ID: 1195619497

View in Genome Browser
Species Human (GRCh38)
Location X:106938856-106938878
Sequence GAAATTGCAAAGATGGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 429}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195619492_1195619497 21 Left 1195619492 X:106938812-106938834 CCAAAGGAAAGATGATGAGGGAA 0: 1
1: 0
2: 1
3: 33
4: 381
Right 1195619497 X:106938856-106938878 GAAATTGCAAAGATGGAGATGGG 0: 1
1: 0
2: 2
3: 30
4: 429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195619497 Original CRISPR GAAATTGCAAAGATGGAGAT GGG Intronic
901936766 1:12632026-12632048 GAAAAGGCAAAGGAGGAGATGGG - Intergenic
902459724 1:16564897-16564919 GAAATTGAAAAGAAGGGGAAGGG - Exonic
902543029 1:17167679-17167701 GAAAATGCAGAGAGGAAGATGGG + Intergenic
904525762 1:31132716-31132738 AAAATTGCAAAGATGCAGCCAGG + Intergenic
904818374 1:33222246-33222268 GCAATTGGATGGATGGAGATGGG - Intergenic
905113521 1:35616694-35616716 GAAATTGAAAAATTGGGGATTGG - Intronic
906786469 1:48620184-48620206 GACTTTGCAAAGATGGGGATGGG + Intronic
907039384 1:51244908-51244930 TAACTTGAGAAGATGGAGATGGG + Intronic
907228998 1:52977533-52977555 GAGATAGCAAAGTTGGAGCTGGG + Intronic
907903891 1:58766606-58766628 GACATTGCAGAGATGGAGTGAGG + Intergenic
909293786 1:73917971-73917993 AAAATTCCCAAGATGGAAATGGG + Intergenic
909325381 1:74345420-74345442 GAAATTACAAAGAAGCAGAGGGG + Intronic
909434662 1:75627052-75627074 GGACTTTAAAAGATGGAGATGGG - Intergenic
911163956 1:94708900-94708922 GAGTTTGCACAGATGGACATGGG - Intergenic
911232213 1:95373375-95373397 GAAATTACAAAAATGAAGGTGGG + Intergenic
911244032 1:95497031-95497053 GTACTTGCAAAAATGGAGCTGGG + Intergenic
912272006 1:108220933-108220955 GAAATTCCCAAGATGGAAAGGGG - Intergenic
913605868 1:120465262-120465284 GAAATTGAAAAGAAGGGGAAGGG + Intergenic
913643285 1:120832874-120832896 GAAATTGAAAAGAAGGGGAAGGG + Exonic
913643586 1:120835516-120835538 GAAATTGAAAAGAAGGGGAAGGG + Intronic
913644052 1:120839631-120839653 GAAATTGAAAAGAAGGGGAAGGG + Intronic
914082687 1:144423954-144423976 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914177591 1:145292468-145292490 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914178136 1:145297226-145297248 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914178681 1:145301988-145302010 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914179057 1:145305157-145305179 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914179435 1:145308340-145308362 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914179979 1:145313096-145313118 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914180524 1:145317868-145317890 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914181067 1:145322630-145322652 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914181610 1:145327378-145327400 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914182155 1:145332145-145332167 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914182700 1:145336901-145336923 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914183245 1:145341651-145341673 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914183789 1:145346409-145346431 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914184333 1:145351181-145351203 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914184877 1:145355943-145355965 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914185422 1:145360690-145360712 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914185968 1:145365444-145365466 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914186514 1:145370204-145370226 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914187058 1:145374952-145374974 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914187601 1:145379704-145379726 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914188146 1:145384458-145384480 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914188689 1:145389208-145389230 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914210559 1:145574911-145574933 GAAATTGAAAAGAAGGGGAAGGG - Intergenic
914269489 1:146067267-146067289 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914269844 1:146070411-146070433 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914270384 1:146075133-146075155 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914270921 1:146079869-146079891 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914271459 1:146084605-146084627 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914271994 1:146089326-146089348 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914272530 1:146094044-146094066 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914273068 1:146098766-146098788 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914273607 1:146103488-146103510 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914274145 1:146108206-146108228 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914274683 1:146112916-146112938 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914275216 1:146117634-146117656 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914275753 1:146122370-146122392 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914367074 1:146988840-146988862 GAAATTGAAAAGAAGGGGAAGGG + Exonic
914367610 1:146993598-146993620 GAAATTGAAAAGAAGGGGAAGGG + Exonic
914485373 1:148104624-148104646 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914532322 1:148533948-148533970 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914532682 1:148537098-148537120 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914533217 1:148541818-148541840 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914533752 1:148546532-148546554 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914534288 1:148551240-148551262 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914534824 1:148555954-148555976 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914535359 1:148560671-148560693 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914535896 1:148565407-148565429 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914536431 1:148570129-148570151 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914536790 1:148573317-148573339 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914585336 1:149056599-149056621 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914585699 1:149059787-149059809 GAAATTGAAAAGAAGGGGAAGGG - Exonic
914629129 1:149492025-149492047 GAAATTGAAAAGAAGGGGAAGGG + Intergenic
914629662 1:149496788-149496810 GAAATTGAAAAGAAGGGGAAGGG + Intergenic
914630197 1:149501543-149501565 GAAATTGAAAAGAAGGGGAAGGG + Intergenic
914630731 1:149506304-149506326 GAAATTGAAAAGAAGGGGAAGGG + Intergenic
914631262 1:149511065-149511087 GAAATTGAAAAGAAGGGGAAGGG + Intergenic
914631794 1:149515821-149515843 GAAATTGAAAAGAAGGGGAAGGG + Intergenic
914632331 1:149520574-149520596 GAAATTGAAAAGAAGGGGAAGGG + Intergenic
914632866 1:149525331-149525353 GAAATTGAAAAGAAGGGGAAGGG + Intergenic
914633401 1:149530060-149530082 GAAATTGAAAAGAAGGGGAAGGG + Intergenic
914633937 1:149534811-149534833 GAAATTGAAAAGAAGGGGAAGGG + Intergenic
914634472 1:149539562-149539584 GAAATTGAAAAGAAGGGGAAGGG + Intergenic
914635005 1:149544299-149544321 GAAATTGAAAAGAAGGGGAAGGG + Intergenic
914635540 1:149549036-149549058 GAAATTGAAAAGAAGGGGAAGGG + Intergenic
914636075 1:149553773-149553795 GAAATTGAAAAGAAGGGGAAGGG + Intergenic
915151983 1:153840823-153840845 AATATTTCAAAGATGGAGATAGG + Intronic
915700429 1:157787667-157787689 GAAAGTGAAAAGATGAAGAAAGG + Intergenic
915859288 1:159425598-159425620 AAAATTGCAAAGAAAGAGATAGG + Intergenic
916738482 1:167628983-167629005 GAAAGTGCAAAGATGGTGCCGGG + Intergenic
917259475 1:173151155-173151177 GAAAATGTAATCATGGAGATGGG - Intergenic
918043335 1:180926526-180926548 GAAATAGCAAAGCTGGAAAATGG + Intronic
918847743 1:189640374-189640396 GAAATAGCACAGATGGTGACAGG + Intergenic
918966949 1:191363098-191363120 GAAATTGCAAGTATTGAAATTGG + Intergenic
920231780 1:204475492-204475514 GAATTTTCAGACATGGAGATGGG + Intronic
921620630 1:217322476-217322498 GAAAATGAAAAGATGGAAAATGG + Intergenic
921650521 1:217672915-217672937 GAAGATACAAAGATGAAGATAGG - Intronic
922076351 1:222248479-222248501 GATATTCCAAATATGAAGATAGG + Intergenic
922500005 1:226090007-226090029 GAATTTGGATAGATGGACATGGG + Intergenic
923185766 1:231571684-231571706 TAAATATCAGAGATGGAGATAGG + Intronic
923492698 1:234498536-234498558 TACATTTCAAAGGTGGAGATAGG + Intergenic
1064606434 10:17045686-17045708 GAAATTGCATTAATGGAAATTGG - Intronic
1065239535 10:23692227-23692249 GAAACTGAAAAGATGGAAAGGGG - Intergenic
1065382842 10:25107254-25107276 CAAATTGAAAAGCTTGAGATAGG - Intergenic
1065940607 10:30561023-30561045 AAAATTGCAGTGAAGGAGATGGG - Intergenic
1066307804 10:34163384-34163406 GAATTTGAAAAGATGAAGAAAGG + Intronic
1068378907 10:56222045-56222067 GAATGTGCAAAGATTGAGTTAGG - Intergenic
1070557410 10:77539303-77539325 GATAATGCAGAGATGGAGATGGG + Intronic
1071282596 10:84116059-84116081 GAAATTGGAAAGATGATGAATGG + Intergenic
1071513436 10:86281753-86281775 GAAATTGCATTTCTGGAGATGGG - Intronic
1073425997 10:103455912-103455934 GAAATTGAAATAATGGAGATAGG + Intronic
1073634116 10:105179782-105179804 GCAATGGCAAAGATTGAAATAGG + Intronic
1073954098 10:108847969-108847991 GAAAGTGAAAAGATGGAGGGAGG + Intergenic
1075641687 10:124069388-124069410 GATATGGCACAGATGGAAATGGG + Intronic
1075891099 10:125951728-125951750 GAAATTGAAAGAATGAAGATTGG - Intronic
1075927196 10:126261416-126261438 GACATGGCAAAGATTGGGATAGG + Intronic
1075993849 10:126860546-126860568 GAAACTGGAAATATGGAGTTGGG - Intergenic
1078033134 11:7773804-7773826 CAATTCACAAAGATGGAGATTGG - Intergenic
1079034318 11:17009041-17009063 GAAAAAGCAAAGATGGAGTCTGG + Intronic
1079303257 11:19298278-19298300 GACCCTGCAAAGCTGGAGATGGG + Intergenic
1080057703 11:27924655-27924677 GTAATTCCCAAGCTGGAGATGGG - Intergenic
1081130635 11:39375095-39375117 TAAATTACATAGATGGTGATTGG - Intergenic
1082721794 11:56686842-56686864 AAAATAGCAAAGTTGGAGACTGG + Intergenic
1083481957 11:62954731-62954753 GATATTTCAAAGTTGGAGGTGGG + Intronic
1086011756 11:82112921-82112943 GAAATTGCATATATGAAGAATGG + Intergenic
1086744468 11:90407770-90407792 GGAATTGCAAAGATGGAAAGGGG + Intergenic
1086973093 11:93104634-93104656 GAAATTGGAAAGATGATGAATGG - Intergenic
1088090509 11:106033483-106033505 GATATTCCAAAGATTAAGATGGG + Intergenic
1088253106 11:107878694-107878716 TCAATTGCAAAAATGAAGATAGG - Intronic
1089908787 11:122074453-122074475 AAACTTGGACAGATGGAGATGGG - Intergenic
1090885808 11:130875560-130875582 GAAATTTCCAAAATGGAAATTGG + Exonic
1091814135 12:3423483-3423505 GAAATTGGAAAGATGAAAAATGG - Intronic
1092206400 12:6616822-6616844 GAAAATCCAAAGATAGAGAAGGG - Intergenic
1092583089 12:9868581-9868603 GAAATCTCAAAGATGTAGCTTGG + Intronic
1092915898 12:13188721-13188743 GAAATTGCAGATATGAGGATTGG - Intergenic
1093125554 12:15323349-15323371 GGAATTGTAAAGATGTTGATAGG - Intronic
1093593732 12:20938146-20938168 GAAATTGGAAAGATGATGAATGG - Intergenic
1093904758 12:24677418-24677440 GAGATTCTAGAGATGGAGATGGG - Intergenic
1093915361 12:24796353-24796375 GATACTGTAATGATGGAGATAGG + Intergenic
1094090957 12:26648838-26648860 GAATCTCCAAATATGGAGATAGG - Intronic
1095308869 12:40671267-40671289 GATATTGCAAAGACTGAGAAAGG + Intergenic
1096316589 12:50572634-50572656 GATATGGCAAAGGTGGAGAATGG - Intronic
1096952880 12:55493373-55493395 GAAATTACAAAGTTGGTTATTGG - Intergenic
1097405854 12:59189022-59189044 TAAGTTGCAGAGATGTAGATAGG + Intergenic
1097691707 12:62740109-62740131 GACATTTCAAAGGTGGAGTTCGG - Intronic
1098603846 12:72365976-72365998 GAAGATGCAAAGATGGAGAAAGG - Intronic
1098749013 12:74271923-74271945 GAAATTGGAAAGATGATGAATGG + Intergenic
1099138714 12:78942431-78942453 AGAATTGGAAAGATGGAGAGAGG - Intronic
1099199291 12:79656908-79656930 TGAATTGAAAAGATGGAAATGGG + Intronic
1099679748 12:85810666-85810688 AAATTTTCAAAGATTGAGATGGG - Intronic
1100451516 12:94711412-94711434 GATATGGCCAAGGTGGAGATGGG + Intergenic
1100564703 12:95784167-95784189 CAATTTTCAAAGATGGAAATTGG + Intronic
1100922790 12:99507912-99507934 AAAATTGGAAAGATGAACATGGG - Intronic
1100938888 12:99703004-99703026 TAAATTGCAAAAATGGTGCTGGG - Intronic
1101474517 12:105031906-105031928 GAAATTAAAAAGATGAAAATTGG - Exonic
1101634659 12:106528593-106528615 AGAAATGCAAAGATGGAGGTGGG + Intronic
1103499567 12:121390692-121390714 CAAATGTCAAAGTTGGAGATAGG + Intronic
1104293300 12:127488456-127488478 GAAATTGGAAAGATGATGAGTGG + Intergenic
1104925356 12:132311228-132311250 GACATTTCAAAGAGGGAGAAAGG + Intronic
1106663631 13:31828223-31828245 GAAAATGAAAGGATGGGGATTGG + Intergenic
1106998561 13:35517602-35517624 GATCTGCCAAAGATGGAGATGGG - Intronic
1107242173 13:38249487-38249509 GTAATTGCAAAGTGGGAGATTGG - Intergenic
1107767079 13:43747460-43747482 AAACTTGCAAAGTTGGAGGTGGG - Intronic
1108671298 13:52691853-52691875 AAAAATGCACAGATGGAGAAAGG - Intronic
1109803360 13:67404786-67404808 GAAATTGGAAAGATGATGAATGG + Intergenic
1110527894 13:76560765-76560787 TAAAATGCAAATATGGAGAGAGG - Intergenic
1112635339 13:101211259-101211281 GAAATTGCAAATAAGATGATTGG + Intronic
1114064054 14:19045326-19045348 AAAATTGCAAGGACGAAGATGGG - Intergenic
1114098205 14:19354670-19354692 AAAATTGCAAGGACGAAGATGGG + Intergenic
1114496754 14:23138112-23138134 GAATTAGCAAGGGTGGAGATAGG - Intronic
1115981625 14:39057735-39057757 GAAATTTTAAAGTTGGATATAGG - Intronic
1117571625 14:57054781-57054803 GAAATTGAGAAGATGGAGAGAGG + Intergenic
1118656488 14:67955856-67955878 GAATTTGGACAGATGAAGATGGG + Intronic
1119031393 14:71195649-71195671 GGACTTCCAAAGATGGAGATGGG - Intergenic
1119975646 14:79020896-79020918 GAATTGGCAAAGATGTAGAGTGG - Intronic
1121181931 14:91935506-91935528 GAAAATGCAGAGATAGAGGTGGG - Intronic
1123613550 15:22122345-22122367 GATAATTCAAAGATGGAAATGGG + Intergenic
1126119773 15:45241318-45241340 TAAATTGCAGAAATGGAGAGGGG + Intergenic
1126351353 15:47748020-47748042 GAAATTTCAGTGGTGGAGATGGG + Intronic
1128157039 15:65397743-65397765 TAAATTGCAATGCTGGAGAAAGG + Intronic
1128957730 15:71966207-71966229 GAAAGTAAAAAGATGGAGAAAGG - Intronic
1133754043 16:8748866-8748888 GAAAGTAAAAAGATGGAGAAAGG - Intronic
1135318766 16:21475976-21475998 GAATTTGCAAAGTTGAAAATAGG - Intergenic
1135371658 16:21907769-21907791 GAATTTGCAAAGTTGAAAATAGG - Intergenic
1135440129 16:22462935-22462957 GAATTTGCAAAGTTGAAAATAGG + Intergenic
1135905688 16:26509781-26509803 GAAAGTGGAAGGATGGAGAAAGG + Intergenic
1139031343 16:62885099-62885121 GATATTGCAAAAATGGAGACTGG + Intergenic
1140188587 16:72795746-72795768 GAGAGGGCAAAGATGGAGAGCGG - Exonic
1140554449 16:75905529-75905551 GAAATCACAAAGGTGGAGAAGGG - Intergenic
1143884512 17:10055884-10055906 GAGATTCTAAAAATGGAGATTGG - Intronic
1144213411 17:13034157-13034179 GAAACAGAGAAGATGGAGATGGG - Intergenic
1144430352 17:15185577-15185599 GACCTTGCAAAGAAGGGGATGGG - Intergenic
1146764532 17:35507239-35507261 GAAATTGGAAAGATGATGAATGG + Intronic
1148011584 17:44486235-44486257 GAAATGGAAAAAATGGAGAAAGG - Intronic
1148935503 17:51161756-51161778 GAGAGTGCAGAGAAGGAGATCGG + Exonic
1149725193 17:58886018-58886040 GAAATTACAAAGGGGGACATTGG - Intronic
1154297629 18:13164412-13164434 GCAATTGCTGAGATGGAGCTAGG + Intergenic
1155440187 18:25854285-25854307 GAAATTGCAAATATGGAGGTAGG - Intergenic
1155745719 18:29354998-29355020 GAAATTGGTAACATGGAGAGTGG + Intergenic
1156677310 18:39543561-39543583 GAATTTGTGAAGATGAAGATAGG + Intergenic
1156917266 18:42476462-42476484 GAAAATGTAAGGATGAAGATGGG + Intergenic
1157549265 18:48570000-48570022 GAAATTGCTAACATGAAGTTCGG - Intronic
1158249102 18:55466949-55466971 GAAGTGGGAAAGATGGAAATGGG - Intronic
1158292462 18:55956853-55956875 GAAATTGGAAAGATGATGAATGG + Intergenic
1159107587 18:64020963-64020985 TATATTGGAAAGATTGAGATGGG - Intergenic
1159802697 18:72920507-72920529 GAAATTGGCATGAAGGAGATAGG - Intergenic
1160613422 18:80106965-80106987 AAAATTGGAAAACTGGAGATGGG + Intergenic
1163222090 19:15929113-15929135 GGAATTGGCAAGAAGGAGATGGG - Intronic
1164481457 19:28614157-28614179 GAAATTGGAAAGATGATGAGTGG + Intergenic
1164556692 19:29258531-29258553 GAACCTGCAAAGATGGAAATGGG - Intergenic
1165053730 19:33160383-33160405 GAAAATGAAAGGGTGGAGATGGG - Intronic
1166200240 19:41232724-41232746 GAGATTAGAAAGTTGGAGATGGG + Intronic
1202675968 1_KI270711v1_random:7081-7103 GAAATTGAAAAGAAGGGGAAGGG - Intergenic
925043450 2:752098-752120 GAACGTGCAAAAATGGAGGTTGG + Intergenic
925072609 2:983064-983086 GAAGTTGCAGAGGTGGAGGTTGG + Intronic
925072633 2:983245-983267 GAAGTTGCAGAGGTGGAGGTTGG + Intronic
925072649 2:983351-983373 GAAGTTGCAGAGGTGGAGGTCGG + Intronic
925800926 2:7599591-7599613 GAGACTGCAAAGATGGCGGTGGG + Intergenic
926879890 2:17533207-17533229 GAAATTGCAGGGATGGAACTTGG - Intergenic
927427336 2:22995752-22995774 GAAGTTTAAAACATGGAGATAGG - Intergenic
927877687 2:26669793-26669815 GAAACTGCAAACATGGGGTTGGG + Intergenic
928150800 2:28826910-28826932 AAAATAGCAAAGATGGGGATGGG - Intronic
928190219 2:29158503-29158525 GACCTTTCAAAGAGGGAGATGGG + Intronic
928867424 2:35933842-35933864 GTAATAGCAAAGATGGAGGATGG - Intergenic
929217679 2:39433353-39433375 GAGATAGTAAAGCTGGAGATGGG - Intronic
929222493 2:39478744-39478766 GAGATTTCAAAGATGGAAACAGG + Intergenic
929494051 2:42424051-42424073 GGATTTGCAAAGCTGGAGGTGGG - Intronic
930243809 2:48963040-48963062 GAAATGGCAAAGAAAGAAATGGG + Exonic
930576828 2:53160830-53160852 GAAAATGCAAAGTTGCAGAAGGG - Intergenic
930696221 2:54414486-54414508 GGAATTGTAAAGAAAGAGATAGG + Intergenic
931451470 2:62370693-62370715 GAAATTCCCAAGCTGGAGAATGG - Intergenic
931718454 2:65048202-65048224 TCAATTGCTCAGATGGAGATGGG - Intergenic
932229769 2:70073610-70073632 GAAAAAGGAAAGGTGGAGATGGG + Intergenic
932663710 2:73679479-73679501 TAAGTTGCCAAGAGGGAGATTGG - Intergenic
933561450 2:83891078-83891100 TAAATAGCAAAAATGGAAATAGG - Intergenic
934020100 2:87940438-87940460 GAAATTGAAAATATAAAGATAGG + Intergenic
934120950 2:88838914-88838936 TAAATTACAAAGAAGGAGACTGG - Intergenic
935119210 2:100166639-100166661 GAAATTGCAAAGAAGGAAAAAGG - Intergenic
936286221 2:111183396-111183418 GGAATGGCAAAGGTGGAGTTGGG - Intergenic
938481313 2:131664310-131664332 AAAATTGCAAGGACGAAGATGGG - Intergenic
938622854 2:133074887-133074909 GAAAATGAAAAGAAAGAGATTGG + Intronic
938648788 2:133358630-133358652 AACATTGAAATGATGGAGATGGG - Intronic
938696266 2:133837912-133837934 GAAATGACAAGGAGGGAGATAGG + Intergenic
939290453 2:140187737-140187759 AAAATTGCAATTATGGAAATAGG + Intergenic
939320841 2:140619427-140619449 GAAATGGCCAAGATGGATAATGG + Intronic
939878818 2:147606976-147606998 GAAATTGCATAGAGGGAGGAGGG - Intergenic
940076239 2:149745301-149745323 GAAACAGAAAAGATGGAGGTTGG - Intergenic
940446613 2:153785110-153785132 GAAACAGCAAAGATGGAGCTTGG - Intergenic
940523122 2:154777066-154777088 TAAATTGGAAAGATGCAGTTGGG + Intronic
940549633 2:155137428-155137450 GAAAATGCCTAGATAGAGATAGG - Intergenic
940943575 2:159590728-159590750 CTAATTGCAAAGATGGGGGTGGG + Intronic
941401477 2:165036155-165036177 GAACTTGGAAAGATGATGATGGG + Intergenic
941555685 2:166977705-166977727 GTAATCACAAAGATGGAGAGGGG + Intronic
941838087 2:170048221-170048243 AAAATTGCAAAGAGGGACAGGGG - Intronic
942308510 2:174632321-174632343 GAAAGTGGAAAGATGGGGAAGGG + Intronic
943334211 2:186594087-186594109 GATATTGCAAACATGAAGTTAGG - Intronic
943470628 2:188290874-188290896 GAAAGCGTAAAGATGGAGTTTGG + Intergenic
943907510 2:193518284-193518306 CAAACTGCAAAGAAGGAGAGGGG - Intergenic
943990429 2:194682870-194682892 GAAAAGGTAAAGATGGAGAAAGG + Intergenic
945295244 2:208163896-208163918 GAAACTGCTGAGATGGAGGTTGG + Intergenic
947544822 2:231003205-231003227 GAAGTTGGGAAGATGGAGAAAGG - Intronic
948090638 2:235291829-235291851 GAAATTATAAATAAGGAGATTGG + Intergenic
948323726 2:237093831-237093853 AAAATTACAAAGATGGAAAAAGG - Intronic
1169086983 20:2832788-2832810 GAAATTAAAAATATGGAGGTAGG + Intergenic
1169397949 20:5251991-5252013 CAAATTGCAAAGAAAGTGATTGG - Intergenic
1169651601 20:7874378-7874400 GCACTGGCAAAGAGGGAGATTGG - Intergenic
1175121946 20:56722513-56722535 GAGGTTGCAAGGATGGAGATGGG + Intergenic
1177882954 21:26715973-26715995 GAAATTGCAGAGATGAAGGAGGG + Intergenic
1178052338 21:28761862-28761884 CAAATTGAAAAGACGAAGATTGG + Intergenic
1178448087 21:32663635-32663657 GAAATTGGAAAGATGATGAATGG + Intronic
1179282339 21:39944707-39944729 GAAGTTGAACAGGTGGAGATAGG + Intergenic
1180482546 22:15767960-15767982 AAAATTGCAAGGACGAAGATGGG - Intergenic
1184353339 22:43960221-43960243 AAAATTGAAAGGATAGAGATGGG + Intronic
950310531 3:11953990-11954012 GAACTTGCAGAGATGGATGTAGG + Intergenic
952505326 3:34002065-34002087 GAAATTTCCAAGATGGAGAATGG - Intergenic
952662589 3:35869590-35869612 GAAATGGAGAAGATGGAGATGGG + Intergenic
952735650 3:36689352-36689374 GTGTTTGCAAAGATGTAGATAGG - Intergenic
954073931 3:48162977-48162999 GAAATTTCAAATTTTGAGATGGG - Intronic
954505464 3:51067537-51067559 GAAATAGGAAAGAGGGAGAAGGG - Intronic
954578167 3:51688233-51688255 GAAATTGCAAACCTGCAGAGGGG + Intronic
954870060 3:53761075-53761097 GAAGTTGAACAGATGGAGTTGGG + Intronic
955021309 3:55124294-55124316 GAAATTGCAAACATAAAGATTGG - Intergenic
955434501 3:58888072-58888094 GACATAGAAAAGATGGTGATTGG - Intronic
956343108 3:68248652-68248674 GGAATGGCAAACCTGGAGATGGG + Intronic
956856998 3:73284970-73284992 GAAATGGCAAAGATGAAGGGAGG + Intergenic
957550266 3:81695146-81695168 GAAATTGAGAAGAGGGAGCTTGG - Intronic
958559050 3:95719860-95719882 AAACTTGCAAAGATTGATATTGG - Intergenic
959403587 3:105933149-105933171 CAAATTGCAAAGATGAATAGGGG - Intergenic
959785177 3:110288330-110288352 GAAATTAAAAAGATGGGGCTGGG - Intergenic
959836951 3:110930048-110930070 GAAAGTGTCAAGAGGGAGATTGG - Intergenic
960376544 3:116909012-116909034 AAAATGGAAAAGATGGAAATGGG - Intronic
963013117 3:140794074-140794096 CAAATTATAAAGATGGAGAACGG + Intergenic
963300204 3:143588884-143588906 GAAATTGAAAAGTTGGAGAAAGG - Intronic
964141963 3:153413316-153413338 CAAATTGCAAAGCTAGAGAGTGG - Intergenic
964380745 3:156096791-156096813 GAAATTAAGAAGATGGAGACAGG + Intronic
964696997 3:159520170-159520192 GAGAATGCAAAGACGGAGGTAGG + Intronic
965441201 3:168717182-168717204 GAAATTGGGAAGATTGAGAGTGG + Intergenic
965532374 3:169785592-169785614 AAGAGTTCAAAGATGGAGATGGG + Intronic
965982136 3:174705990-174706012 GAAATTATAAAAGTGGAGATGGG - Intronic
966128534 3:176608459-176608481 AAAATTCCCAAGATGGAGCTAGG + Intergenic
966617048 3:181924900-181924922 TAAATTTCAAAAATGGAGATAGG - Intergenic
967875794 3:194267761-194267783 GAAAGTGCAAACATGGGGAAAGG - Intergenic
968971924 4:3800337-3800359 GAAATGGGAAAGATGGATGTAGG + Intergenic
970118272 4:12723625-12723647 GAAAATGCAGAGAATGAGATGGG - Intergenic
970398878 4:15699040-15699062 GAAATTTCAGAGATGAAGTTGGG - Intronic
972064870 4:34928964-34928986 GAAATGAAAAAGATGGATATAGG + Intergenic
972817375 4:42658344-42658366 GAAATACCACAAATGGAGATAGG - Intergenic
974087142 4:57273463-57273485 GCAGATGCCAAGATGGAGATTGG + Intergenic
976457268 4:85262662-85262684 GAAATAGCAAAGATAAGGATAGG - Intergenic
977043190 4:92039544-92039566 GAAATTGGAAAGATGATGAATGG - Intergenic
977923474 4:102671780-102671802 GAAATTGCATAAAAGGAGATAGG - Intronic
977924357 4:102683117-102683139 CAATTTGCAAAGATGAAGACAGG + Intronic
977972752 4:103230336-103230358 GAAATTGGAAAGATGATGAATGG + Intergenic
978188852 4:105890279-105890301 GAAAATGAAAAGGAGGAGATAGG - Intronic
978382272 4:108141858-108141880 GAACATGCAAAGATGGGGGTGGG + Intronic
978466081 4:109011329-109011351 GAAATTGCAAGCCTGGAGAGAGG - Intronic
979040794 4:115791051-115791073 GAAAATGCAAGGATGGAAAAAGG - Intergenic
979045833 4:115862087-115862109 GAATTTTAAAAGATGGAGAAAGG + Intergenic
979898043 4:126185877-126185899 TAAATCTCAAAGATGGATATTGG - Intergenic
979911536 4:126373024-126373046 AGAATAGCAAAGATAGAGATAGG + Intergenic
980499573 4:133630946-133630968 GAAAAGGCAAAGATGTAGACTGG + Intergenic
980851206 4:138384288-138384310 GAGATTGTAAAGATGGATGTTGG - Intergenic
982547277 4:156749546-156749568 GAAAGTGCAAAGGTGGAGTCAGG + Intergenic
984276318 4:177615122-177615144 TAAATTGTAATGATGGAGAAAGG - Intergenic
984339532 4:178438218-178438240 GAAAGAGTAATGATGGAGATGGG - Intergenic
985301821 4:188498231-188498253 GACATTCGAAAGATGGATATGGG + Intergenic
985724278 5:1507561-1507583 GGAAATGCAGAGATGAAGATGGG + Intronic
986858286 5:11897926-11897948 GAAAGTGAAAAGCTGGAGAGAGG - Intronic
987681860 5:21146090-21146112 GAAATTGCATATATGGTGGTGGG + Intergenic
988477121 5:31596574-31596596 GTAATTGCAAAGCAGGGGATTGG + Intergenic
989095672 5:37779180-37779202 GAAATTGGAAAGATGATGAATGG - Intergenic
989115003 5:37943887-37943909 GAAAGTGCAAAGCTGGTGAAGGG + Intergenic
989127168 5:38066442-38066464 GAAATTGAAATAATTGAGATGGG + Intergenic
992282983 5:75201190-75201212 TAAATTGCAAAGATGAAGCGAGG - Intronic
992371761 5:76151167-76151189 GGACTTGCAGAGATGGAGCTGGG + Intronic
992415973 5:76551837-76551859 GACCTTGCAAAGAGGGAGACGGG + Intronic
993308536 5:86299077-86299099 GAAATTCCCAAGATGGAAAGGGG + Intergenic
993482187 5:88437780-88437802 GAAATTGCAGTGGTGGTGATGGG + Intergenic
993622371 5:90183828-90183850 GAAAATGTAGAGATGTAGATTGG - Intergenic
994084715 5:95745105-95745127 AAAATTAAAAAAATGGAGATGGG + Intronic
994876437 5:105428551-105428573 TAAATTATAAAGATGGACATGGG + Intergenic
995474197 5:112531521-112531543 GAAATTGGAAAGATGATGAATGG + Intergenic
996008197 5:118449370-118449392 GAAAGAGCAAAGATGTAGACAGG - Intergenic
996152143 5:120052225-120052247 GAACTGGCAAAGATGAAGAACGG - Intergenic
996805636 5:127451161-127451183 GAAATTTCAAAGAAGGAAAGGGG + Intronic
1000825000 5:166034006-166034028 TAAATTGCAAATATGGTAATAGG - Intergenic
1000993408 5:167934595-167934617 GAAATTGGAACGAGGGAGTTTGG + Intronic
1001140645 5:169140946-169140968 GAAGATGACAAGATGGAGATTGG - Intronic
1001330761 5:170760765-170760787 GAAAATGCACAGATGGACCTAGG - Intergenic
1002174431 5:177393596-177393618 GAGATGGGGAAGATGGAGATGGG - Intronic
1003031584 6:2605801-2605823 GAATGTGGAAAGATGGATATGGG - Intergenic
1003343857 6:5246913-5246935 GAAAGTGCAAAGAGGGAAATGGG + Intronic
1004025610 6:11815341-11815363 GAAAATGCCAAGCTGGAGCTGGG + Intergenic
1005179532 6:23088915-23088937 GAAAGAGCATATATGGAGATGGG - Intergenic
1005897274 6:30189010-30189032 GAAAGTGCAAAGAGGGAGGGGGG + Intronic
1006060791 6:31417239-31417261 GAAATTGAGAAGATGCAGAGAGG - Intergenic
1006370895 6:33643055-33643077 GAAAAGACAAAGATGGAGCTTGG + Intronic
1007341767 6:41195111-41195133 GAAAGTGAAAAGAGAGAGATGGG - Intronic
1007817092 6:44532100-44532122 GAAATCACAAAGATAGAAATGGG - Intergenic
1008758774 6:54828715-54828737 GTAATTCCAATGTTGGAGATGGG - Intergenic
1009706077 6:67253518-67253540 GAAATTGTACATATGGCGATTGG + Intergenic
1011538447 6:88403818-88403840 GAAATTAAACAGATGGAGAAGGG - Intergenic
1012810891 6:103956719-103956741 GAAATTGCTAGGCTAGAGATAGG - Intergenic
1013065642 6:106682501-106682523 AAAATTGTAAAGATGGAGTCTGG + Intergenic
1013491946 6:110656034-110656056 GAAATTGGTAAGATGAAGAGAGG - Intronic
1013796969 6:113899056-113899078 GAAATTGCCAAGATGAAGGCAGG - Intergenic
1013929479 6:115514024-115514046 GAAATTGAGAAGATTGAGACTGG - Intergenic
1014361437 6:120480516-120480538 AAAATTCCAAAGATAGAGAGAGG - Intergenic
1014546522 6:122742619-122742641 GAAATTGGAAAGATGATGAATGG - Intergenic
1014574374 6:123052357-123052379 GCAAGTGCATAGAAGGAGATGGG + Intronic
1015526619 6:134180313-134180335 AACATTGCCAAGATGGAGATGGG - Intronic
1017296861 6:152807587-152807609 GAATATGAAAAGATGCAGATGGG + Intergenic
1017798089 6:157865597-157865619 GAAATTTCAGACATGGAGAAAGG + Intronic
1018594559 6:165464355-165464377 GTAATTACAAATATGGAAATAGG - Intronic
1018735529 6:166684855-166684877 TAAATTGGAAAGAAGGAGAAAGG - Intronic
1020572455 7:9883150-9883172 GAAAATGCGGAGATGGAGATTGG + Intergenic
1020775124 7:12443404-12443426 AAAATGACAAAAATGGAGATGGG - Intergenic
1021150114 7:17140341-17140363 TAAATTGAAAAAATGCAGATGGG + Intergenic
1021384759 7:20015686-20015708 GAAATGGCACAGCAGGAGATGGG - Intergenic
1026958159 7:74391174-74391196 CAAATTGCAAAGATGGAACATGG - Intronic
1028286484 7:89009353-89009375 GAAATTGAGAAGATTGAGAGTGG - Intronic
1028514923 7:91667313-91667335 GAAATTTGAAAGTGGGAGATAGG - Intergenic
1028989243 7:97032513-97032535 ACAATTGCAAGGATGGTGATGGG - Intergenic
1031338158 7:120563760-120563782 GAAGTTGGCAAGATGGGGATAGG - Intronic
1033949539 7:146766801-146766823 CAAATTGGAAGGATTGAGATGGG + Intronic
1035327243 7:158073096-158073118 GAGAGTGCAAAGATGGTGCTGGG - Intronic
1035356839 7:158280823-158280845 GAAATGACAAAGATGGAAAGCGG + Intronic
1036063232 8:5349332-5349354 AAAATTGCAATGAGGAAGATTGG + Intergenic
1036462140 8:8962810-8962832 GAAACTGTAATGATGGAGAGAGG + Intergenic
1036738018 8:11336530-11336552 GAAATTGTAAAGAACAAGATTGG - Intergenic
1037012484 8:13860736-13860758 GAAATCATAAAGATGAAGATAGG + Intergenic
1037216895 8:16465164-16465186 GAAATTACTAAGATGGAGTAGGG + Intronic
1037375166 8:18219227-18219249 GAAACTACAACTATGGAGATGGG - Intronic
1037801683 8:22039430-22039452 TAAATTGCAAAGGTGGAGGCCGG + Intergenic
1039098406 8:33912823-33912845 GAAGGTGAGAAGATGGAGATGGG - Intergenic
1039635865 8:39164181-39164203 GAAATCACAAAGAAGGAGAATGG - Intronic
1040725840 8:50380011-50380033 GAAATTGGAGGGATGGAGAGTGG + Intronic
1041540773 8:58982389-58982411 AAGAATGAAAAGATGGAGATAGG - Intronic
1042587677 8:70359941-70359963 GAAATATCAAAGATGGAACTGGG - Intronic
1044844823 8:96370576-96370598 GCAAGAGCAAAGATGGAGAATGG - Intergenic
1045048716 8:98303346-98303368 GAATTTGGATAGATGGAGGTGGG + Intergenic
1046120133 8:109835859-109835881 GTAATGAGAAAGATGGAGATAGG - Intergenic
1046155489 8:110284331-110284353 GAAATTATAAAGATGGGGCTGGG - Intergenic
1046171887 8:110519827-110519849 GAAATTGAAGAGATGGAAAAAGG + Intergenic
1046312654 8:112458783-112458805 GAAACTGCAAAGCTGGTGATTGG + Intronic
1046890191 8:119414396-119414418 GAAATTGGCAACATGGAGATTGG - Intergenic
1047306960 8:123660197-123660219 GAGATTGCAAGGAGGGAGGTTGG - Intergenic
1047759458 8:127943439-127943461 GAAATTGCAAAGACATAGGTAGG + Intergenic
1049939814 9:534902-534924 GTAATTCCATGGATGGAGATGGG + Intronic
1050897088 9:10897530-10897552 GAAAATGCAAAAATTGAGAAAGG + Intergenic
1051673173 9:19532799-19532821 GAAATTGCAAACATCTAGCTGGG + Intronic
1051960188 9:22750960-22750982 GAAATTGCGAAAAAGGAGAATGG + Intergenic
1052303843 9:26982985-26983007 TAAAATGGGAAGATGGAGATAGG - Intronic
1052607870 9:30728667-30728689 GAAAGTCAAAAGATGGAGATTGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053531405 9:38885566-38885588 GAGATTGCAAATATGTAAATTGG + Intergenic
1054203629 9:62109995-62110017 GAGATTGCAAATATGTAAATTGG + Intergenic
1054634733 9:67478369-67478391 GAGATTGCAAATATGTAAATTGG - Intergenic
1055103074 9:72485117-72485139 GAAGTTGCAAACATGTTGATGGG + Intergenic
1056067239 9:82949298-82949320 GAAATACCAAAGAATGAGATAGG + Intergenic
1056188492 9:84161157-84161179 AAAATTACAGAGATGGACATTGG + Intergenic
1056500695 9:87205806-87205828 AAGATTGCAATGATGAAGATAGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058256509 9:102772419-102772441 GTCATTGCAAGGGTGGAGATGGG - Intergenic
1058338063 9:103857926-103857948 AAAATGGCAAAGATGAAGAATGG - Intergenic
1058595627 9:106612368-106612390 GAGCCTGCAAAGATGGAGAATGG - Intergenic
1058805717 9:108589490-108589512 GAAAATGTAAAGATGGAGAAGGG + Intergenic
1058921496 9:109619607-109619629 GGAATTGCAAAGACTGAGAGTGG + Intergenic
1059631921 9:116134238-116134260 AAGATTAAAAAGATGGAGATGGG + Intergenic
1061930547 9:133830687-133830709 GAATTTTCAAAGCTGGAGCTGGG - Intronic
1185910340 X:3975058-3975080 GAAATTGGAAAGATGATGAATGG + Intergenic
1186538273 X:10372338-10372360 GAGATTACAGAGATGGAGAGGGG + Intergenic
1186751876 X:12629850-12629872 GAAATTGCAGGGTAGGAGATTGG + Intronic
1186953217 X:14651294-14651316 GTAATTCCAAAGCTGGGGATAGG + Intronic
1188270876 X:28139187-28139209 GAAATTGAAAACAGGGAAATGGG - Intergenic
1188457818 X:30387352-30387374 GAAATGGCAAATACGGAGTTGGG - Intergenic
1192213130 X:69140209-69140231 GAAATTGCTGAGCTGGAGAGAGG + Intergenic
1192218647 X:69181429-69181451 GAGATGGCAAAGTTGGAGATGGG + Intergenic
1192926239 X:75758237-75758259 CAAACAGCAAAGATGGAGGTTGG - Intergenic
1194384754 X:93238526-93238548 GAAATTGGAAAGATGATGAATGG + Intergenic
1194773908 X:97939275-97939297 GAAATTGCACAGATGGAGAGGGG - Intergenic
1195599885 X:106734201-106734223 GGAAGTGAAAAAATGGAGATGGG + Intronic
1195619497 X:106938856-106938878 GAAATTGCAAAGATGGAGATGGG + Intronic
1198089892 X:133318166-133318188 AGAATTGCAAAGAGGAAGATGGG - Intronic
1198400416 X:136263196-136263218 GAATTGGCAGAGATGGAGGTGGG - Intergenic
1198445127 X:136705713-136705735 GGAATAGCAAATATGGAAATTGG - Intronic
1199124424 X:144098688-144098710 GAAATTGAAAATATAAAGATAGG - Intergenic
1199392056 X:147291645-147291667 AACATTGCAAACATGGACATGGG + Intergenic
1199841957 X:151658247-151658269 GAAAATGCATGCATGGAGATAGG - Intronic
1200393710 X:155970055-155970077 GAAATTGGAAAGATGATGAATGG - Intergenic
1200943723 Y:8810588-8810610 GAAATTGGAAAGATGTTGAATGG + Intergenic
1200969182 Y:9131903-9131925 GGAATGGGAAAGAAGGAGATGGG + Intergenic
1201297104 Y:12473328-12473350 GAAATTGGAAAGATGATGAATGG - Intergenic
1201556588 Y:15269407-15269429 GAAATTGAAAAGATGATGAATGG + Intergenic
1201636094 Y:16125039-16125061 AAAATTGTAAAGAGGGAGAGAGG + Intergenic
1202037674 Y:20650846-20650868 GAAATTGGAAAGATGATGAGTGG + Intergenic
1202141647 Y:21730595-21730617 GGAATGGGAAAGAAGGAGATGGG - Intergenic
1202145218 Y:21773207-21773229 GGAATGGGAAAGAAGGAGATGGG + Intergenic