ID: 1195619367

View in Genome Browser
Species Human (GRCh38)
Location X:106937699-106937721
Sequence ATACAGTGGTTGGCAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 202}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195619362_1195619367 2 Left 1195619362 X:106937674-106937696 CCCTGGTACTAGGATAAGCTCTA 0: 1
1: 0
2: 0
3: 1
4: 62
Right 1195619367 X:106937699-106937721 ATACAGTGGTTGGCAAAAACAGG 0: 1
1: 0
2: 0
3: 11
4: 202
1195619363_1195619367 1 Left 1195619363 X:106937675-106937697 CCTGGTACTAGGATAAGCTCTAG 0: 1
1: 0
2: 1
3: 5
4: 94
Right 1195619367 X:106937699-106937721 ATACAGTGGTTGGCAAAAACAGG 0: 1
1: 0
2: 0
3: 11
4: 202
1195619357_1195619367 29 Left 1195619357 X:106937647-106937669 CCATCATTAACTAACTACCTCCT 0: 1
1: 0
2: 4
3: 104
4: 797
Right 1195619367 X:106937699-106937721 ATACAGTGGTTGGCAAAAACAGG 0: 1
1: 0
2: 0
3: 11
4: 202
1195619361_1195619367 9 Left 1195619361 X:106937667-106937689 CCTAGATCCCTGGTACTAGGATA 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1195619367 X:106937699-106937721 ATACAGTGGTTGGCAAAAACAGG 0: 1
1: 0
2: 0
3: 11
4: 202
1195619356_1195619367 30 Left 1195619356 X:106937646-106937668 CCCATCATTAACTAACTACCTCC 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1195619367 X:106937699-106937721 ATACAGTGGTTGGCAAAAACAGG 0: 1
1: 0
2: 0
3: 11
4: 202
1195619359_1195619367 12 Left 1195619359 X:106937664-106937686 CCTCCTAGATCCCTGGTACTAGG 0: 1
1: 0
2: 0
3: 4
4: 94
Right 1195619367 X:106937699-106937721 ATACAGTGGTTGGCAAAAACAGG 0: 1
1: 0
2: 0
3: 11
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195619367 Original CRISPR ATACAGTGGTTGGCAAAAAC AGG Intronic
900838484 1:5026372-5026394 ATAGAGTGGATGGCAAAAAGAGG - Intergenic
901338570 1:8473388-8473410 ATACAGTGGTGTGCAAAGACAGG + Intronic
901610289 1:10492790-10492812 ATACAGTGATAAGCAAACACAGG + Intronic
904873718 1:33637312-33637334 ATACTGTGGTTTTCATAAACTGG - Intronic
905503874 1:38460946-38460968 ATAAAGTAGTTTGCAAAATCTGG + Intergenic
906445965 1:45898336-45898358 AAACATTGGTTGTCTAAAACAGG - Intronic
907447379 1:54517329-54517351 ACACAGTGCTTGGCACAAAGTGG + Intergenic
909451263 1:75800160-75800182 AGAGAGTGGTTGCCAGAAACTGG - Intronic
909598090 1:77429499-77429521 ATACATTGGTGGGCAAAAGATGG + Intronic
910436193 1:87208564-87208586 ATACAGTGCCTGGCACACACCGG + Intergenic
917195453 1:172460017-172460039 AGACAGTGGTTGTCAAAGATTGG + Intronic
917603812 1:176604451-176604473 GTACAGTGGTTGGCAAACCATGG + Intronic
922144457 1:222925687-222925709 ATACAGTGGTTCTCAAAATGTGG + Intronic
924091002 1:240500702-240500724 ATTCAGTGGTGGGGATAAACAGG - Intronic
924688157 1:246317393-246317415 ATTCAGGGGTTGGCAAATAAAGG + Intronic
1067781208 10:49208840-49208862 GTACAGTGTTTGGCACACACAGG + Intergenic
1072195102 10:93110975-93110997 AAACAGTGGTTGACTAAAAGAGG - Intergenic
1073006438 10:100328943-100328965 AAACAATGGCTGCCAAAAACTGG + Intronic
1073889587 10:108084021-108084043 ATACAGTGCGTGGCAGACACAGG + Intergenic
1079222048 11:18571718-18571740 ATACATTGGTAGGCCAAAATGGG + Intronic
1081145217 11:39555353-39555375 AAATAGTGGTTGCCAAGAACTGG - Intergenic
1082016898 11:47496034-47496056 ATACAGTGCTGTGGAAAAACTGG + Intronic
1082297171 11:50455724-50455746 ATTCAGCAGTTTGCAAAAACTGG + Intergenic
1083069677 11:59964408-59964430 TTACAGTGACTGGCAAAATCAGG + Intergenic
1085767148 11:79293106-79293128 ACACAGTGGCTAGCAAAAAATGG - Intronic
1086555414 11:88104627-88104649 GTACAGTAGTTGGCACAAAGTGG + Intergenic
1087247750 11:95859511-95859533 AAACAGTGGTGGGGAAAAATTGG + Intronic
1087402637 11:97686739-97686761 ATAAAGTGGTTGTCAAAACAAGG + Intergenic
1088498084 11:110452824-110452846 ATACAGTGTTTGACTGAAACTGG - Intronic
1089044225 11:115485343-115485365 ATACAATGATTGGCACACACTGG + Intronic
1090474632 11:127008751-127008773 ATACAGTGGTTCCCAACAAGGGG + Intergenic
1092974193 12:13728348-13728370 AAACAGTGGTTCTCTAAAACTGG - Intronic
1093452215 12:19328932-19328954 ATACTGAGATGGGCAAAAACTGG - Intronic
1093890712 12:24517045-24517067 ATACATTAGTTTTCAAAAACAGG + Intergenic
1099155166 12:79166167-79166189 AAACAGTGATTTGCAAAAGCAGG - Intronic
1100685199 12:96979863-96979885 AAACACTGGGTGGCAAAAAACGG + Intergenic
1100741078 12:97594332-97594354 ACACAGTGGTTGATAAAAAGAGG - Intergenic
1103706786 12:122879242-122879264 AGACAGTGGTTTTCAAGAACAGG - Intronic
1109688297 13:65849560-65849582 TTAAAGTGGTAGGAAAAAACTGG - Intergenic
1109826752 13:67731407-67731429 ATATAGTGGTAGGCAAAGAAGGG - Intergenic
1109967691 13:69723146-69723168 AAACAGTGGTTATCAAAGACTGG + Intronic
1110500976 13:76227888-76227910 ATCCAGTGGTTTGCAGAAAAAGG + Intergenic
1111247016 13:85552911-85552933 ATACAGTATTAGGCAAAAACGGG + Intergenic
1112541989 13:100323232-100323254 AGACAATGGTTGGCAAAATATGG - Intronic
1112581094 13:100676717-100676739 ATAAATTTGTTGGCAAAAAGTGG + Intergenic
1114297232 14:21340940-21340962 ATACAGTGTTTTGAAAAATCTGG - Intronic
1115882761 14:37938434-37938456 ATACAGTGGTTTGCACAATTGGG - Intronic
1118009405 14:61594098-61594120 ATACAATGGCTGACAAAATCAGG + Intronic
1120668063 14:87330858-87330880 ACACAGTGTCTGGCAAAAAAGGG + Intergenic
1122502747 14:102212258-102212280 GTACACTCCTTGGCAAAAACTGG - Intronic
1123167788 14:106342970-106342992 ATACAGTTGTTGGCAGCCACAGG + Intergenic
1123170414 14:106367681-106367703 ATACAGTTGTTGGCAGCCACAGG + Intergenic
1125267432 15:37899308-37899330 ATAAAGGGTTTGGCCAAAACTGG + Intergenic
1126782619 15:52151352-52151374 ACACAGTGGGTGGCACACACAGG - Intronic
1130038505 15:80383463-80383485 ATCCTGTGCTTTGCAAAAACAGG + Intronic
1133159849 16:3903735-3903757 AAACAGTGGCTGGATAAAACTGG - Intergenic
1134573453 16:15311724-15311746 ATCCAGAATTTGGCAAAAACAGG - Intergenic
1134728930 16:16444238-16444260 ATCCAGAATTTGGCAAAAACAGG + Intergenic
1134938505 16:18267628-18267650 ATCCAGAATTTGGCAAAAACAGG - Intergenic
1138209297 16:55149721-55149743 AAACAGTGTTTGGCAAATAGAGG + Intergenic
1138518832 16:57558609-57558631 AAGCAGAGGTTGTCAAAAACTGG - Intronic
1143023170 17:3927082-3927104 AAGCAGTGGTTGGAAAGAACAGG - Intronic
1147337581 17:39736924-39736946 ATTCAGTGCTGGGCAAACACAGG - Intergenic
1148995452 17:51705474-51705496 AAACAGTGCTTGGCACATACAGG + Intronic
1149810373 17:59663938-59663960 ATTCAGTGCTTTGCAGAAACAGG + Exonic
1150412556 17:64958237-64958259 ACACAGTGTCTGTCAAAAACAGG + Intergenic
1151628922 17:75296658-75296680 AAACAGTGTCTGGCCAAAACAGG - Intergenic
1151741209 17:75983497-75983519 AAACACTGGTTGTCTAAAACAGG - Intronic
1152175481 17:78784022-78784044 AAACAGAGGATGGCAAATACTGG - Intergenic
1152386990 17:79980602-79980624 ACACAGTGGGTGGCAGGAACGGG + Intronic
1153745004 18:8169195-8169217 ATACAATGGTTGGAGAAAATAGG - Intronic
1155399525 18:25422618-25422640 CCACAGGGGTGGGCAAAAACAGG + Intergenic
1155413774 18:25573925-25573947 AAACAGTGGTTGCCAAGAGCTGG - Intergenic
1155596151 18:27489903-27489925 ATACATTAGTTGGAAAAAATGGG + Intergenic
1155605495 18:27601011-27601033 ATCCAGGGGTTGGCAAATAATGG + Intergenic
1155612184 18:27678358-27678380 ATACAGTGATTGAAAACAACTGG + Intergenic
1156745560 18:40386875-40386897 ATTCAGTGGTTTGCAAGACCAGG + Intergenic
1157053182 18:44194410-44194432 ACACAGGGGTTGGCAAACATTGG - Intergenic
1157135658 18:45052092-45052114 GTACAGTGCCTGGCACAAACTGG + Intronic
1157210416 18:45737258-45737280 ATACAGTGGTTCTCAAACTCTGG - Intronic
1157967180 18:52221647-52221669 AGCCAGTGCTTGGCAGAAACTGG - Intergenic
1158162344 18:54499517-54499539 AAACAGTGGTTGCCAAGAGCTGG + Intergenic
1164796628 19:31039065-31039087 ATACAGGAGTTGGCACAAGCTGG - Intergenic
1165579056 19:36846605-36846627 ATACAATGGTTGACAGGAACAGG + Intronic
1165700205 19:37931775-37931797 ATAAAGTAGTGGGTAAAAACTGG + Intronic
1167737545 19:51305384-51305406 AAACTTTGGTTGTCAAAAACAGG - Intergenic
1168687134 19:58355846-58355868 ATGCAGAGGTGGGCAAGAACTGG - Exonic
925842166 2:8002585-8002607 ATACTGTGGTTGGCAAACCACGG - Intergenic
929769007 2:44875935-44875957 AGACATTGGTTGCCAAAAACAGG + Intergenic
929821468 2:45277394-45277416 TTACAGTGGTTCCCCAAAACAGG - Intergenic
934497051 2:94812567-94812589 AGACAGTGGTTGCCTACAACAGG + Intergenic
935725059 2:106016572-106016594 ATAGAGTGCTTGGAAGAAACTGG + Intergenic
936395179 2:112121246-112121268 ATACAGTGGTTACCAAAGCCTGG - Intergenic
940619481 2:156093040-156093062 ATTCAGTGGTTGGCTAGAAGAGG - Intergenic
941137823 2:161739352-161739374 AAACATTGGTTGGCCAAAATAGG - Intronic
942325282 2:174771305-174771327 ATACAGCGGTGAGCAGAAACAGG - Intergenic
942336088 2:174887886-174887908 TTGCAGTGGTTGGCATATACTGG - Intronic
942931730 2:181501999-181502021 ATGAAGAGGTTGGCAAAAAGAGG + Intronic
944005418 2:194898700-194898722 ACACAGGGGTTGGGAAACACAGG + Intergenic
946812721 2:223543267-223543289 CTACAGTTGTTGGCTAAAATAGG - Intergenic
947006455 2:225517195-225517217 ATATAGTGGTGAGCATAAACTGG + Intronic
1168970718 20:1929031-1929053 ATGCAGTTGCTGGCAAAACCTGG - Intronic
1169835151 20:9869707-9869729 AGTCAGTGGATGGCAAAAATAGG + Intergenic
1172273037 20:33665062-33665084 ATACAGTGATTGGCCCAAGCTGG + Intronic
1173035697 20:39407515-39407537 AAATAGTGGTTGCCAAAACCTGG + Intergenic
1174339277 20:49886023-49886045 AAGCAGTGGTTGTCAAACACTGG - Intronic
1174952437 20:55056925-55056947 TTTCAGTGGCTGACAAAAACTGG + Intergenic
1177053391 21:16267840-16267862 ATACAGTTGTAGGCACAAAAAGG + Intergenic
1178245462 21:30946939-30946961 AAACAGTAGTTGGCAAACACAGG + Intergenic
1178376160 21:32069097-32069119 CTACAGTTTATGGCAAAAACTGG - Intergenic
1179324605 21:40329313-40329335 ACACAATGGTTGCCAAAAAAAGG + Intronic
1180884685 22:19233200-19233222 ATCCAGTGTTTTGCAGAAACAGG - Exonic
1182966716 22:34528499-34528521 ATACAGTGCTTGGCACACACAGG - Intergenic
1183197280 22:36362125-36362147 AGTCAGTGGTTGGAAAATACTGG + Intronic
949119139 3:364496-364518 ATACAGTGCTTGGCCCAAAATGG + Intronic
949188980 3:1228437-1228459 ATAAAGTGGTTGCCAAAGGCAGG + Intronic
949196577 3:1316827-1316849 GGACAGTGGGTGGGAAAAACTGG - Intronic
952208908 3:31209450-31209472 ATTCATTGGTTGGTGAAAACTGG - Intergenic
957924987 3:86797534-86797556 ATAAACTGGTTAGCTAAAACAGG - Intergenic
960334764 3:116403011-116403033 ATACAGTGATTGGCCATATCTGG - Intronic
960467799 3:118018982-118019004 ATAAAGTGGCTGGCTTAAACAGG + Intergenic
960657027 3:120016067-120016089 ATGCAGCAATTGGCAAAAACTGG + Intronic
960951486 3:123001239-123001261 ATACAGTGGGTGGCAGCCACTGG + Intronic
962046014 3:131759672-131759694 ATAAAGTGGTTGACAAAGCCTGG - Intronic
964777291 3:160292358-160292380 AAACAGTGGTTTTCTAAAACAGG + Intronic
966539905 3:181077773-181077795 CAGCAGTGATTGGCAAAAACTGG + Intergenic
966790155 3:183660378-183660400 ATACTTTGGTAGGCTAAAACAGG - Intronic
969058580 4:4417100-4417122 ATACAGTGATGAGCAAAAACGGG - Intronic
969124369 4:4935552-4935574 ATGCAGTGGTGAGCAAAAGCAGG - Intergenic
970422149 4:15915298-15915320 AAACAGTGCTTGGCAGAAAGTGG + Intergenic
970488345 4:16546693-16546715 ACACAGTGGTGGGCAAAGAGAGG - Intronic
971605752 4:28654892-28654914 AGACAGTGGCTGGCAAAAGGGGG - Intergenic
973771321 4:54209700-54209722 AGACAGTGCTTGGCATATACTGG - Intronic
975835938 4:78422268-78422290 ATACAGTGGCAAGCAAAAAGAGG + Intronic
976094530 4:81494092-81494114 AGACAGTGGGTGGGAGAAACAGG + Intronic
977174872 4:93807799-93807821 ATACAGTGCTTGGCACATAGTGG - Intergenic
977402775 4:96554939-96554961 GCCCAGTGTTTGGCAAAAACAGG - Intergenic
978750456 4:112240489-112240511 ATTCAGTGGTATGGAAAAACAGG - Intronic
980334399 4:131451883-131451905 AAACACTGGTAGGCAAAAATGGG - Intergenic
980736262 4:136893273-136893295 ACACAGTGCCTGGCAAAAACTGG + Intergenic
981117038 4:141003786-141003808 ATAGAGTGCTGGGCAAAAATGGG - Intronic
982208589 4:153017172-153017194 ATACGGTGGTTGGTAAAAGAAGG - Intergenic
984331548 4:178327149-178327171 ATACAGTGCCTGGCACATACTGG - Intergenic
985382994 4:189414989-189415011 ATACAATGGTTGTGCAAAACAGG - Intergenic
986437682 5:7750460-7750482 ATACATTGTTTAACAAAAACAGG - Intronic
986641452 5:9875786-9875808 TTACAGTGATTGGCATAAACTGG + Intergenic
988983595 5:36595873-36595895 ATACAGTGTCCGGCCAAAACTGG - Intergenic
989241758 5:39210131-39210153 ATACAGGGGTTGTCACAATCAGG - Intronic
991101088 5:62793973-62793995 AAACAGTGGTTGGAAATCACTGG + Intergenic
993408652 5:87546396-87546418 ATACAGTGCATGGTAAAAATGGG + Intergenic
995042186 5:107601385-107601407 GTACAGTGGTGGGCAGAGACTGG - Intronic
999819839 5:155215778-155215800 AGACAGTAGTTGGAAACAACAGG - Intergenic
1002885505 6:1290199-1290221 TTACAGTGCTTGGCAAAGAGTGG - Intergenic
1004804302 6:19185252-19185274 AAAAAGTGGTTGGAAAAAAATGG + Intergenic
1009196271 6:60689432-60689454 ATAGATTGGTTGGCAGAGACTGG + Intergenic
1010816848 6:80368164-80368186 ATTCAGAGGCTGGGAAAAACTGG - Intergenic
1010837762 6:80611427-80611449 AGAAAGTAGTTGGCAAGAACTGG + Intergenic
1011063073 6:83293421-83293443 AGAAAGTGGTTGCCAAAAGCTGG - Intronic
1012479602 6:99651691-99651713 ATATAATGTTTGGAAAAAACAGG - Intergenic
1012739623 6:102999867-102999889 CTACAGTAGTAGTCAAAAACAGG - Intergenic
1014634284 6:123825520-123825542 ATACAGTAGTTGGCAAATGTGGG - Intronic
1015257119 6:131190964-131190986 ATACTGTGCTTGGCACATACAGG + Intronic
1015790714 6:136961789-136961811 CTACAGTGCTTGTTAAAAACTGG - Intergenic
1018248003 6:161840629-161840651 ATACACTGGAGGGGAAAAACAGG - Intronic
1018783553 6:167090746-167090768 ACACAGTGGATGGCGAAAATTGG - Intergenic
1022304210 7:29131262-29131284 ATACACCGGGTGGCAAATACAGG + Intronic
1023542136 7:41276944-41276966 ATGGAGAGGTTGGCAATAACCGG - Intergenic
1024281243 7:47721581-47721603 ATACAGTGGGAAGCAAAAACAGG - Intronic
1027949867 7:84801531-84801553 AAATAGTAATTGGCAAAAACAGG - Intergenic
1033037511 7:137888667-137888689 AGAGAGTGGTTGGCAATAAGAGG - Intronic
1033573651 7:142658639-142658661 ATACAGTGTGTGGCCAAAATGGG - Intergenic
1038059874 8:23900974-23900996 ATAAAGTGCTTGTCAAACACAGG - Intergenic
1038398932 8:27268325-27268347 TTAAAGTGGATGGGAAAAACAGG - Intergenic
1040355569 8:46614806-46614828 ATTCAGTGGTTGGCTAGAGCTGG + Intergenic
1040963618 8:53062125-53062147 AATCAGTGCTTGGTAAAAACAGG + Intergenic
1041655723 8:60348421-60348443 ATATAGTGGTTGCCAATACCTGG - Intergenic
1042381636 8:68121740-68121762 GAACAGTGGTTGGCAACATCTGG + Intronic
1045082699 8:98645497-98645519 ATACAGTGTTTAGCAAGAAAGGG - Intronic
1046250255 8:111622056-111622078 AAATAGTGGTTGCCAGAAACTGG - Intergenic
1046362919 8:113185560-113185582 AAACATTGGTTGTCTAAAACAGG - Intronic
1046511155 8:115204646-115204668 GTTCAGTGGTTAGCAAGAACAGG - Intergenic
1047716996 8:127604733-127604755 AAACATTGGTTGTCTAAAACGGG - Intergenic
1050080015 9:1905966-1905988 ATACAGTGTGTGGCAAATAAAGG - Intergenic
1051413601 9:16815788-16815810 AGTTAGTGGTTAGCAAAAACTGG + Intronic
1051672794 9:19529115-19529137 ATAAAGTGTTTGGCAATAATAGG - Intronic
1051751127 9:20341870-20341892 ATACATTTTTTGGCATAAACTGG - Exonic
1051857426 9:21584926-21584948 ATACAACGGTTGGAACAAACTGG - Intergenic
1052389585 9:27863485-27863507 CTACTGTTGTTGGCAAAAACGGG + Intergenic
1052886254 9:33651018-33651040 ATACAGTGTGTGGCCAAAATGGG - Intergenic
1052974908 9:34402994-34403016 AGACAGTGGGGGGCAAAAAGAGG + Intronic
1053188700 9:36041080-36041102 ATAAAGTGGTAAGCAAAAATAGG + Intronic
1055258017 9:74395780-74395802 ATGCAGTGATTGGCAACAATGGG - Intergenic
1055720855 9:79173122-79173144 ATTCAGTGTATGGCAGAAACTGG + Intergenic
1055988410 9:82078312-82078334 ATACAGGGGTAGGCACAAATTGG + Intergenic
1056480388 9:86997671-86997693 ATACTGGAGATGGCAAAAACTGG + Intergenic
1056547470 9:87624726-87624748 GTACAGTTGATGGCAAAAAATGG - Intronic
1056571436 9:87819970-87819992 AAACAGTGGTTGCCAGAGACTGG + Intergenic
1056667874 9:88596347-88596369 AGACAGTGGTAGGCAAAGAAAGG + Intergenic
1057761870 9:97881354-97881376 AGACAGTGGTAGGAATAAACTGG - Intergenic
1059658916 9:116382154-116382176 ATACTCTAGTTGGAAAAAACTGG + Intronic
1189510458 X:41656582-41656604 AAACATTGGTTGTCTAAAACAGG + Intronic
1189607466 X:42695193-42695215 ATAGAGTGGTTAGTAAAACCTGG + Intergenic
1193137094 X:77984240-77984262 ATACAGTGATGAGCAAAACCAGG - Intronic
1193407875 X:81124531-81124553 ATGGAGTGGTTGGGAAAAAAAGG - Intronic
1193769971 X:85576733-85576755 AAACATTGGTTGTCTAAAACAGG + Intergenic
1194031715 X:88825246-88825268 ATACAGAACTTGGCAAAATCAGG - Intergenic
1195619367 X:106937699-106937721 ATACAGTGGTTGGCAAAAACAGG + Intronic
1195664705 X:107418402-107418424 ATACATTGCATTGCAAAAACAGG + Intergenic
1195762285 X:108259540-108259562 AGACAGTTGGTGGCAAAAAGTGG - Intronic
1201392206 Y:13510919-13510941 ATATAGTGGTTGCCAAGGACTGG + Intergenic
1201753179 Y:17456856-17456878 ATATACTGATGGGCAAAAACTGG + Intergenic
1201848374 Y:18449127-18449149 ATATACTGATGGGCAAAAACTGG - Intergenic
1202335354 Y:23803224-23803246 ATATACTGATGGGCAAAAACTGG + Intergenic
1202535413 Y:25866835-25866857 ATATACTGATGGGCAAAAACTGG - Intergenic