCAGGAGGAAGGTGG - Exonic
1084470413 11:69356174-69356196 GAGGATGAAGAGAAGGAAGGAGG + Intronic
1084911913 11:72396277-72396299 GAGAAAAGGCAGAAGGAGGGAGG + Intronic
1085571105 11:77558707-77558729 GAGGAACAGCAAAAGGGAGGAGG - Intronic
1085931554 11:81089343-81089365 GGGAGGAAGCAGAAGGAAGGAGG - Intergenic
1086056116 11:82649065-82649087 AAGAAGGAGCAGAAGAAAGGAGG - Intergenic
1086144228 11:83533918-83533940 GGGAAGGAGCAGAAGGAAGCTGG + Intronic
1086281066 11:85189611-85189633 GAGAGTTAGCAAAAGGAAAGAGG + Intronic
1086455175 11:86954206-86954228 GAGAAGAAGCTGCAGGAAGGTGG - Intronic
1086598188 11:88600260-88600282 GAGAAGGAGCAGGAGGAAGAAGG - Intronic
1087363506 11:97190641-97190663 GGAAATCAGTAGAAGGAATGAGG + Intergenic
1087413937 11:97828448-97828470 GAGAATCACTTGAAGGCAGGAGG - Intergenic
1087806522 11:102561378-102561400 GAGAAGGAAAAGAAGGAAGGAGG - Intergenic
1088011157 11:105002420-105002442 AAGAAAAAGGAGAAGGAAGGGGG - Intronic
1088455776 11:110031329-110031351 GTGAATCACCTGAAGGAGGGTGG - Intergenic
1088652459 11:111970143-111970165 GAGAATCAGCTGAACCTAGGAGG - Intronic
1089256193 11:117195546-117195568 GAGAATCAGAAGGAAGGAGGAGG + Intronic
1089281885 11:117380539-117380561 GAGAGCCAGCAGGAGGATGGAGG + Intronic
1089298571 11:117484096-117484118 GAGAATACCCGGAAGGAAGGAGG - Intronic
1089613113 11:119680726-119680748 GTGAATCAGCACAGAGAAGGGGG - Intronic
1089795607 11:120978097-120978119 AAGAATGAGCAGAAAGAAAGAGG - Intronic
1089798376 11:121002379-121002401 GAGAAGAAGAAGAAGGGAGGGGG + Intergenic
1089871881 11:121682247-121682269 CAGCATCAGCAGAAGTAAGCAGG + Intergenic
1090403688 11:126464983-126465005 GAGGAACAGGAGAGGGAAGGAGG - Intronic
1090923583 11:131230340-131230362 GAAAATAAGCAGAAGGCATGGGG + Intergenic
1091227494 11:133966294-133966316 GACAATGAGCTGATGGAAGGGGG + Intergenic
1091725587 12:2844462-2844484 GAGAATCACCTGAACCAAGGAGG + Intronic
1091992527 12:4967476-4967498 GAGGATGAGTAGAAGGAAGAGGG - Intergenic
1092191452 12:6524252-6524274 GAGAATCAGAGCAAGGAGGGAGG + Intronic
1092884781 12:12915605-12915627 GAGAAGGAGGAGAAGGAAGAAGG - Exonic
1092932347 12:13327945-13327967 GAGAATCACCTGAAGCCAGGAGG + Intergenic
1093608165 12:21119737-21119759 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1094129877 12:27063392-27063414 GAGAAGGAGAAGAAAGAAGGGGG - Intronic
1094387265 12:29908892-29908914 GAGGAACAGAAGAAGGGAGGAGG - Intergenic
1095514505 12:42991114-42991136 GAGTATCAGCATAAGGAGGTGGG - Intergenic
1095595218 12:43950995-43951017 GAGAGTGAGCAGAAGCAGGGTGG + Intronic
1095886676 12:47195498-47195520 GATAATCAGAGGAAGGAGGGTGG - Intronic
1096340337 12:50793061-50793083 CATAATCAGGAGAAGAAAGGAGG - Intronic
1096718908 12:53506940-53506962 GAGGAAGAGGAGAAGGAAGGGGG - Intronic
1097023698 12:56038221-56038243 GGGAATCAGAAGAAGAGAGGAGG - Exonic
1097620953 12:61938896-61938918 GAGACTCAGAAGGAGGAGGGTGG + Intronic
1097628212 12:62027625-62027647 GAGGTTCTGCTGAAGGAAGGGGG - Intronic
1097654516 12:62343692-62343714 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1097914086 12:65001919-65001941 GAGAATCATCAGAAGGTAAGAGG - Intergenic
1098193688 12:67977208-67977230 GAGAATGAGCAGAAGCGAGGTGG - Intergenic
1098460769 12:70730842-70730864 GAGAGAGAGCAGAAGGAAGGAGG + Intronic
1098622072 12:72613758-72613780 GAGAAGGAGCAGAAGGAGGAGGG + Intronic
1099135172 12:78888794-78888816 GACAGTGAGCAGGAGGAAGGAGG - Intronic
1099163838 12:79276934-79276956 GAGAAGAAGAAGAAGGAAGAAGG + Intronic
1099215047 12:79843349-79843371 GAGGATCACCAGAAGTCAGGAGG + Intronic
1099517598 12:83616845-83616867 GAAAAACAGCAGATGCAAGGAGG - Intergenic
1100261033 12:92932199-92932221 GAGAATCACTTGAAGGCAGGAGG + Intergenic
1100449927 12:94696066-94696088 GAGCAGCAGCAGGGGGAAGGAGG + Intergenic
1100978163 12:100143091-100143113 GAACACCAGCAGAGGGAAGGAGG - Intergenic
1101022248 12:100565144-100565166 CAGGAGCAACAGAAGGAAGGTGG + Intergenic
1101227454 12:102704161-102704183 GAGAAGCAGGAGAAGGGAGAAGG - Intergenic
1101648881 12:106656677-106656699 GAGAATGAGGAGAAGGGAGATGG - Intronic
1102262481 12:111452757-111452779 TAGAAGCAGTAGAAGGGAGGAGG + Exonic
1102758297 12:115362981-115363003 GAGAACCAGCAAAAGAAATGAGG - Intergenic
1102783233 12:115583674-115583696 GTGTTTCAGCAGAAGGAAAGTGG - Intergenic
1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG + Intronic
1104239265 12:126971709-126971731 GAGAAAGAGAAGGAGGAAGGAGG - Intergenic
1104428369 12:128696361-128696383 GAGAATCAGAGGTAGGATGGGGG - Intronic
1104511502 12:129383537-129383559 GAGAATCACCAGAACCCAGGAGG - Intronic
1105025329 12:132844718-132844740 GAGAATCAGTTGAACGCAGGAGG - Intronic
1105738084 13:23292928-23292950 GCAAATCAGAAGAAGCAAGGAGG + Intronic
1105779262 13:23692113-23692135 GAGAAGCAGAAGAAAGAAGATGG + Intergenic
1105882190 13:24614722-24614744 GGGCCTCAGCAGAAAGAAGGAGG - Intergenic
1106182288 13:27380160-27380182 CACAATCATCAGAAGGAATGTGG - Intergenic
1106451769 13:29888821-29888843 GTGAGTTATCAGAAGGAAGGAGG + Intergenic
1106668827 13:31882985-31883007 GAGAATGAGCTGAGTGAAGGGGG - Intergenic
1107999430 13:45892727-45892749 AAGAAGCAACAGGAGGAAGGAGG + Intergenic
1108095318 13:46894519-46894541 GAGAATGTGAAGGAGGAAGGCGG - Intronic
1108738995 13:53315146-53315168 GAGACTCAGAAGAGGGAGGGTGG + Intergenic
1109299385 13:60575188-60575210 TAAAAACAGAAGAAGGAAGGAGG + Intergenic
1109627732 13:64998045-64998067 GAGAAGCAGCAAAAGAAATGAGG + Intergenic
1110627412 13:77666873-77666895 GAGGAGGAGCAGAAGGAAGTTGG + Intergenic
1111098033 13:83539949-83539971 GAGAAACAGCAGCTGGAAAGAGG + Intergenic
1111536859 13:89612629-89612651 GAAAATAAGGAGAAGGTAGGGGG - Intergenic
1111767554 13:92551703-92551725 GAGAAACAGTAGGAGGTAGGAGG + Intronic
1111959252 13:94791817-94791839 GAGAATCAGGAGGAGGAAAGAGG + Intergenic
1112685327 13:101818421-101818443 GAGAATTAGCAGAAGCTAGGAGG - Intronic
1112870789 13:103968396-103968418 GAGAATGGGCAGAAGGAAATTGG + Intergenic
1113149985 13:107252477-107252499 GAGAGAGAGGAGAAGGAAGGAGG + Intronic
1113419921 13:110163367-110163389 GGGAAACAGCAGAATGAAGTTGG - Intronic
1114384636 14:22242470-22242492 TAGAATCAGGAGAAGGAAAAAGG + Intergenic
1115094538 14:29618967-29618989 GAGAATGAGGAGGAGGAAGGGGG + Intronic
1115360005 14:32489929-32489951 GAGAGTCAGCAAAAGGGTGGTGG + Intronic
1115912249 14:38269255-38269277 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1116868064 14:50047371-50047393 GTGAATCAGGGGAAGGAAGCTGG + Intergenic
1117172312 14:53113581-53113603 GAGAGTGAGCAGAAGCATGGTGG + Intronic
1117515090 14:56492813-56492835 GAGAATAAGCAGAAGTATGAAGG + Intronic
1118072077 14:62256510-62256532 GAGTAAAAGCAGACGGAAGGTGG - Intergenic
1118337095 14:64862783-64862805 GAGAATCACCTGAATGCAGGAGG + Intronic
1118459544 14:65976007-65976029 GGGAAGCAGGAGAAGGAGGGAGG + Intronic
1119278248 14:73380352-73380374 GAGATGCAGCAGACAGAAGGAGG + Intronic
1119394998 14:74319730-74319752 GGAAATCATCAGAAGAAAGGTGG + Intronic
1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG + Exonic
1119922209 14:78456966-78456988 GAGAAGGAGGAGAAGGAAGAAGG - Intronic
1119996832 14:79262441-79262463 GAGAAAGAGGAGGAGGAAGGAGG + Intronic
1120495821 14:85233970-85233992 GAGAATCAGCAGAAGAAAAAAGG - Intergenic
1120624964 14:86813768-86813790 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1120673985 14:87397479-87397501 CAGAATTAGAAGGAGGAAGGGGG - Intergenic
1120717496 14:87855401-87855423 GAGAACAAGTATAAGGAAGGGGG + Intronic
1121051360 14:90820882-90820904 ATGAATGAGCTGAAGGAAGGTGG + Intergenic
1122000394 14:98646103-98646125 GTGAATGAGCAGAAGGTATGAGG - Intergenic
1122009675 14:98735781-98735803 AAGGAACATCAGAAGGAAGGAGG + Intergenic
1122638027 14:103139232-103139254 GAGACTCCGCAGGAGGAAGGAGG + Intergenic
1122655261 14:103254464-103254486 GAGAATCACCAGAACCCAGGAGG + Intergenic
1122787593 14:104171143-104171165 TAGAGTCAGCAGAAAGCAGGGGG - Intronic
1122811209 14:104290245-104290267 GAGAAGCAGCAGCAGGAAGCAGG - Intergenic
1122861750 14:104585636-104585658 GAGAATCAGAGAGAGGAAGGGGG + Intronic
1122878650 14:104680130-104680152 GAGAGTCAGAAGACGGAGGGGGG - Intergenic
1123459118 15:20452462-20452484 GAGCATCACCAGGAGGAAGTGGG + Intergenic
1123658943 15:22547956-22547978 GAGCATCACCAGGAGGAAGTGGG - Intergenic
1124037440 15:26068774-26068796 GAAAATAAAAAGAAGGAAGGAGG - Intergenic
1124047252 15:26161707-26161729 CAGTACCAGCAGGAGGAAGGTGG - Intergenic
1124265357 15:28228312-28228334 GAGCATCACCAGGAGGAAGCGGG + Exonic
1124312808 15:28642448-28642470 GAGCATCACCAGGAGGAAGTGGG - Intergenic
1126715863 15:51516792-51516814 GAGACTCAGAAGAGGGAGGGTGG - Intronic
1126853568 15:52815439-52815461 TGGAATCAGCAGAAGGAGGGTGG - Intergenic
1126856967 15:52848034-52848056 GAGAGTTAGCACAAGGAATGTGG + Intergenic
1126950901 15:53879826-53879848 GAGAATCAGGCCAAGGCAGGTGG - Intergenic
1127250799 15:57235659-57235681 CAGAATCAGGAGAAGGAATATGG - Intronic
1127449525 15:59103274-59103296 GAGACTCAGAAGAGGGAGGGTGG - Intergenic
1128095607 15:64952228-64952250 AAGAATAAGAAGAAGAAAGGAGG - Intronic
1128619744 15:69138636-69138658 ATGAATTAACAGAAGGAAGGAGG + Intergenic
1128674134 15:69596297-69596319 GTGAAGCAGCTGCAGGAAGGTGG + Intergenic
1128734706 15:70046687-70046709 GAGACGCAGCAGGAGGAAGGAGG + Intergenic
1128903702 15:71448985-71449007 GAGAATGAACAGAAGGCAAGGGG - Intronic
1129232450 15:74204282-74204304 GAGCATCAGGGGAAGGCAGGAGG - Intronic
1129284580 15:74514234-74514256 GGACTTCAGCAGAAGGAAGGTGG + Intergenic
1129284640 15:74514661-74514683 GGACTTCAGCAGAAGGAAGGTGG + Intergenic
1129594904 15:76955220-76955242 TAAATTTAGCAGAAGGAAGGTGG - Intergenic
1130601794 15:85280518-85280540 GAGAATCACCAGGAAGAAGCTGG + Intergenic
1130654483 15:85782517-85782539 GAGAATGAGAGGAAGGGAGGGGG - Intronic
1131833303 15:96367832-96367854 GAGAAAATTCAGAAGGAAGGGGG + Intergenic
1131956925 15:97746908-97746930 GAGAATCAACAGAAATAAGGGGG + Intergenic
1132261572 15:100429693-100429715 GAGGATCAACTGAAGGATGGGGG - Intronic
1133107311 16:3520889-3520911 GAGAAAGAGCAGAAGCATGGGGG - Intronic
1133247640 16:4459816-4459838 GAGAATCAGCTGAACCCAGGAGG - Intergenic
1133911459 16:10069998-10070020 GAGAAACAGAAGTAGGAGGGAGG - Intronic
1134090852 16:11390986-11391008 GAGTGTCAGCACAGGGAAGGGGG - Intronic
1134133220 16:11663737-11663759 GAGAATCAGCTGAACCCAGGAGG + Intergenic
1134324287 16:13192883-13192905 GAGAAGAAGAAGAAAGAAGGAGG + Intronic
1134425037 16:14133610-14133632 GAGAAAAAGCAGAAGGGAAGAGG - Intronic
1134484714 16:14648530-14648552 GCGAATCAGCAGATGGGAGGGGG + Exonic
1135218559 16:20593561-20593583 GAGACTCAGAAGGAGGAAGGTGG - Intergenic
1135862171 16:26066551-26066573 GAGAATGAGTAGATGGAAAGAGG - Intronic
1136019337 16:27430091-27430113 GAGCAGCAGCAGGAGCAAGGGGG - Exonic
1136027428 16:27478079-27478101 GAGAATCACCTGAACCAAGGAGG + Intronic
1136294241 16:29292543-29292565 GAGAAGCAGTAGAAGGTTGGTGG + Intergenic
1136380694 16:29893555-29893577 GAGAATCATCTGAAGCTAGGAGG + Intronic
1136703543 16:32165735-32165757 GAGCATCATCAGGAGGAAGCGGG + Intergenic
1136764159 16:32761867-32761889 GAGCATCATCAGGAGGAAGCGGG - Intergenic
1136803939 16:33108519-33108541 GAGCATCATCAGGAGGAAGCGGG + Intergenic
1137783067 16:51114076-51114098 GAGAGCCGGGAGAAGGAAGGGGG + Intergenic
1138053686 16:53810490-53810512 GATAAGGAGCAAAAGGAAGGAGG - Intronic
1138799673 16:60012812-60012834 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1139424938 16:66873725-66873747 GAGAAGGAGGAGAAGGGAGGAGG - Intergenic
1139425011 16:66873914-66873936 GAGAAGGAGGAGAAGGGAGGAGG - Intergenic
1140357602 16:74319581-74319603 GAGAAGAAGGAGAAGAAAGGAGG - Intergenic
1140489788 16:75325486-75325508 GACAATCAGAGGAAGGGAGGAGG - Intronic
1140992769 16:80230448-80230470 GAGAATCAGCATCAGGCTGGAGG - Intergenic
1141212728 16:81996228-81996250 GAGAATGGACTGAAGGAAGGAGG + Exonic
1141278932 16:82613266-82613288 GAGAAGCAGCAGAAATGAGGAGG - Intergenic
1141856223 16:86683106-86683128 GAGAAGGAAAAGAAGGAAGGAGG + Intergenic
1142100145 16:88266589-88266611 GAGAAGCAGTAGAAGGTTGGTGG + Intergenic
1203066513 16_KI270728v1_random:1023989-1024011 GAGCATCATCAGGAGGAAGCGGG - Intergenic
1142642479 17:1292444-1292466 GAGCAGCACCAGAAGGAGGGTGG - Intronic
1143178008 17:4967676-4967698 GAGAACCGGGCGAAGGAAGGCGG + Intronic
1143361128 17:6372189-6372211 GAGAAGAAGCAGCAGGAGGGAGG + Intergenic
1143361129 17:6372192-6372214 AAGAAGCAGCAGGAGGGAGGCGG + Intergenic
1143712326 17:8743533-8743555 AGGAGTCAGCAGAAGCAAGGAGG + Intronic
1143843954 17:9757935-9757957 GAGAATCACTAGAAAGCAGGAGG - Intergenic
1143949388 17:10620643-10620665 GAGAATCAGAACCTGGAAGGTGG + Intergenic
1144304602 17:13956609-13956631 GAGAATCACCAGAACCCAGGAGG + Intergenic
1144361808 17:14502273-14502295 AGGAATCAGAAGAATGAAGGGGG + Intergenic
1144792332 17:17867360-17867382 GGGCACCAGCAGGAGGAAGGCGG + Intronic
1145726695 17:27134149-27134171 GAGAATCACCATGAGGAATGAGG + Intergenic
1145968545 17:28939509-28939531 GAGAATCAGCAGAACTATGATGG + Intronic
1146679953 17:34799916-34799938 GAGAACAAGCAGGAGGAAGGGGG - Intergenic
1147030845 17:37634539-37634561 GAGAATCACCTGAAGCCAGGAGG + Intronic
1147302345 17:39540140-39540162 GAGAATCAGAGGAAAGAAAGTGG + Intronic
1148015638 17:44520085-44520107 GAGAATCTTCAGAGGGAAGGTGG - Intergenic
1148047678 17:44753937-44753959 GAAGAGCAGCAGAAGGAAGGAGG + Intergenic
1148090730 17:45021194-45021216 GAGAAGGAGCAAAAGGAAGGAGG - Intergenic
1148767806 17:50049426-50049448 GAGAAACAGCAAAAGGCTGGAGG + Intergenic
1149250017 17:54757275-54757297 GAGAATCACCTGAAGCCAGGAGG + Intergenic
1149376982 17:56054005-56054027 GAGAATCAGAAGAGGGAGGGAGG - Intergenic
1149378241 17:56067097-56067119 GAGAATCAGCAGAACCCGGGAGG + Intergenic
1149472895 17:56933503-56933525 GAGCATCTGCAGAAGACAGGAGG + Intergenic
1150605574 17:66687784-66687806 GAGAAGGGGAAGAAGGAAGGAGG + Intronic
1150772006 17:68050254-68050276 GAGAAAGAGAAGAAGGAAGGAGG - Intergenic
1150772027 17:68050365-68050387 CAGAAAGAGAAGAAGGAAGGAGG - Intergenic
1150803967 17:68304264-68304286 GAGCCTCAGCACAAGGAGGGTGG - Intronic
1151053250 17:71003859-71003881 GAGAAACCGCAGATGCAAGGGGG - Intergenic
1151215565 17:72574567-72574589 GACAACCTGCAGGAGGAAGGGGG - Intergenic
1151267154 17:72965696-72965718 GAGTATCTCCAAAAGGAAGGAGG + Intronic
1152595727 17:81236742-81236764 GAGGATGAGCAGGAAGAAGGAGG + Exonic
1152900108 17:82936217-82936239 GAGAATCAGCAGCTGGCAGGCGG - Intronic
1153623337 18:7000374-7000396 GAAAAACAGCAGAGGGAAGATGG + Intronic
1153796392 18:8626758-8626780 GAGAATCAGGAGAGGGAGAGGGG - Intronic
1153851739 18:9101832-9101854 GAAAATGGGCAAAAGGAAGGGGG + Intergenic
1153926159 18:9836927-9836949 GAGAGTCAGCATAAGGAATGGGG + Intronic
1153945044 18:10010565-10010587 GAGAATGAGCAGAATGATGCTGG - Intergenic
1154029850 18:10744096-10744118 CACAATCAGAAGACGGAAGGAGG + Intronic
1154031389 18:10756798-10756820 GAGAATGAGGAGGAGGAATGGGG + Intronic
1154127174 18:11701988-11702010 GAGAATCACTGAAAGGAAGGTGG + Intronic
1154149596 18:11895912-11895934 TAGAAACAGCAGCAGGAAGAAGG + Intronic
1155325715 18:24662968-24662990 GAGAATGGGGAGAAGGAAAGAGG - Intergenic
1155409916 18:25532593-25532615 GGTAATAAACAGAAGGAAGGAGG + Intergenic
1155517383 18:26637211-26637233 TAGAGTCAGGAGGAGGAAGGAGG - Intronic
1156801552 18:41120963-41120985 GACAAACACCAGGAGGAAGGAGG + Intergenic
1157134035 18:45036705-45036727 GAGAATAGGAGGAAGGAAGGAGG + Intronic
1157777397 18:50406385-50406407 GAGACTCACCAGGAGAAAGGTGG + Intergenic
1158083658 18:53624901-53624923 AAGAATCAGAAGAAGGCAGATGG - Intergenic
1158571929 18:58603552-58603574 GAGAGCCAGCAGGAGGGAGGTGG - Intronic
1158993938 18:62898007-62898029 GAGAAAGAGGAGAAGGGAGGAGG - Intronic
1159116490 18:64119245-64119267 GAGGAAGAACAGAAGGAAGGAGG + Intergenic
1159244972 18:65794030-65794052 GAGAATTAGAAGTAGGAAGTAGG + Intronic
1159467416 18:68802821-68802843 AAGAATCAGCAGATGGGAGGTGG - Intronic
1159581237 18:70236565-70236587 GAGGGTGAGCAGAAGCAAGGTGG + Intergenic
1160236955 18:77093291-77093313 GAGCTGCAGCAGAGGGAAGGCGG + Intronic
1160329035 18:77975611-77975633 GAGATGCAGCAGGAGGAAGTGGG - Intergenic
1160593222 18:79956199-79956221 GAGAATCGGAAGGAGGAAAGAGG + Intergenic
1161597295 19:5157064-5157086 GAGAATCACTAGAAGCCAGGAGG + Intergenic
1162304737 19:9865143-9865165 GAGAAGAAGAAGAAGGGAGGTGG - Intronic
1162412356 19:10514193-10514215 GAGCAACAGCAGCAGGAAGAGGG + Exonic
1162414605 19:10527667-10527689 GAGAATCACCTGAAGCCAGGAGG - Intergenic
1162501992 19:11059465-11059487 GAGATTGTGCAGAAGGAGGGAGG + Intronic
1162647796 19:12062851-12062873 CAGAACCAGCAGAAGGGAGCCGG - Intergenic
1162740605 19:12771507-12771529 GGGATTCAGGAGAAGGACGGGGG + Intronic
1163181363 19:15606435-15606457 GAGAATCACTAGAACGCAGGAGG - Intergenic
1163229299 19:15989307-15989329 GAGACTCAGAAGAGGGAAGGTGG - Intergenic
1163690896 19:18737723-18737745 GAGGAGCAGCAGCAGGAGGGCGG - Intronic
1163902542 19:20117452-20117474 CAGAGCCAGAAGAAGGAAGGAGG - Intronic
1163989799 19:20988043-20988065 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1164250299 19:23469747-23469769 GAGAATGAGGAAAAAGAAGGAGG - Intergenic
1164664583 19:30018904-30018926 GAGAATCACCTGAACGCAGGAGG - Intergenic
1164740403 19:30571640-30571662 GAGAAGCAGGAGCAGGAAGTGGG - Intronic
1164945295 19:32288254-32288276 GTGGATCAGGAGAAGGAAGAAGG - Intergenic
1165433588 19:35785208-35785230 GAGAAGCAGCGGAAGCCAGGGGG + Exonic
1165596650 19:37015214-37015236 GAGGAGCATCAGAAGGTAGGTGG - Intronic
1166067544 19:40368811-40368833 GATACTCAGGAGATGGAAGGAGG + Intronic
1166627482 19:44372071-44372093 CAGAATGAGCTGTAGGAAGGTGG - Intronic
1167086439 19:47313061-47313083 GAGAATCACCAGAATCCAGGAGG - Intronic
1167114077 19:47478880-47478902 GAGATTCAGAAGCAGGAAGGTGG + Intronic
1167240929 19:48342563-48342585 GAGCAGCAGCAGCAGGGAGGTGG + Exonic
1167659476 19:50787861-50787883 GAGAATCATCAGAACCCAGGAGG + Intergenic
1167723674 19:51196604-51196626 GAGACTCAGAATGAGGAAGGGGG - Intergenic
1167916446 19:52743762-52743784 GAGAATCACCTGAATGCAGGAGG + Intergenic
1168379002 19:55904437-55904459 GAGACTCAGATGAAGCAAGGGGG - Intronic
1168510187 19:56967468-56967490 GAAGATCAGTAGGAGGAAGGGGG - Intergenic
925156425 2:1651765-1651787 GAGAAACAGCAGGCGGGAGGTGG - Intronic
925585662 2:5461563-5461585 GAGAGTCACCAGGAGGAAAGAGG + Intergenic
925725479 2:6866459-6866481 GAGAGTCAGCAAAAGGGAGAGGG - Intronic
925941552 2:8825281-8825303 GAGAATCACTGGAAGGCAGGGGG + Intronic
925994627 2:9281993-9282015 GAGCATGAGCAGAGGGAAGAAGG - Intronic
926077670 2:9954403-9954425 GAGAAGCAGCAGAAAGAAAAAGG - Intronic
926119138 2:10232070-10232092 GGGAATAAGCGGAAGGAAGTGGG + Intergenic
926774823 2:16411672-16411694 GAGAAGGAGCAGAAGAGAGGTGG - Intergenic
927097316 2:19757447-19757469 AAGAAGCAGGAGAAGGAAGATGG + Intergenic
927876056 2:26655853-26655875 AAGAAACAGCAAAAGGAAGGGGG - Intergenic
928540401 2:32278599-32278621 AAGAATGAGAAAAAGGAAGGAGG + Intronic
928652342 2:33416596-33416618 GAGGATCACCAGAACGCAGGAGG - Intergenic
929295677 2:40243848-40243870 TAGACTCATCAGAGGGAAGGAGG - Intronic
929508772 2:42550496-42550518 ATGGAGCAGCAGAAGGAAGGAGG + Intronic
929597461 2:43185351-43185373 GGAAAACAGCAGAAGGAAGAAGG + Intergenic
929626907 2:43418752-43418774 GAGAGGCAGCGGGAGGAAGGGGG + Intronic
929868314 2:45736958-45736980 GGGAATGAGCAGATGGAAGAGGG + Intronic
930516412 2:52413161-52413183 TAGAAACAGCAGAAAGAATGGGG - Intergenic
930590601 2:53322223-53322245 GAGAAACTGAAGAAGGTAGGTGG - Intergenic
931348008 2:61464227-61464249 GAGAATCACTTGAAGCAAGGAGG + Intronic
931939394 2:67235187-67235209 CAGAAGCAGCAGTAGGTAGGTGG - Intergenic
931992776 2:67807774-67807796 GAGAAGAAGGAGAAGGAAGAAGG - Intergenic
931994097 2:67823431-67823453 GAGAAAGAGAGGAAGGAAGGAGG + Intergenic
932730368 2:74216831-74216853 GGGAATCAGCAGAGGTCAGGAGG - Exonic
933317794 2:80736558-80736580 GAGAGTGAGCAGAAGTACGGTGG + Intergenic
933326694 2:80846835-80846857 GAGAATCAGCTGAAACCAGGAGG + Intergenic
933488368 2:82950819-82950841 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
933720514 2:85394730-85394752 GAGAATCAGCCCAGGGCAGGTGG + Exonic
933904904 2:86882295-86882317 GAGACTCAGAAGGAGGAGGGTGG + Intergenic
933937723 2:87219823-87219845 GAGACTCATTAGAAGGCAGGAGG - Intergenic
933998231 2:87685640-87685662 GAGGGGCAGCTGAAGGAAGGAGG + Intergenic
934562189 2:95319194-95319216 CAGAGTCTGCAGGAGGAAGGCGG + Intronic
934636756 2:95996363-95996385 GAGAAACAGGAGAAACAAGGTGG + Intergenic
934796898 2:97109061-97109083 GAGAAACAGGAGAAACAAGGTGG - Intergenic
934836518 2:97594370-97594392 GAGAAACAGGAGAAACAAGGTGG + Intergenic
936295619 2:111265233-111265255 GAGGGGCAGCTGAAGGAAGGAGG - Intergenic
936355416 2:111745950-111745972 GAGACTCATTAGAAGGCAGGAGG + Intergenic
936367324 2:111869867-111869889 GAGACTCAGAAGGAGGAGGGTGG - Intronic
936545286 2:113387074-113387096 GAGAAACAGGAGAAACAAGGTGG - Intergenic
936941130 2:117885554-117885576 TAGAATCAGAAGAAGGGTGGTGG - Intergenic
937345967 2:121125485-121125507 GAGAAGGAGAAGAAGGAAGGAGG + Intergenic
937562644 2:123244619-123244641 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
937573353 2:123390970-123390992 GAGAATGGGGAGGAGGAAGGAGG - Intergenic
937588839 2:123590061-123590083 GAGACACAGCAGAAGGAGAGTGG + Intergenic
938131214 2:128716982-128717004 GAGAAACAGCTGAATGAAGCAGG - Intergenic
938165118 2:129019355-129019377 GAGAGTCAGCAGAGAGAAGGGGG + Intergenic
938546023 2:132332490-132332512 CAGAATGAGCTGCAGGAAGGCGG + Intergenic
938588146 2:132711928-132711950 GAGAATAAGCAGAAATAAAGAGG + Intronic
938702560 2:133892699-133892721 AAGTCTCAGCAGAAGGCAGGTGG + Intergenic
939169267 2:138675000-138675022 ATGAAACAGGAGAAGGAAGGTGG - Intronic
939604970 2:144242870-144242892 GAGAATCACCTGAACGCAGGTGG + Intronic
940030639 2:149257941-149257963 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
940124774 2:150311163-150311185 GAGAACTAGCAGAAGCAGGGTGG + Intergenic
940582543 2:155600488-155600510 GGGCACCAGCAGAAGGCAGGAGG + Intergenic
940893795 2:159061310-159061332 GAGAAACTGCAGAAGAAAGGAGG + Intronic
941465733 2:165824339-165824361 CAGAATAAGAAGATGGAAGGAGG - Intergenic
941478883 2:165981823-165981845 GAGATTCAGAAGTAGGGAGGGGG - Intergenic
941674825 2:168332430-168332452 GAGAATCACCTGAAGTCAGGAGG + Intergenic
941923348 2:170873078-170873100 GAAAATCAGCTGAAAGAAAGGGG + Intergenic
942062275 2:172238864-172238886 TAGACTCAGATGAAGGAAGGGGG + Intergenic
942387239 2:175455375-175455397 GTTAATCAGCAGAAGGGAGGCGG - Intergenic
942594444 2:177579730-177579752 GACAATAAGCAGGAGGTAGGGGG - Intergenic
942797217 2:179835655-179835677 GACAAACAGAAGAAGGAAGTGGG - Intronic
943240465 2:185377314-185377336 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
943322625 2:186464450-186464472 GAGACTCAGAAGTAGGAGGGTGG + Intergenic
943330780 2:186556366-186556388 GAGAAAGAGAGGAAGGAAGGAGG - Intergenic
943631449 2:190257382-190257404 TAAAATAAGCAGAAGAAAGGAGG + Intronic
943735468 2:191348979-191349001 AAGTATCAGCAGAAGTCAGGTGG - Intronic
944521554 2:200574695-200574717 GAGAGTCAGAAAAAGGGAGGGGG + Intronic
946536968 2:220641193-220641215 CAGAAACAGCAGAAGCAAGAAGG + Intergenic
946714566 2:222539677-222539699 CAGAAACAGCAGGAGGAAGATGG + Intronic
946859014 2:223982309-223982331 GAGACTCAGAAGGAGGAGGGTGG + Intronic
947033424 2:225824398-225824420 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
947200799 2:227612994-227613016 GAGAACCATCACAAGGGAGGGGG + Intronic
947403602 2:229752330-229752352 TAAAATCACCAGCAGGAAGGAGG + Intergenic
947812983 2:233015823-233015845 GAGAGTGAGCAGAAGGATGAGGG - Exonic
947988849 2:234471397-234471419 TAGAATCATCAGAAGCCAGGAGG + Intergenic
948772778 2:240260035-240260057 GAGCCCCAGCAGAAGGCAGGTGG + Intergenic
948939254 2:241187934-241187956 GAGAAGGAGGAGAGGGAAGGTGG + Intergenic
1169208384 20:3752535-3752557 GAGGAGCCGCAGGAGGAAGGAGG + Exonic
1169976423 20:11333688-11333710 GAGAAAGAGCAGAGGGAATGGGG + Intergenic
1170285717 20:14706222-14706244 GAGAATCACCTGAACGCAGGAGG + Intronic
1171316396 20:24199505-24199527 GAGAAACAGGATAGGGAAGGTGG - Intergenic
1171874886 20:30565223-30565245 CAGAATGAGCTGCAGGAAGGCGG + Intergenic
1172090207 20:32425792-32425814 GAGAATCACTTGAACGAAGGAGG - Intronic
1172275338 20:33676117-33676139 GGGAATCAGCAAAGGGGAGGAGG - Exonic
1173076043 20:39820618-39820640 GAGAATCACCTGAACCAAGGAGG + Intergenic
1173833888 20:46112594-46112616 AAGAGTCAGCAGATGAAAGGTGG + Intergenic
1173980910 20:47223414-47223436 GAGAATCAGTGGAAGCCAGGAGG + Intronic
1174014327 20:47475543-47475565 GAGAATCAGCTGAACTCAGGAGG + Intergenic
1174033872 20:47653612-47653634 GATACACAGCAGAAGGAGGGGGG - Exonic
1174166089 20:48584517-48584539 GGGAAGCAGAAGAAGGAAGCAGG - Intergenic
1174641773 20:52050479-52050501 GAGAAAGAGGAGGAGGAAGGAGG - Intergenic
1175040578 20:56046461-56046483 GAGACTCAGAAGAAAGAGGGTGG + Intergenic
1175929699 20:62487871-62487893 GAGAAAGAGCAAGAGGAAGGGGG - Intergenic
1175935202 20:62510839-62510861 GTTAATCAGCAGAAGGATGGAGG - Intergenic
1176059632 20:63166824-63166846 GAGAATCAGGAGGGGAAAGGAGG + Intergenic
1176981374 21:15385019-15385041 GAGAATCACCTGAACCAAGGAGG + Intergenic
1178256264 21:31055193-31055215 GACAAACAGAAAAAGGAAGGAGG + Intergenic
1178909651 21:36664290-36664312 GAGAAGCAGCAGGAGTGAGGAGG + Intergenic
1179171951 21:38980042-38980064 CACAATCAGCTGAAGGAATGTGG - Intergenic
1179627882 21:42658829-42658851 GAAAATCTGCTGAAGGAAGGGGG + Intronic
1180897408 22:19346909-19346931 AAGAATAATCAGCAGGAAGGAGG + Intronic
1181122157 22:20678078-20678100 GAGAATCTAGAGAATGAAGGAGG + Intergenic
1181408848 22:22704105-22704127 GAGAAGCAGACGAAGGAAGCTGG + Intergenic
1181766345 22:25094870-25094892 GAGAATCAGAGGGAGGGAGGAGG - Intronic
1181817284 22:25448104-25448126 CAGAATGAGAAGAAGGAAAGCGG + Intergenic
1181845044 22:25700040-25700062 GTGTTTCAGCAGAAGCAAGGGGG - Intronic
1182285867 22:29246585-29246607 GAGAACCAGGAGAAGCAAGCAGG + Intronic
1182353291 22:29710752-29710774 GAGATTCAGGAGGAGGAAGCGGG + Intergenic
1183173429 22:36204585-36204607 GAGAATAAGGAGATGGAGGGAGG + Intronic
1183645575 22:39124192-39124214 GAAAAGCTGCAGAAGGAAAGAGG - Intronic
1183970771 22:41475806-41475828 GAGAATCAGCTGAACCCAGGAGG + Intronic
1184059308 22:42072524-42072546 GAAAAACAGGAGAAAGAAGGGGG + Intergenic
1184183182 22:42845092-42845114 GAGACTTAGCAGAAAGAAAGAGG + Intronic
1184208856 22:43023510-43023532 GAGGCTCAGCAGAAGAAGGGGGG - Intergenic
1184321436 22:43744823-43744845 GAGAGGAAGCAGAAAGAAGGAGG + Intronic
1184411519 22:44328966-44328988 GTGAATCAGCTAGAGGAAGGGGG - Intergenic
1184730266 22:46367819-46367841 GAGCAGCAGCAGGAGGAATGCGG + Exonic
1184942068 22:47776219-47776241 GACATTATGCAGAAGGAAGGAGG - Intergenic
1185080567 22:48707358-48707380 GAGAGCCAGAAGAAGGCAGGAGG - Intronic
949549774 3:5103324-5103346 GAGAATCAGCTGAACCAGGGAGG - Intergenic
950683066 3:14598526-14598548 GAGAAACAGCATGAGTAAGGGGG - Intergenic
951226905 3:20131103-20131125 GAGAATCACCAGAACCCAGGAGG - Intronic
951676521 3:25247616-25247638 GAGGATGAGCAGAAGCAGGGTGG - Intronic
951934006 3:28001702-28001724 GAGAAACAGGAGCAGGAAGAGGG + Intergenic
951953250 3:28225191-28225213 GAGAATCACTAGAACCAAGGAGG - Intergenic
952186661 3:30976941-30976963 CACAATCAGCAGAAGGAAAAGGG - Intergenic
952382257 3:32814812-32814834 GAGAATTGCCAGAAGGAAGATGG - Intergenic
952588589 3:34923575-34923597 GAGTGTCAGTTGAAGGAAGGTGG + Intergenic
953195402 3:40727515-40727537 GAGACTCAGAAGAGGGAAGGTGG - Intergenic
954651881 3:52169851-52169873 GAGAATCACCTGAATGCAGGAGG + Intergenic
954859877 3:53678709-53678731 GAGAATGTGAAGAGGGAAGGTGG + Intronic
955411631 3:58659213-58659235 GAGAGGCAGCAGAGTGAAGGGGG - Intronic
955685161 3:61541837-61541859 GAGCATCAGGAGAAGCAAAGTGG - Intergenic
956362574 3:68464741-68464763 GAGAATAAACTGAAGGTAGGAGG + Intronic
957302154 3:78405883-78405905 GATGATCAGCTGAAAGAAGGAGG - Intergenic
957894140 3:86398384-86398406 GAGAAGGAGAAGAAGGGAGGAGG + Intergenic
958742068 3:98086533-98086555 AAGAAACAGCAGATGGAAGAAGG + Intergenic
958894124 3:99811302-99811324 CAGAATCATCAGAAGGAAAATGG - Intergenic
959142933 3:102507544-102507566 GGGAGTTAGGAGAAGGAAGGAGG + Intergenic
959283448 3:104377732-104377754 TAGATTCCCCAGAAGGAAGGTGG + Intergenic
959695514 3:109245500-109245522 GATAATCAGCAGCATGAAGAGGG - Intergenic
959714482 3:109417599-109417621 GAAACTGAGCAAAAGGAAGGGGG - Intergenic
960002646 3:112749071-112749093 GATAATGAGCAAAAGGAAAGGGG + Intronic
960166573 3:114409493-114409515 CAGAAGCAGCTGAAGGAAGGGGG + Intronic
960533747 3:118794089-118794111 GTGAAACAGCACAAGGAAGGGGG + Intergenic
961955578 3:130799611-130799633 GAGACTCAGAAGGAGGATGGTGG + Intergenic
962642438 3:137401115-137401137 GAGGGTGAGCAGAAGCAAGGTGG - Intergenic
962693580 3:137925926-137925948 GAGAAGCAGCAGAAAGCAGGTGG + Intergenic
962922421 3:139963088-139963110 GAGAATGAGGAGGAGGAGGGGGG + Intronic
962982814 3:140506302-140506324 AAGAATGGGCAGAAGGAGGGAGG - Intronic
963846035 3:150159073-150159095 GTGAAGCAGCAGAAGAATGGGGG - Intergenic
964397265 3:156258530-156258552 GAGAATTGGCAGCAGGCAGGTGG - Intronic
965054470 3:163696144-163696166 TAGAATTAGGAGAAGGAAAGAGG - Intergenic
965442925 3:168738555-168738577 GAGAAGCAGGACAAGGCAGGGGG + Intergenic
965551268 3:169967074-169967096 GAGCAGCAGGGGAAGGAAGGAGG + Intronic
966739464 3:183218747-183218769 GAGGGTTAGCGGAAGGAAGGGGG - Intronic
967464981 3:189794521-189794543 AAGCATCAGCAAAGGGAAGGGGG + Intronic
968238025 3:197049225-197049247 GAGAATCAACAGAACCCAGGAGG + Intronic
968495551 4:913458-913480 GAGATTCAGCAGAAGCAAAAGGG + Intronic
969308705 4:6339906-6339928 GAGAAGCAGAAGAAGGACGATGG + Intronic
969448770 4:7260830-7260852 GAGCAGCAGCAGGAGGAAGAGGG - Intronic
969617124 4:8260180-8260202 GAGGAGCAGGAGAGGGAAGGAGG - Intergenic
970195576 4:13547594-13547616 GAGAAGCAGGAGGAGGGAGGAGG - Intergenic
971318703 4:25588220-25588242 GAGAATGGACAGAAGGGAGGGGG - Intergenic
971454679 4:26833271-26833293 AAGAATCAGCAGGAAGAAAGGGG + Intergenic
972840200 4:42921870-42921892 GAGGATGAGGAAAAGGAAGGTGG - Intronic
974120359 4:57630917-57630939 GAGAAGCTGCAGAAGTAAGCAGG - Intergenic
974247092 4:59333849-59333871 GTGGAAGAGCAGAAGGAAGGAGG - Intergenic
975028214 4:69578510-69578532 GAGAAGAAGAAGAAAGAAGGAGG - Intergenic
975585578 4:75944963-75944985 GAGAATCACTTGAAGGCAGGAGG - Intronic
976142251 4:82004335-82004357 GAGTATCAGAAGAAGCAAGAAGG - Intronic
976204764 4:82614322-82614344 GAGATTCATCAGAGGGAAGGTGG - Intergenic
977398258 4:96498665-96498687 TAGAAAGAGCAGAGGGAAGGAGG + Intergenic
978089545 4:104697935-104697957 GAGTATAAGGAGAAGAAAGGGGG + Intergenic
978406166 4:108380986-108381008 GAGAATCAGTTGAAGCCAGGAGG + Intergenic
978622006 4:110641866-110641888 AAGAATAAGCAAAAGGAAGGAGG - Intronic
978768549 4:112430245-112430267 GTGAATCAGAAGAAGGGATGGGG - Intronic
978813796 4:112879847-112879869 GAGACACAGAAGAAGGAAGCAGG - Intronic
979023045 4:115526975-115526997 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
979417372 4:120460483-120460505 GAGAGCAAGCAGAAGCAAGGTGG + Intergenic
979829732 4:125284761-125284783 GAGAATCTGGAGATGGCAGGGGG - Intergenic
980082106 4:128355076-128355098 GAGAGGCAGCAAGAGGAAGGAGG - Intergenic
980151736 4:129056080-129056102 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
980550273 4:134327075-134327097 GAGAAGCAGCAGCAGGAACGAGG + Intergenic
980848137 4:138348777-138348799 GAGACACAGAAGGAGGAAGGTGG + Intergenic
981009241 4:139907979-139908001 TAGAATAAGCAGATGGATGGTGG + Intronic
981497392 4:145409619-145409641 CAGAAACATCAGAAAGAAGGAGG - Intergenic
982445759 4:155489158-155489180 GAAAATGAGAACAAGGAAGGAGG - Intergenic
982848079 4:160276409-160276431 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
983081483 4:163390663-163390685 GAGAATCAGCAGATAGAAAGGGG + Intergenic
983379837 4:166978700-166978722 GAGAAGGAGAAGAAGGAAGACGG + Intronic
983429313 4:167628289-167628311 GACAATCAGAAAAAGCAAGGTGG + Intergenic
983766485 4:171490355-171490377 GAGAATATGAAGAACGAAGGAGG - Intergenic
984075490 4:175172885-175172907 GAGAATCACCTGAACCAAGGAGG - Intergenic
984256493 4:177395553-177395575 GAATAACAGCAGAAGGAAAGTGG - Intergenic
985317328 4:188672336-188672358 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
985403183 4:189612306-189612328 GAGAAAAAGAAGAAGAAAGGAGG - Intergenic
986246271 5:6009888-6009910 GTGAATCACCTGAAGGCAGGTGG + Intergenic
986516534 5:8570357-8570379 GAGAATCATCTGAAGCCAGGAGG + Intergenic
986700856 5:10407085-10407107 GACAATCTGCAGAAGGAAACAGG - Exonic
986776773 5:11022633-11022655 GAGAATCAAGAGAAGGAAAATGG - Intronic
986782454 5:11079289-11079311 GAGGCTCAGCAGAAGGGAGCTGG - Intronic
987025370 5:13921690-13921712 AAGAAGCAGAAGAAGGAAAGAGG - Intronic
987092926 5:14523438-14523460 GAGCACCAGCAGGAGGAAGGAGG - Intronic
987523882 5:19023075-19023097 GAGATTGAGAAGAAGGAGGGAGG - Intergenic
987827782 5:23055847-23055869 GAGAATAAGGAGAGTGAAGGAGG + Intergenic
988204007 5:28110806-28110828 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
988212946 5:28229739-28229761 GAGAATCACTTGAAGGCAGGAGG + Intergenic
988970712 5:36465105-36465127 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
989225364 5:39021591-39021613 GAGCATGAGCACAAGCAAGGTGG - Intronic
989242899 5:39220602-39220624 ATGAATGAGTAGAAGGAAGGTGG - Intronic
989522504 5:42418395-42418417 GAGAATAAGCTGAAGCAGGGTGG - Intergenic
989977633 5:50605620-50605642 GAGAAGCAGGGGAAGGCAGGCGG - Intergenic
990868320 5:60403751-60403773 GAGAGACAGCATCAGGAAGGAGG - Intronic
990946197 5:61252387-61252409 GAGAATCAGAACAAGACAGGAGG + Intergenic
991230186 5:64323671-64323693 GAGAAAGAGCAGAAGGGATGGGG + Intronic
991465787 5:66910835-66910857 GAGAATCGCCTGAAGGGAGGTGG - Intronic
991665059 5:68991363-68991385 GAGAAAAAGAAGAAAGAAGGTGG - Intergenic
991942135 5:71863230-71863252 AAGAAACAACAGAGGGAAGGAGG - Intergenic
993526295 5:88969974-88969996 GAAAATATGCAGAATGAAGGAGG - Intergenic
994371573 5:98973314-98973336 AAGAATGAGGAGAAGGAAGAAGG + Intergenic
994682999 5:102912561-102912583 GAGAAACAGAAGAAAGAAGAAGG - Intronic
994878521 5:105456113-105456135 GGGAATCAGGAGTAGGAAGGAGG - Intergenic
994933166 5:106216434-106216456 GAAAATGAGAAAAAGGAAGGTGG + Intergenic
995345694 5:111114310-111114332 GAGAAAAATGAGAAGGAAGGTGG + Intronic
995980246 5:118093163-118093185 AAGAAAGAGAAGAAGGAAGGGGG + Intergenic
996019189 5:118573307-118573329 GTGAACCACCAGAAGGAAGCTGG - Intergenic
996030457 5:118699010-118699032 GAGAAAGAGAAGAAGGAAAGTGG + Intergenic
996090713 5:119348966-119348988 GAAAAGCAGCAGAAGGAAAAAGG - Intronic
996426701 5:123320609-123320631 GAGGATGAGCAGAAGAAGGGTGG - Intergenic
996939035 5:128981605-128981627 TAGAGTGAGCAGAAGGATGGAGG + Intronic
996985149 5:129552992-129553014 GAGAGTCAACAGTAGGAAGATGG - Intronic
997347571 5:133203053-133203075 GAGCATATGCAGAAGGCAGGAGG - Intronic
998099822 5:139423477-139423499 GAGAATCATCAGAACCCAGGAGG - Intronic
998413651 5:141929757-141929779 TGGAATCAGCAGAAGGCAGGGGG + Intronic
998977002 5:147659328-147659350 GAGAACCAGCAGAAGCAGGGTGG - Intronic
999154876 5:149450916-149450938 CAGACCCAGCAGAAGGAAGAGGG - Intergenic
999619521 5:153458461-153458483 GAGAACCAGCAGAAGGGACAAGG - Intergenic
999686474 5:154107770-154107792 TAGTATCTGCAAAAGGAAGGAGG + Intronic
1000173415 5:158726702-158726724 GAGAATCTACATAAGGATGGGGG + Intronic
1000508105 5:162147335-162147357 GAGAGACAGAGGAAGGAAGGAGG - Intronic
1001201391 5:169720818-169720840 GAGAATCAGTTGAAGGTGGGAGG - Intronic
1001509459 5:172309114-172309136 GAGAATGAGCAGAAGGAATATGG + Intergenic
1001842634 5:174892325-174892347 ACCAATCAGGAGAAGGAAGGAGG - Intergenic
1001960127 5:175874998-175875020 GTGATTCAGCAGAGGGATGGAGG + Intronic
1002092931 5:176815363-176815385 GAGACTCCCCAGAAGGCAGGAGG - Intronic
1002161302 5:177315331-177315353 GAGAATGCGCTGAAGGAGGGAGG - Intergenic
1002865649 6:1119861-1119883 GTGAATCAGAACAAAGAAGGAGG + Intergenic
1003315854 6:5011353-5011375 GAGACACAGCAGGAGGAAGGAGG + Intergenic
1004793983 6:19060686-19060708 AACCATGAGCAGAAGGAAGGAGG - Intergenic
1004848208 6:19669225-19669247 GAGTATTAGCAGAAGAAAGTTGG - Intergenic
1004865459 6:19849146-19849168 GTGAAACAGCAGAAGAAACGAGG + Intergenic
1005424314 6:25685132-25685154 GAGAACCTCCAGAAGGAATGAGG + Intronic
1005693910 6:28333900-28333922 GAGAATGAGCTGAGGGAATGAGG + Intronic
1005948313 6:30611664-30611686 GAGCAGCAGCAGAAGCAGGGAGG + Intronic
1005959943 6:30687317-30687339 GACAATGAGGAGAGGGAAGGGGG + Exonic
1005987371 6:30883533-30883555 GAGGAGCAGGAGAAGGATGGAGG - Intronic
1006174996 6:32116343-32116365 GAGAAGCAGCAGGAAGTAGGTGG - Intronic
1006670383 6:35726636-35726658 GGGACTCAGAAGAAAGAAGGTGG - Intronic
1007237093 6:40398403-40398425 GAGCAGCAGCAGAAGGTCGGCGG - Intronic
1007260878 6:40562248-40562270 GAGATTGGGCAGACGGAAGGAGG + Intronic
1007300101 6:40861492-40861514 GAGAATCAGCAAAGGGAGAGAGG + Intergenic
1007388171 6:41533376-41533398 GAGAATCACCAGAACCAGGGAGG + Intergenic
1008048339 6:46874336-46874358 AAGAATCAGCAGGAGGAAGAGGG - Intronic
1008407676 6:51136734-51136756 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
1008708633 6:54196035-54196057 GAGGATGAGAAGAAGGAAAGTGG - Intronic
1008753446 6:54764983-54765005 GAGAAAAAGCAGAAGGACAGAGG - Intergenic
1009887018 6:69635650-69635672 GAGAATCAGCACAGAGAAGTAGG - Intergenic
1010132065 6:72505895-72505917 GAGAATGAGCAGTAGGAACTAGG + Intergenic
1010372295 6:75124551-75124573 GAAAATCAGCGAAAGAAAGGGGG - Intronic
1010893788 6:81342933-81342955 TAGAATCAGGAGAAGGAAAAAGG + Intergenic
1011098576 6:83695185-83695207 GAGAATCACCAGAACCCAGGAGG + Intronic
1011750053 6:90446566-90446588 AAGAAGCAGCAGAAGCCAGGTGG + Intergenic
1011860349 6:91747184-91747206 GAGAATCACCTGAAGACAGGAGG + Intergenic
1012055204 6:94398002-94398024 GAGAATCAGAAAAGAGAAGGTGG + Intergenic
1012083159 6:94785735-94785757 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1012931849 6:105325746-105325768 GAGGATAAGAACAAGGAAGGTGG + Intronic
1012966309 6:105677651-105677673 GAGAAGCAGAAGATGGAAGAAGG - Intergenic
1013325239 6:109039100-109039122 GAGGAGAAGGAGAAGGAAGGAGG + Intronic
1013954209 6:115821577-115821599 GAGACTCAGAAGAAGAAGGGTGG + Intergenic
1014481422 6:121942750-121942772 GAAAATTTGCAGAAGGAAGCGGG - Intergenic
1014484081 6:121977755-121977777 GAGAGTCAGGAGAAGGGAGTGGG + Intergenic
1014773583 6:125484190-125484212 GTGGGTCAGCAGAAGTAAGGAGG - Intergenic
1015264980 6:131281766-131281788 TAGACTCAGCAGAGGGAAGCAGG - Exonic
1015636267 6:135277804-135277826 GAGACTCAGAAGGGGGAAGGTGG + Intergenic
1015804237 6:137092362-137092384 GAGAAACAGGAGGAGGAAGGAGG - Intergenic
1015817580 6:137226411-137226433 GAGAAACAGCAGAAGTGAGAAGG + Intergenic
1016075205 6:139787953-139787975 GAGAATCAGCAGAAGAACTCTGG - Intergenic
1016423170 6:143906531-143906553 GAGAATCACCTGAAGCCAGGAGG - Intronic
1016754963 6:147674827-147674849 GGGAAACAGCAGAAGGAGAGTGG - Intronic
1016935392 6:149445870-149445892 GAGAATAAACAGAAGGAAACAGG + Intergenic
1017219136 6:151945424-151945446 GAGAATCAACTGAAGGAACAAGG - Intronic
1017743865 6:157429601-157429623 GAGAAGGAGGGGAAGGAAGGAGG + Intronic
1018082602 6:160271296-160271318 GAGAGGCAACAAAAGGAAGGAGG - Intronic
1018113927 6:160564673-160564695 GAGAGTGAGCCGAAGCAAGGCGG + Intronic
1018176946 6:161185378-161185400 GAGAATCACCTGAACGCAGGGGG - Intronic
1018229691 6:161663781-161663803 GAGAATCATAGGAAAGAAGGAGG - Intronic
1018291005 6:162292636-162292658 CTGAATCAGCTGGAGGAAGGTGG + Intronic
1018383776 6:163284709-163284731 GAGAGGCATCAGAAGGGAGGCGG - Intronic
1018801630 6:167227210-167227232 ACCAGTCAGCAGAAGGAAGGAGG - Intergenic
1018958916 6:168432291-168432313 GAGGATGAGCAGGAGGGAGGAGG + Intergenic
1019124103 6:169827786-169827808 GAGAATAAAGAGAAGGATGGAGG - Intergenic
1019320796 7:414419-414441 GAGGATGAGGGGAAGGAAGGAGG - Intergenic
1019828763 7:3304927-3304949 GAGAATCACCTGGAGGGAGGAGG - Intronic
1020530171 7:9323159-9323181 AAGAATGGGGAGAAGGAAGGAGG + Intergenic
1020760429 7:12262043-12262065 CAGAAGCAGCAGAAGAAAAGTGG + Intergenic
1020828136 7:13058019-13058041 GAGGAGAAGCAGAAAGAAGGAGG - Intergenic
1020909457 7:14110346-14110368 GAGAATAAGCAGAAAGGAGTAGG - Intergenic
1021502438 7:21345795-21345817 GACAGTCAGCAGAAGCAGGGTGG - Intergenic
1022151125 7:27607705-27607727 GATAAGCAGCTGGAGGAAGGAGG - Intronic
1022964919 7:35463871-35463893 GAGAAGCATCAGAAGCAGGGTGG - Intergenic
1023026590 7:36056396-36056418 GAGAAGAAGCAGGAGGAAGCAGG + Intergenic
1023048514 7:36231703-36231725 CAGAATCAGCAGAAGAAAGGCGG + Intronic
1023049964 7:36242433-36242455 ATGAATGAACAGAAGGAAGGAGG - Intronic
1023693448 7:42818728-42818750 GAGAAGGAGAAGAAGGAAGAAGG + Intergenic
1024113386 7:46169839-46169861 TAGGATCAGCGGAGGGAAGGAGG + Intergenic
1024169395 7:46768540-46768562 ATCAATCAGGAGAAGGAAGGAGG - Intergenic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024674575 7:51626720-51626742 GGGAAGCAGCAGCAGGAGGGAGG - Intergenic
1025080586 7:55978880-55978902 GAGAATCAGCGGAAGGGACTTGG - Intronic
1025887775 7:65614523-65614545 GAGGAGGAGCAGATGGAAGGAGG - Intergenic
1026353177 7:69535105-69535127 GAGAATCAGCTGAACCCAGGAGG + Intergenic
1026879717 7:73900792-73900814 GAGGAGCAGGAGAAGAAAGGGGG - Intergenic
1027856846 7:83522544-83522566 GGGGATCAGGACAAGGAAGGAGG - Intronic
1027898880 7:84082326-84082348 AAGAATGAGCAGCAGGAAGTGGG + Intronic
1029361404 7:100090989-100091011 GAGAATCAAAAGCAGGAAAGAGG - Intronic
1030078479 7:105757289-105757311 GATAATCACAAGAAGGATGGAGG + Intronic
1030342943 7:108401148-108401170 GAGAATCACTTGAAGGCAGGAGG + Intronic
1030545654 7:110892076-110892098 GAGAAACAGGAGGTGGAAGGAGG - Intronic
1031674465 7:124591521-124591543 GAGACTCATAAGAAGGAAGGTGG + Intergenic
1031854602 7:126907187-126907209 GAGGAGGAGCAGATGGAAGGAGG + Intronic
1032012027 7:128352891-128352913 GAGAAGTAGGAGAAGGAAGAGGG - Intronic
1032561703 7:132899228-132899250 GAGAAGGAGCAGAAGAAAGCAGG + Intronic
1032774098 7:135091744-135091766 CAGTATGAGCAGAAGCAAGGAGG - Intronic
1032966369 7:137103246-137103268 GAGAGCAAGCAGAAGCAAGGTGG + Intergenic
1033227939 7:139575541-139575563 AAGAATCAGGAGAGGCAAGGTGG + Intronic
1033674424 7:143525159-143525181 GAGGATCATGAGAAGGAACGTGG - Intergenic
1033697412 7:143804288-143804310 GAGGATCATGAGAAGGAACGTGG + Intergenic
1033832620 7:145271698-145271720 AAGAATAAGCAGGAAGAAGGAGG + Intergenic
1034423506 7:151001291-151001313 GAGAATGAGCAGAAGGCCAGGGG + Exonic
1034490575 7:151391166-151391188 GAGAAGCCACAGAAGGCAGGAGG + Intronic
1034680104 7:152922123-152922145 GAGAAACAGCAAGAGGAAGAGGG + Intergenic
1034888790 7:154820739-154820761 GAGATTGGGGAGAAGGAAGGGGG + Intronic
1034995107 7:155572077-155572099 GAGAAAGAGAGGAAGGAAGGAGG + Intergenic
1035084869 7:156249428-156249450 GAGCACCACGAGAAGGAAGGCGG + Intergenic
1035356808 7:158280591-158280613 GAGAACCAGGAGATGAAAGGAGG + Intronic
1035516769 8:240376-240398 GAGGACCAGCAGAAGGGAGAAGG + Intronic
1035743908 8:1947792-1947814 GAGCAGCAGCAGTAGGGAGGCGG - Intronic
1036188839 8:6650852-6650874 GAGAAGAGACAGAAGGAAGGAGG - Intergenic
1036708439 8:11061771-11061793 AAGAATGAGAAGAAGGAAGGGGG + Intronic
1036783211 8:11664782-11664804 GAGACTCAGAAGAAAGAGGGAGG - Intergenic
1037547586 8:19939594-19939616 GAGGATGAGAAGAAGGAAGTTGG + Intronic
1037861460 8:22408454-22408476 GAGAATGAGCAGACGGAGGAGGG + Exonic
1038141863 8:24853825-24853847 GAGAATCAGCTGAACCTAGGAGG + Intergenic
1038240093 8:25800453-25800475 GAGACTGAGCAGAAGGAATATGG - Intergenic
1038271920 8:26082119-26082141 GAAACTCAGCTGCAGGAAGGAGG - Intergenic
1038324818 8:26564924-26564946 GAGACTCAGAAGAAGGAGGGTGG - Intronic
1039799424 8:40941546-40941568 GAGAATCAGGAGAATGAACCTGG - Intergenic
1040108532 8:43554552-43554574 GAGACTCACCAGGAGAAAGGTGG - Intergenic
1040579081 8:48681242-48681264 GAGAATCTGAAGAGGGAAGGAGG - Intergenic
1041706420 8:60850971-60850993 GATAAGCAAAAGAAGGAAGGGGG - Intronic
1041744987 8:61198719-61198741 GAGACTTAGAAGAAGGGAGGAGG - Intronic
1042000703 8:64121113-64121135 GAAACTCAGAAGAAGGAAAGTGG + Intergenic
1042478731 8:69280045-69280067 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1042579153 8:70257516-70257538 GAGAAAGAGCAGCAGGCAGGAGG + Intronic
1042732232 8:71948778-71948800 AAGAATGAAAAGAAGGAAGGGGG + Intronic
1044402245 8:91786183-91786205 GAGAAGCAGCAGCAGCAAGAAGG - Intergenic
1044574680 8:93754982-93755004 GAGGAACAACAGAAGGAACGCGG - Exonic
1044722043 8:95160184-95160206 GAGCCTCAGCAGAGGGAATGGGG - Intergenic
1045199581 8:99967069-99967091 GAGCATGAGCAGAAGCAGGGTGG + Intronic
1045372523 8:101539054-101539076 GAGACTCAGCAGGAGGGAGTAGG + Intronic
1046275222 8:111950157-111950179 GGGAATCAGTGGAAGGAGGGAGG + Intergenic
1046612448 8:116440980-116441002 GGAAATCAGCAGAAGGCATGGGG - Intergenic
1046652373 8:116851235-116851257 AAGAATTACCAGAAGGAGGGTGG + Intronic
1046874837 8:119242601-119242623 AAAAATCAGCAGAAGAAGGGTGG + Intronic
1048034661 8:130666091-130666113 GAAAAGCAGGAGAAGGCAGGAGG + Intergenic
1048230505 8:132635923-132635945 GCAAATCAGCAGAAGCTAGGAGG + Intronic
1048468722 8:134688529-134688551 GAGAAAGGGGAGAAGGAAGGTGG + Intronic
1048630183 8:136233948-136233970 GAGAATAAGCAGAAGCAGGATGG - Intergenic
1049058446 8:140257386-140257408 GAGGAGAAGTAGAAGGAAGGTGG - Intronic
1050119074 9:2289377-2289399 GGGCATCAGCAGAGGGAAGCAGG + Intergenic
1050475620 9:6037821-6037843 GAGACTCAGAAGAATGTAGGAGG - Intergenic
1050746537 9:8882793-8882815 GAGAATCAGGTGAAGCCAGGAGG + Intronic
1051059968 9:13034461-13034483 GGGAAACAGCAGAAGAATGGGGG - Intergenic
1051229588 9:14941906-14941928 GAGAATCTGCACCTGGAAGGTGG + Intergenic
1051324822 9:15954202-15954224 GAAAGCTAGCAGAAGGAAGGGGG - Intronic
1051780005 9:20679928-20679950 GAGAAACAGCAGAGAGAGGGTGG - Intronic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1052465434 9:28823326-28823348 GAAATCCAGCAGCAGGAAGGAGG + Intergenic
1052548155 9:29907316-29907338 GAGAATCACCAGGAAGAAGCAGG - Intergenic
1052830619 9:33212261-33212283 GAGCAGCAGAAGAAGGGAGGAGG + Intergenic
1052968766 9:34363622-34363644 GAGCAGCAGCAGGGGGAAGGGGG - Intergenic
1053244135 9:36520530-36520552 GAGAATCATCAGAACCCAGGAGG - Intergenic
1053836457 9:42141419-42141441 CAGAAACAGGAGAAAGAAGGAGG + Intergenic
1054253993 9:62746189-62746211 GAGAAGCAGCCCAAGGAAGTGGG + Intergenic
1054735175 9:68743816-68743838 GAGAATCAATAGAAGGACAGGGG - Intronic
1055119185 9:72638509-72638531 CAAAATAAGCAGCAGGAAGGGGG - Intronic
1055511035 9:76995791-76995813 TGGAAGGAGCAGAAGGAAGGGGG - Intergenic
1055576469 9:77664916-77664938 GAGAAACAACAAAAGGCAGGAGG - Intergenic
1055658142 9:78472921-78472943 GAGGATTTCCAGAAGGAAGGTGG + Intergenic
1055928835 9:81539013-81539035 CTGAATCAGCAGAAGGTGGGAGG + Intergenic
1056018423 9:82416590-82416612 AGGAAGCAGCAGCAGGAAGGGGG + Intergenic
1056271154 9:84949215-84949237 GAAAAGCTTCAGAAGGAAGGAGG + Intronic
1056385358 9:86092362-86092384 CAGAGTCAGGAGAAGGAAAGAGG - Intronic
1056418720 9:86402877-86402899 GAGAATGAGCAGCATGAAGCCGG - Intergenic
1056541219 9:87572983-87573005 CAGAATCAGCATCTGGAAGGTGG - Intronic
1056587691 9:87939032-87939054 GAGGATTAGGAGAAGGAAGAGGG - Intergenic
1057287850 9:93774712-93774734 GAGAATTAGGAGAAAGAAAGAGG - Intergenic
1057369729 9:94459544-94459566 GAGGATGAGCAGAATGATGGCGG - Exonic
1058276495 9:103048042-103048064 GAGAATCAGAAGGGGGAGGGTGG + Intergenic
1058569576 9:106326236-106326258 GAGAATCAAGAGAGGGAGGGAGG + Intergenic
1058588513 9:106535691-106535713 GGGCAACAGCAGAAGGCAGGAGG + Intergenic
1058686630 9:107486998-107487020 GACAAACTGCAGAAGGGAGGGGG - Intronic
1058875874 9:109244400-109244422 GAGAAAGAAGAGAAGGAAGGAGG + Intronic
1059173110 9:112145367-112145389 GAGAATCAGTTGAAGTCAGGAGG - Intronic
1059303397 9:113333957-113333979 GAGAAGGAGGAGAAGGAAGAAGG - Intronic
1059804884 9:117787884-117787906 GAGAACCAGAAGAAGGGAAGTGG - Intergenic
1060891083 9:127188908-127188930 GAGAATCACCTGAATGCAGGAGG + Intronic
1060917957 9:127402602-127402624 GAGAAGCAGCATGAGGGAGGGGG - Exonic
1061133592 9:128721418-128721440 GAGGGACAGCAGCAGGAAGGTGG + Exonic
1061731146 9:132615014-132615036 GAGAATGTGCAGAAGGAACAGGG + Intronic
1062190716 9:135246619-135246641 GAGGATGAGCAGAAGGAAGGAGG - Intergenic
1203365274 Un_KI270442v1:250303-250325 GAGTGTCAGCAAAAGGGAGGCGG - Intergenic
1185501747 X:602075-602097 GAGAAGAAGAAAAAGGAAGGAGG - Intergenic
1186532851 X:10314690-10314712 GAGAGGCAGGAGAGGGAAGGTGG + Intergenic
1186643532 X:11482518-11482540 CAGTATGAGCACAAGGAAGGTGG - Intronic
1186671506 X:11771667-11771689 GAGAATCACCTGAACCAAGGAGG - Intronic
1186774941 X:12855044-12855066 GAGGGTGAGCAGAAGCAAGGTGG - Intergenic
1186962610 X:14752932-14752954 GAGACAGAGAAGAAGGAAGGAGG - Intergenic
1187245767 X:17551692-17551714 GAGAATCAAATGAAGGAGGGTGG + Intronic
1187337012 X:18390282-18390304 GAGAATCAGCAGAACCTGGGAGG - Intergenic
1187609138 X:20921267-20921289 GAGAAACTGCAGAAGCAAGAAGG + Intergenic
1187620445 X:21047354-21047376 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1187718902 X:22131531-22131553 AACAAACAGCAGATGGAAGGGGG - Intronic
1188193129 X:27196830-27196852 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1189150216 X:38699044-38699066 GAGCATAAGCATAATGAAGGAGG + Intergenic
1189712363 X:43826694-43826716 AAGTATGAGCAGAAGGAAAGGGG + Intronic
1189785875 X:44558410-44558432 GAGAAGCAGCAGCAGGCAGTTGG + Intergenic
1190478388 X:50850450-50850472 GCCAGTCAGGAGAAGGAAGGAGG + Intergenic
1191135488 X:57059245-57059267 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1191713133 X:64174156-64174178 CAGCATCAGCAGAAGCAAGTTGG - Intergenic
1191766804 X:64706345-64706367 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1192998102 X:76533692-76533714 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1193992355 X:88323609-88323631 TAGTATCAGAAGAGGGAAGGTGG - Intergenic
1194453930 X:94079526-94079548 GAGACTCAGAAGCAGGGAGGAGG - Intergenic
1194537632 X:95125622-95125644 GAGAAGGAGGAGAAGGAAAGAGG + Intergenic
1194669294 X:96710491-96710513 TAGAATCACCAGAAAGAATGTGG - Intronic
1194961132 X:100236775-100236797 GAGAATGAGCCGAAGCAGGGTGG - Intergenic
1195069642 X:101266782-101266804 GAGAATAAGGAGAAAGAATGAGG - Intergenic
1195540060 X:106053296-106053318 CAGAGGCTGCAGAAGGAAGGGGG + Intergenic
1195615069 X:106905674-106905696 GAGAATCAGCAGAAGGAAGGAGG + Intronic
1195751006 X:108161981-108162003 GAGGATGAGAAGAAGGGAGGAGG - Intronic
1196206825 X:112949288-112949310 GCGAATCTGGAGAAGTAAGGAGG + Intergenic
1196603049 X:117623388-117623410 GAGGGTCAGCAGAAGCAGGGTGG - Intergenic
1196931378 X:120684998-120685020 GAGACTCAGAAGAAGAAAGAAGG - Intergenic
1197571315 X:128154159-128154181 GAGACTCAGAAGTAGGAGGGTGG + Intergenic
1197686425 X:129444059-129444081 TAGAATCAAAAGAAGGCAGGTGG - Intergenic
1198038326 X:132823428-132823450 GAGACTCAGAAGGAGGAGGGTGG - Intronic
1198060648 X:133042490-133042512 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1198295482 X:135282783-135282805 GAGGGTGAGCAGAAGCAAGGTGG - Intronic
1198322455 X:135532008-135532030 GAGAAGTTGCAGAAGGAAGGAGG + Intronic
1198559634 X:137835377-137835399 GAGATACAGCAAAAGGAAAGAGG - Intergenic
1199266513 X:145834075-145834097 GAGAATTCGCAGAAGCATGGAGG - Intergenic
1199600859 X:149540368-149540390 GAGAATCAGCAGGGGGAGGCAGG - Intronic
1199751550 X:150824134-150824156 GAGGAGGAGAAGAAGGAAGGAGG + Intronic
1200109608 X:153733660-153733682 GAGAACCTGCAGAAGGCAGCTGG + Intronic
1200732943 Y:6762283-6762305 GAGAATCACCTGAACTAAGGAGG - Intergenic
1201015945 Y:9601540-9601562 GAGAGTTGGCAGAAGGAATGGGG - Intergenic
1201461674 Y:14232562-14232584 AAGAAGCAGAAGAAGGAAGGAGG - Intergenic
1201643471 Y:16202491-16202513 GAGACTCACCAGGAGAAAGGTGG + Intergenic
1201659344 Y:16382830-16382852 GAGACTCACCAGGAGAAAGGTGG - Intergenic
1201736674 Y:17270753-17270775 GAGAATCAGTTGAAGCCAGGAGG - Intergenic
1202169301 Y:22024094-22024116 GAGAACCAGAGGAAGGAGGGAGG - Intergenic
1202186938 Y:22195575-22195597 GATAATCAGGAGTTGGAAGGTGG + Intergenic
1202204422 Y:22390821-22390843 GATAATCAGGAGTTGGAAGGTGG - Intronic
1202222060 Y:22562271-22562293 GAGAACCAGAGGAAGGAGGGAGG + Intergenic
1202321055 Y:23633396-23633418 GAGAACCAGAGGAAGGAGGGAGG - Intergenic
1202549712 Y:26036660-26036682 GAGAACCAGAGGAAGGAGGGAGG + Intergenic