ID: 1195616271

View in Genome Browser
Species Human (GRCh38)
Location X:106914502-106914524
Sequence AAACCACATATTGCAACAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195616269_1195616271 20 Left 1195616269 X:106914459-106914481 CCTATCTTTGTGGGGCTGGATTT No data
Right 1195616271 X:106914502-106914524 AAACCACATATTGCAACAGCTGG No data
1195616268_1195616271 21 Left 1195616268 X:106914458-106914480 CCCTATCTTTGTGGGGCTGGATT No data
Right 1195616271 X:106914502-106914524 AAACCACATATTGCAACAGCTGG No data
1195616266_1195616271 24 Left 1195616266 X:106914455-106914477 CCTCCCTATCTTTGTGGGGCTGG No data
Right 1195616271 X:106914502-106914524 AAACCACATATTGCAACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195616271 Original CRISPR AAACCACATATTGCAACAGC TGG Intronic