ID: 1195616823

View in Genome Browser
Species Human (GRCh38)
Location X:106919218-106919240
Sequence TGTATTGTAGAAGATATCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 86}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195616823_1195616827 22 Left 1195616823 X:106919218-106919240 CCATCGATATCTTCTACAATACA 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1195616827 X:106919263-106919285 TTCTGGCTGGTGGCATTATGAGG 0: 1
1: 0
2: 1
3: 16
4: 177
1195616823_1195616825 9 Left 1195616823 X:106919218-106919240 CCATCGATATCTTCTACAATACA 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1195616825 X:106919250-106919272 TAGCAATGATTATTTCTGGCTGG 0: 1
1: 0
2: 1
3: 35
4: 309
1195616823_1195616824 5 Left 1195616823 X:106919218-106919240 CCATCGATATCTTCTACAATACA 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1195616824 X:106919246-106919268 ATGTTAGCAATGATTATTTCTGG 0: 1
1: 3
2: 21
3: 112
4: 527
1195616823_1195616826 12 Left 1195616823 X:106919218-106919240 CCATCGATATCTTCTACAATACA 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1195616826 X:106919253-106919275 CAATGATTATTTCTGGCTGGTGG 0: 1
1: 0
2: 7
3: 39
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195616823 Original CRISPR TGTATTGTAGAAGATATCGA TGG (reversed) Intronic
909338352 1:74502848-74502870 TGTTTTGAAGAAGATACAGAGGG - Intronic
909737512 1:78982001-78982023 TGTATTTTAGAAGATCTTAAAGG - Intronic
910393995 1:86773720-86773742 TGTTTTGTATATGATATCCATGG - Intergenic
916961013 1:169889967-169889989 CATATTGTAGAAGATTTGGAAGG - Intronic
919191488 1:194226504-194226526 TGTATTACAGTAGATATGGAAGG - Intergenic
921333747 1:214065731-214065753 TATATTGGAGGAGATTTCGAGGG - Intergenic
1062962219 10:1581122-1581144 TGTATTGGCGAGGATATAGAGGG - Intronic
1063865374 10:10359115-10359137 TGTATTTTAGAATATATCATTGG - Intergenic
1067770473 10:49119389-49119411 TGTATTGTATAATATATATATGG + Intergenic
1073749479 10:106507957-106507979 TGGATTGTAATAGATATCAATGG + Intergenic
1079639594 11:22788419-22788441 TGTATTGTAGGAGATTTCACTGG + Intronic
1080608352 11:33883516-33883538 TGTAATGGAGAAGAAATCCATGG + Intronic
1081501444 11:43670586-43670608 TGTATTTTAAAAGATAGCAAGGG + Intronic
1086039867 11:82463171-82463193 TCAACTGTAGAAGATATTGATGG + Intergenic
1087917364 11:103826651-103826673 TGTATTGTACAAGAAATCTTTGG - Intergenic
1087990691 11:104743299-104743321 TTTATTGTAGAAGACATGAAAGG + Intergenic
1098159217 12:67632514-67632536 TGTATTGTTGAAGTTATTAATGG + Intergenic
1099000195 12:77170366-77170388 TGTCTTGTAGACGGTATCAAAGG + Intergenic
1100089306 12:90951236-90951258 TCTATTCTAGAAGATATGGATGG + Intronic
1102908107 12:116692992-116693014 TCGATTGTAGAAGATCTGGAAGG - Intergenic
1108686481 13:52823773-52823795 TGAATTTTGGAAGATACCGATGG - Intergenic
1111555029 13:89869071-89869093 TCTATTGTAAATGATACCGAAGG - Intergenic
1114153768 14:20075529-20075551 TGAATTGTAGGAGATAAAGAAGG + Intergenic
1116130413 14:40849083-40849105 TGTTTTGCAGAAGGTATAGATGG + Intergenic
1116169290 14:41379145-41379167 TCTATTGAAGTAGTTATCGAAGG + Intergenic
1117261322 14:54036732-54036754 TATATTGTAGAAGATATAAATGG - Intergenic
1118324370 14:64771369-64771391 TGTATTGTTGAGGAGATCAAAGG - Intronic
1121197418 14:92086390-92086412 TGTATTTTAGTAGAGATGGAAGG - Intronic
1122444451 14:101759181-101759203 TGCATTTTAGAAGACATCGGTGG - Intergenic
1126821509 15:52508835-52508857 TGTATTGTTGAAAATATGCAAGG - Intronic
1128826867 15:70726712-70726734 TTTATTGTAGAAAATTTAGAAGG - Intronic
1134898946 16:17916966-17916988 TGTTTTGTTGAAGAAATGGAGGG - Intergenic
1139803943 16:69547710-69547732 TATATTATAGAAAATATCAAAGG - Intergenic
1148005651 17:44426818-44426840 TGTGTTGTTGAAGAGATCAAAGG - Intronic
1152053967 17:78007198-78007220 AGTATTTTAGAGGATATAGAAGG - Intronic
1153563494 18:6395809-6395831 TTTATTGTAGATAATATCCATGG - Intronic
1157939960 18:51917782-51917804 TGTATGGTGGAAAATATCAAAGG - Intergenic
1161841759 19:6685941-6685963 TGTATTCTAGAACCTATAGATGG + Intronic
929679536 2:43977000-43977022 TGTAATGTAGGAGATATTGAAGG - Exonic
935525255 2:104157866-104157888 TTTATTGTATAAGGTATAGAAGG + Intergenic
935697160 2:105780176-105780198 TTTATTGTAGAATATTTGGAAGG + Intronic
945486220 2:210399170-210399192 TGTATTTTAAAAGGTATAGAGGG + Intergenic
1171355461 20:24542060-24542082 TGTGTTGAAAGAGATATCGAAGG + Intronic
1177388518 21:20437301-20437323 TGTATTGTGCAAGTTTTCGAGGG - Intergenic
952265406 3:31780920-31780942 AGTATTGCAGAAGATAAAGAGGG + Intronic
957853106 3:85836678-85836700 TGCACTGAAGAAGATATCCAGGG + Intronic
957875169 3:86135561-86135583 TATATTATTGAAGATATCAATGG - Intergenic
959977403 3:112476248-112476270 TGAAATATAGAAGAAATCGATGG - Intronic
960128025 3:114022131-114022153 TGTATTGTGGAAGATTTTGTGGG - Intronic
962396850 3:135023378-135023400 TGCATTGTAGAAGATTTAGCAGG + Intronic
962425217 3:135263476-135263498 TGTATTGTTCAAGATATCATTGG + Intergenic
963215406 3:142740598-142740620 TGAATTGTTGAAGATATCAGAGG + Intronic
966170403 3:177073873-177073895 TGTATTGTAGAAGGTGCCAAAGG + Intronic
970925919 4:21452250-21452272 TGTATGCTAGAAGATGTCTACGG - Intronic
971524234 4:27595991-27596013 TGTATTTTAGATCATATTGAAGG + Intergenic
974934202 4:68394162-68394184 TTTATTGTAAAAGATATTGCAGG - Intergenic
981025840 4:140076290-140076312 TATATTGGAGAAAATATCTAAGG - Intronic
982607955 4:157537977-157537999 TGCATGGTACAAGATATTGACGG - Intergenic
983368278 4:166824258-166824280 TGTATTGTAGAATACTTCGAGGG - Intronic
986027383 5:3863749-3863771 TTTATTGTTGAAGATGTTGATGG - Intergenic
987239343 5:15978087-15978109 TCTGGTGTAGATGATATCGAGGG + Intergenic
990108608 5:52294689-52294711 TGTATTATAGCACATAACGATGG + Intergenic
992115568 5:73535717-73535739 AGTATTGTAGAAGACAGAGAAGG + Intergenic
997159202 5:131589315-131589337 TATATAGTATAAGATATTGAAGG + Intronic
998488447 5:142524460-142524482 TGTATTGTAGCAGGGATCAATGG - Intergenic
999860090 5:155635359-155635381 TTTATTGTAGAAAATTTGGAAGG + Intergenic
1004435577 6:15589805-15589827 GGTATAGTTGAAGATATTGAAGG - Intronic
1004835359 6:19525352-19525374 TGTTTTATAGAAGATACCAATGG + Intergenic
1005301772 6:24478159-24478181 TTTTTTGTAGAAGCTATCAAGGG + Intronic
1010498948 6:76570636-76570658 TTTAGTTTAGAAGATATTGATGG + Intergenic
1011368667 6:86608827-86608849 TGTTTTGCAGAAGATATAAAAGG + Intergenic
1013119193 6:107126370-107126392 TGTATTGGAGAAGAAATGGGTGG - Intergenic
1013218706 6:108056468-108056490 TGTATGGTGTAAGATATCTATGG - Intronic
1017463549 6:154673609-154673631 TGTCTTGTAGAGGGTATAGATGG - Intergenic
1023564784 7:41513339-41513361 TGTAATGTAAAAGAAATAGAAGG - Intergenic
1024373536 7:48612924-48612946 TGTATTGTAGAGAAAAACGAGGG - Intronic
1030341495 7:108385782-108385804 TGTATTGGAGAGAATATGGAAGG + Intronic
1032098450 7:128952337-128952359 TGTAGAGTAGAAGATATCAATGG + Intergenic
1036125030 8:6054750-6054772 TGCAGAGTAGAAGATATTGATGG - Intergenic
1041938087 8:63356860-63356882 TGTTTTGAAGAAGAAATAGAAGG - Intergenic
1043226871 8:77744688-77744710 TGTCTTGTAGAAAATGTCAAAGG + Intergenic
1043983257 8:86664864-86664886 TGTATTGATGGAGATATGGATGG + Intronic
1044420005 8:91983488-91983510 TATATTATAGAAGATATCTTTGG - Intronic
1045587683 8:103557605-103557627 TGTATGGTAGAAATTATCAAGGG - Intronic
1052226021 9:26087352-26087374 TTTATTGAAGAAGACATGGAAGG - Intergenic
1059008442 9:110429876-110429898 TATATTGTAGAAGATGTTGATGG - Intronic
1186667829 X:11736616-11736638 CGTTTTGTAGAAGGTATTGATGG - Intergenic
1188098814 X:26056822-26056844 TGTATTTTAGTAGATAGAGATGG - Intergenic
1193530162 X:82646502-82646524 TGGATTGCAGAACATATGGAAGG + Intergenic
1195616823 X:106919218-106919240 TGTATTGTAGAAGATATCGATGG - Intronic
1195798121 X:108675817-108675839 TATATAGTAGAAGCTATGGAAGG - Intronic
1197891327 X:131273431-131273453 TGTATTGGAGCTGATCTCGATGG - Intergenic
1200871459 Y:8103280-8103302 TCTATTTTAGAAGATAACGTTGG + Intergenic