ID: 1195621143

View in Genome Browser
Species Human (GRCh38)
Location X:106956095-106956117
Sequence CTTCCCAAGAGGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 519
Summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 467}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195621134_1195621143 20 Left 1195621134 X:106956052-106956074 CCTGAAAGCAGGGATAGGGGAGG 0: 1
1: 0
2: 0
3: 25
4: 304
Right 1195621143 X:106956095-106956117 CTTCCCAAGAGGAAGGAGGAAGG 0: 1
1: 0
2: 2
3: 49
4: 467
1195621131_1195621143 24 Left 1195621131 X:106956048-106956070 CCAGCCTGAAAGCAGGGATAGGG 0: 1
1: 0
2: 0
3: 15
4: 198
Right 1195621143 X:106956095-106956117 CTTCCCAAGAGGAAGGAGGAAGG 0: 1
1: 0
2: 2
3: 49
4: 467
1195621129_1195621143 28 Left 1195621129 X:106956044-106956066 CCAGCCAGCCTGAAAGCAGGGAT 0: 1
1: 0
2: 2
3: 17
4: 221
Right 1195621143 X:106956095-106956117 CTTCCCAAGAGGAAGGAGGAAGG 0: 1
1: 0
2: 2
3: 49
4: 467

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195621143 Original CRISPR CTTCCCAAGAGGAAGGAGGA AGG Intronic
902556679 1:17250860-17250882 CTTCCTTAGAGGATAGAGGATGG + Intronic
902624986 1:17671328-17671350 CCTCCCAAGAGAAGGGAGGGAGG + Intronic
902908787 1:19579705-19579727 CTTCCCAAGATGCAGCAGCATGG - Intergenic
903826409 1:26148769-26148791 CTTCCCCCAAGGAAGAAGGAAGG - Intergenic
904087196 1:27917146-27917168 TTTTTAAAGAGGAAGGAGGAAGG - Intergenic
904614050 1:31740321-31740343 CTGCCTAGGAGGAAGGAGGGCGG - Intronic
905207486 1:36351155-36351177 CTACCAAAAAGAAAGGAGGAAGG + Intronic
906845668 1:49189048-49189070 CTGCCCAGAAGGAAAGAGGAGGG + Intronic
907464918 1:54628528-54628550 CTACCCAGGAGGTGGGAGGATGG + Intronic
907604995 1:55807262-55807284 CTTCTCAAGTGGAAGGAAGGGGG - Intergenic
908438525 1:64130653-64130675 CTCCAGAAGAGGAAGGAGGTAGG + Intronic
908798893 1:67858623-67858645 CTCACTAAGAGGAAGAAGGATGG - Intergenic
908838719 1:68256513-68256535 CTTCCCATGAGGGAGAAGGTAGG - Intergenic
909492343 1:76239305-76239327 CTTCCGTGGAGGAAGGGGGAAGG + Intronic
909933139 1:81520952-81520974 CTAGCCAACAGAAAGGAGGAAGG + Intronic
909940848 1:81610054-81610076 CTCCCCAAGAGGCAGGTGGGAGG - Intronic
910758034 1:90711815-90711837 CTGCCCCAGAGAAAAGAGGAGGG - Exonic
911155274 1:94630196-94630218 CTTCCACAGAGGACTGAGGATGG - Intergenic
911612992 1:99977537-99977559 CATCTCAGAAGGAAGGAGGAAGG + Intronic
911778670 1:101847123-101847145 CTTCCCACGAGGATGGGGGAAGG - Intronic
912593999 1:110855858-110855880 GTTGCCAAGAGGTAGGAGGGAGG + Intergenic
912838423 1:113017417-113017439 GTTCTCTATAGGAAGGAGGAAGG - Intergenic
912932037 1:113972843-113972865 CTTGCTAAGAGGCAGAAGGAGGG + Intronic
913168286 1:116209503-116209525 CTGCCCCAGAGAAAGGGGGAAGG - Intergenic
915082921 1:153364411-153364433 CTTCCTGGGAGGAATGAGGAAGG + Intergenic
915093596 1:153443767-153443789 CCTCTCCAGGGGAAGGAGGATGG + Intergenic
916315564 1:163444362-163444384 CTTCCCAGAAGGAATTAGGAAGG - Intergenic
916393807 1:164363353-164363375 CTTCCCCAAAGGAGGGAGTAAGG + Intergenic
916879316 1:169004108-169004130 CTCCTCAAGGGTAAGGAGGACGG - Intergenic
917159332 1:172040061-172040083 CTTGTCATGTGGAAGGAGGAGGG + Intronic
917929717 1:179814816-179814838 CGTCCCACGAGGAAGGGGGCAGG - Exonic
917936314 1:179870559-179870581 CTTTCCAAAATGGAGGAGGAGGG - Intronic
918126575 1:181589131-181589153 CATCTCTAGAGGTAGGAGGAAGG + Intronic
918209691 1:182339888-182339910 CTTCCAAAGAGGAAGATGTATGG - Intergenic
919294573 1:195679674-195679696 CCTTACAAGAGGAAGGAAGAAGG + Intergenic
920131927 1:203738754-203738776 TTTCTCAATAGGCAGGAGGAAGG + Intronic
920593533 1:207245794-207245816 ATTCCCAAGAAGATGGAGAAAGG + Intergenic
921395282 1:214662638-214662660 CTTTCAAAGAGAAAGGAGAAGGG - Intronic
922061744 1:222099223-222099245 CTTAGCTAGAAGAAGGAGGAGGG + Intergenic
922248279 1:223821795-223821817 CTTCTGAAGTGGAAGCAGGAGGG + Intronic
922930357 1:229384190-229384212 CTAGCCAGAAGGAAGGAGGAAGG - Intergenic
922998136 1:229983149-229983171 ATTCCCAAAGGGAAGGAGGTGGG + Intergenic
923054697 1:230417271-230417293 CTTCCTTTAAGGAAGGAGGAGGG - Intronic
924286286 1:242490900-242490922 TTTACAAAGAGGAAGCAGGAAGG - Intronic
924371825 1:243359132-243359154 GTCACCAAGAGGAAGGAGGAAGG - Intronic
924646028 1:245878009-245878031 GTTCCCAGGAGGAGGAAGGAAGG + Intronic
1062817510 10:511589-511611 CTTCCCTAGAGGAACGTGGTGGG + Intronic
1062932346 10:1361546-1361568 CTTCCCGAGAGGCAGAAGGCAGG + Intronic
1063324007 10:5079211-5079233 CTTCCCAGGAGGCAGGAGTGGGG + Intronic
1063386693 10:5620386-5620408 GATCCACAGAGGAAGGAGGAGGG + Intergenic
1064080175 10:12301985-12302007 CTGCCCAGTAGGAAGGAGGAAGG + Intergenic
1065570185 10:27063174-27063196 CTTCCCAACAGTGAGGTGGATGG + Intronic
1067018506 10:42775335-42775357 CTTTCCAAGAGGAAGAGGGAAGG + Intergenic
1067841211 10:49680765-49680787 CTTCCTGAGAGGATGGAGGTGGG + Intronic
1068258899 10:54552549-54552571 TTTCCCAAAACAAAGGAGGAGGG - Intronic
1068934344 10:62621608-62621630 CTTACCAAGAGGCAGGAGTAAGG - Intronic
1068939160 10:62664063-62664085 ATTCACACCAGGAAGGAGGAGGG + Intronic
1069058629 10:63870739-63870761 ATTCTCATGAAGAAGGAGGATGG - Intergenic
1069328663 10:67263602-67263624 CTTACCAAGATGAAGCAGGGAGG - Intronic
1069791420 10:71024676-71024698 CATCCCATGTGGAAGGTGGAAGG - Intergenic
1070383817 10:75905809-75905831 CTTCCCAAGAGCAAGTTTGAAGG - Intronic
1070646398 10:78205048-78205070 CTTTCCTAGGGGAAGGAGGAAGG - Intergenic
1072688680 10:97555045-97555067 CTGGCAAAGAGGAAGGAGGCAGG + Intronic
1073440122 10:103547570-103547592 AATCCCCAGAGGAAGGAGGGGGG + Intronic
1073733201 10:106315641-106315663 CTTCCCAGGGAGAGGGAGGACGG + Intergenic
1074253971 10:111782089-111782111 CTTCCATAAAGCAAGGAGGAAGG + Intergenic
1074485157 10:113869551-113869573 CCTACAAAGAGGAAGCAGGAAGG - Intronic
1074877151 10:117622345-117622367 CTTCCAATGAGGAAGCAGTAAGG - Intergenic
1076601451 10:131659320-131659342 CTTCCCAGAGGGATGGAGGATGG - Intergenic
1076676140 10:132148697-132148719 CTGCACAGGAGGAGGGAGGAGGG + Intronic
1076822800 10:132948764-132948786 CTTATCAAGGGGAAGGAGGTAGG - Intergenic
1076838416 10:133032729-133032751 ATTCCCATGAGGAGGGAGAAGGG - Intergenic
1076902700 10:133347724-133347746 CTGCCCAAAAGGAAGGGGGCTGG + Intronic
1077386684 11:2272540-2272562 CTTGACAAGGGGAAGGAGGGAGG - Intergenic
1078045252 11:7908158-7908180 CTTCTCAAACTGAAGGAGGAAGG + Intergenic
1078442208 11:11377457-11377479 CTTCCCCAGCAGAAAGAGGAAGG + Intronic
1078465754 11:11549122-11549144 CTAGCCAGCAGGAAGGAGGATGG - Intronic
1078507490 11:11963657-11963679 CTCCCCAAAAGGAAGGAGAATGG - Exonic
1079401943 11:20112833-20112855 CTTTCCAAGGGGAAGGAGCTGGG - Intronic
1080726381 11:34902756-34902778 CTTCCCTACAGGAAGGCTGAGGG - Intronic
1080941598 11:36924439-36924461 ATTAACAAGAGGAATGAGGAAGG + Intergenic
1083160195 11:60849831-60849853 ATTCCCAGGAGGAAGGGGAAAGG - Intronic
1083328615 11:61886362-61886384 CTTCCCACAAGGAAGGAGCAAGG + Intronic
1083827142 11:65210272-65210294 CTGCCCAACAGGATGGGGGAGGG - Intronic
1083852661 11:65377138-65377160 ATTCACAAGAGGAAGGAGGCAGG + Intronic
1084565984 11:69929350-69929372 GTGCCCAAGAGGAAAGAGGCCGG - Intergenic
1085167148 11:74413041-74413063 CTAGGCAAGAGGAAGGGGGAAGG + Intergenic
1085298204 11:75442769-75442791 CTTACCAAGAGGACGGAGGACGG + Intronic
1085789325 11:79483378-79483400 CTTACCACAAAGAAGGAGGAAGG + Intergenic
1086647632 11:89244600-89244622 CTTCCCAAGAGGAAAGTAAAAGG + Intronic
1086931544 11:92698873-92698895 CTTCCCAGAAGGAAGCAGGAAGG + Intronic
1086960296 11:92974108-92974130 CTCCCCAAGAGGAATCAGTAGGG - Intronic
1086984746 11:93235709-93235731 CTTCCCAAGAGGCAGATGTAAGG - Intergenic
1087571292 11:99930048-99930070 CTGCCCAACAGGAAGGACAAGGG - Intronic
1088156822 11:106815736-106815758 CCTCACAAGAGGAAGGCAGAGGG + Intronic
1088891633 11:114049291-114049313 TTTCCCAAAATGAAAGAGGATGG - Intergenic
1089223329 11:116894103-116894125 GTTCCCAGGAGGAGGGAGGAGGG - Intronic
1089295441 11:117464610-117464632 CGTGCCAGGAAGAAGGAGGAAGG + Intronic
1089304549 11:117518212-117518234 CTGGACAGGAGGAAGGAGGAGGG + Intronic
1089692504 11:120195618-120195640 CCTCCCAAGGGGCAGGAGCAGGG - Intergenic
1089938780 11:122394070-122394092 TTTCCCAAGAGGGAGTAGCAGGG + Intergenic
1090078143 11:123592266-123592288 CCTGCCAAGAGGAAGCAGAAGGG - Intronic
1090197969 11:124833117-124833139 CTTCCCCAGAGGTTGGAGGGTGG + Intergenic
1090602872 11:128390863-128390885 TTTGGCAAGAGAAAGGAGGAAGG - Intergenic
1090972496 11:131655409-131655431 TTGCCAAAAAGGAAGGAGGAAGG - Intronic
1093220784 12:16418009-16418031 CTTCCCTACAGCAAGGAGCATGG - Intronic
1093268984 12:17035605-17035627 TTTCCCTAGATGAAGGAGAAAGG + Intergenic
1094499373 12:31008644-31008666 CCTCCCAGGAGGATGGTGGAGGG - Intergenic
1095370928 12:41466425-41466447 TTTCCCCAGAGGAGGGAGGAGGG + Intronic
1096055782 12:48650763-48650785 TTTCTCAAGAGAAAGGATGAGGG + Intergenic
1096410603 12:51374517-51374539 CTAACCTAGAGGAAGGAGGGAGG + Intronic
1096464793 12:51842343-51842365 CCTCCAGAGAGCAAGGAGGAAGG + Intergenic
1096603440 12:52747035-52747057 CTTCCCAAGAGGTGGGAAGCAGG - Intergenic
1096917240 12:55046579-55046601 CTCTCCAAGTGGAAGGAGGGTGG - Intergenic
1099032665 12:77547022-77547044 CTTCCCTGGAGGATGGGGGAGGG + Intergenic
1100431618 12:94535997-94536019 CTCTCTAAGAGAAAGGAGGATGG + Intergenic
1100481436 12:94983385-94983407 CTTCCCCAGACCAAGGTGGAAGG - Intronic
1101645591 12:106628198-106628220 CTTCCCCAGAGGAGTGGGGAAGG - Intronic
1101772689 12:107766160-107766182 CTTCCCAAGAGAAAAAAGGCTGG - Intergenic
1102482825 12:113235764-113235786 CTTCCCAAGAAGGTGGAAGATGG + Intronic
1102894567 12:116588299-116588321 CTTCCCACCATGAAGAAGGAGGG + Intergenic
1103471961 12:121189419-121189441 CTTCCCAAGAGGAAGAGGAGGGG - Intergenic
1107420124 13:40238354-40238376 AGCCCCAAGTGGAAGGAGGATGG - Intergenic
1107963046 13:45575840-45575862 CTTCCCAGGAGTATGGAAGAGGG - Intronic
1108678463 13:52758806-52758828 CTACCCAAGAGGTAAGAGCAAGG + Intergenic
1108732872 13:53253265-53253287 TTAACCATGAGGAAGGAGGAAGG + Intergenic
1109877180 13:68420684-68420706 AACCCCAAAAGGAAGGAGGAAGG - Intergenic
1110700387 13:78540626-78540648 CTCTGCAAGAAGAAGGAGGATGG - Intergenic
1112816896 13:103283321-103283343 CTTCCTGAGAGGAAGGGGGCAGG - Intergenic
1114613049 14:24054566-24054588 CTGGCCCAGGGGAAGGAGGAAGG - Intronic
1114673324 14:24425441-24425463 CAGCCTAACAGGAAGGAGGAAGG - Intergenic
1115190019 14:30738074-30738096 CTTCTAAGGAGGGAGGAGGAAGG + Intergenic
1115933122 14:38520654-38520676 CTTCCCAAAAGCAAGGTGGCGGG - Intergenic
1117028588 14:51646930-51646952 CTTCCCAAGAGCAAGGGGCAGGG + Intronic
1117538584 14:56724976-56724998 CTCACCTAGATGAAGGAGGATGG - Intronic
1117968339 14:61228396-61228418 CTTGCTATGAGGAGGGAGGAGGG - Intronic
1118002108 14:61532997-61533019 CTTCCACATAGGAAGGAGCAGGG + Intronic
1119468282 14:74876681-74876703 CTTCTCAAGCTGAAGGAGGAGGG - Intergenic
1119825401 14:77653650-77653672 CTCCCCCAGTGGCAGGAGGAAGG + Intergenic
1122263416 14:100535697-100535719 CTTCTGCAGAGGAAGGGGGAGGG + Intergenic
1122448826 14:101787350-101787372 TTTGCCAGGTGGAAGGAGGAAGG + Intronic
1122926363 14:104904709-104904731 CTTCAAAGGAGGAGGGAGGAGGG - Intergenic
1123119027 14:105908520-105908542 CTCCCCCGAAGGAAGGAGGAGGG + Intergenic
1123124565 14:105937304-105937326 CTCCCCATGAGGAAGGAATAAGG + Intergenic
1124160916 15:27269058-27269080 CTGGCCAAGATGAAGGAAGAAGG - Intronic
1124365940 15:29071736-29071758 TTTCCAAAGAGGCAGGAGGGTGG - Intronic
1124983970 15:34587525-34587547 CTACTCAAGAGGCAGGAGAATGG - Intronic
1126866820 15:52945731-52945753 CATCCCAAGAGACAGGGGGATGG - Intergenic
1126940755 15:53762639-53762661 CTGCTCAAGAGGTAGGATGAAGG - Exonic
1127334363 15:57969032-57969054 CTTCCAAAGATGAAGGGGAAAGG - Intronic
1127477955 15:59352322-59352344 CTTCCCCAGAGGAAGTGTGATGG - Intronic
1127524336 15:59777297-59777319 CTGCCTAAGTGGAAGGAGAATGG - Intergenic
1128394572 15:67211069-67211091 CTTCCCAAGTGAAAGGAAGAAGG - Intronic
1128541378 15:68536863-68536885 CCAGCCAATAGGAAGGAGGAAGG - Intergenic
1128907828 15:71483945-71483967 CTTCCCTAGAGGAAGAATCAAGG - Intronic
1129104299 15:73295440-73295462 AAACCCAGGAGGAAGGAGGAAGG - Intronic
1129607029 15:77030022-77030044 CTTCCCAGGGGAAGGGAGGAGGG - Intronic
1129870556 15:78937493-78937515 TTTCCTAAGAGGAAAGATGAAGG + Intronic
1130823839 15:87523147-87523169 GTTCCCAAGAGACAGGAGGGAGG - Intergenic
1130988200 15:88858434-88858456 CAGCCCAAGAGGCAGGAGAAGGG + Exonic
1131866613 15:96717864-96717886 CTTGCCAGGAGGATGGAAGATGG + Intergenic
1132041947 15:98532557-98532579 CTTCCCAATAGCCAGGAGGTGGG - Intergenic
1132988966 16:2783363-2783385 CTCCCCAGGAGGAAAGGGGAGGG + Intergenic
1133337527 16:5015654-5015676 CCCCCTAAGAAGAAGGAGGAAGG + Exonic
1135236240 16:20759163-20759185 CCTCCCAAGAGGTAGGGGGATGG - Intronic
1135631611 16:24039861-24039883 CTTGCCAAGACCAAGGAGGAGGG - Intronic
1136922832 16:34346012-34346034 GTTCTCCAGAGGAAGGAGGAGGG - Intergenic
1136925875 16:34373394-34373416 TATCCCAATAGGAAGAAGGAAGG - Intergenic
1136978699 16:35038412-35038434 TATCCCAATAGGAAGAAGGAAGG + Intergenic
1136981741 16:35065794-35065816 GTTCTCCAGAGGAAGGAGGAGGG + Intergenic
1137010228 16:35314067-35314089 CTTCTGAAGAGCAAGGGGGATGG + Intergenic
1137571292 16:49567940-49567962 GTTCCCAAAAGGAGGGAGAATGG - Intronic
1138086081 16:54134986-54135008 GTACTCAAGAGGAAAGAGGAGGG - Intergenic
1139910360 16:70393874-70393896 TTTCCCAGGAGGCAGAAGGAAGG - Intronic
1141155196 16:81592504-81592526 CACCGCAGGAGGAAGGAGGAGGG - Intronic
1141926494 16:87173652-87173674 CGTCCCAAGAGGAAGGGGAAAGG - Intronic
1141987011 16:87586646-87586668 TCTGCCAGGAGGAAGGAGGATGG + Intergenic
1144017005 17:11205830-11205852 CTGCCCAAGGCGAAGGATGAGGG - Intergenic
1144070201 17:11664597-11664619 CTGTCCCTGAGGAAGGAGGATGG - Intronic
1144552155 17:16250191-16250213 CTTCGCAAGACAAAGGAGGCAGG - Intronic
1145286922 17:21512809-21512831 CTTCTGAAGAGGACGCAGGAGGG + Intergenic
1145390697 17:22453540-22453562 GTTCCGAAGAGGACGCAGGAGGG - Intergenic
1146370795 17:32264904-32264926 GTTTCCCAGAGGAAGGAAGAGGG + Intergenic
1146657582 17:34644098-34644120 CTGTCCAAGAGGATGGATGAAGG - Intergenic
1146785493 17:35717236-35717258 ATTGCCAAGAGGAATGTGGAAGG + Exonic
1147456654 17:40542226-40542248 GATGCCAAGAGGACGGAGGAGGG - Intergenic
1147884659 17:43676518-43676540 ATTCCCAAGAAGAAGGAAGGAGG - Intergenic
1148113673 17:45162165-45162187 CTTTCTGAGAGGAAGGAGGGAGG + Intronic
1148565033 17:48627541-48627563 CATCCAAAGAGGAAGGAGCCTGG + Intronic
1148996263 17:51712881-51712903 CTTCCATAAAGGCAGGAGGAGGG + Intronic
1149360329 17:55888582-55888604 GTTTCCAAGAGGATGGAAGAAGG - Intergenic
1150637285 17:66922584-66922606 CCTCCCAAGAGGTTGGGGGATGG + Intergenic
1151042734 17:70882640-70882662 TCTTCCAAGAGGGAGGAGGAGGG + Intergenic
1151396160 17:73824403-73824425 CCTCCCAAGAAGCAGTAGGACGG - Intergenic
1151441953 17:74135409-74135431 CTGCCCACGAGCAAGGAGGATGG + Intergenic
1151509318 17:74548630-74548652 GTCCCCTTGAGGAAGGAGGAAGG + Intergenic
1151540778 17:74763641-74763663 CCTCCCATGAAGGAGGAGGAGGG - Intronic
1152750537 17:82060565-82060587 CTGCCCAAGGGAAAGGAGGAGGG - Intronic
1155512776 18:26594184-26594206 CTTCCCTAGCAGGAGGAGGAAGG - Intronic
1156009244 18:32476800-32476822 CTGCCCAAGAGAAAAGATGAAGG - Intergenic
1156056529 18:33011695-33011717 CTTGCAAAGAGAAAGCAGGAAGG + Intronic
1156310027 18:35913301-35913323 CTTCCCAAGAGAGAGAAGGATGG - Intergenic
1156646557 18:39169382-39169404 ATTCCAAATAGGAAGGAAGAAGG - Intergenic
1157073978 18:44444512-44444534 CTTTCCTAGAGGAAAGAGGGAGG - Intergenic
1157476608 18:48028015-48028037 CATCCCCAGAGGGAGGAGGAAGG + Exonic
1157478178 18:48036509-48036531 CTTCCCAACATCAAGGAGGGAGG + Intronic
1157688874 18:49664699-49664721 CTTCCCCAGAGGAAGGGGGGTGG - Intergenic
1159736814 18:72109852-72109874 CTGCCCAAGATAAAGGAGAAGGG - Intergenic
1160026607 18:75223119-75223141 ATTCCCAAGAGGAAGAACGGAGG - Intronic
1161579915 19:5075132-5075154 CGGCCCAGGAGGCAGGAGGACGG - Intronic
1161652435 19:5493474-5493496 CTTCCCAGGACGAGGGAGGAGGG + Intergenic
1162204327 19:9044413-9044435 CTTCCGTAGAGGAAGGAAGAAGG - Intergenic
1162573531 19:11485871-11485893 CTCCCCAGGAGGAGGGAAGAGGG + Intronic
1163105142 19:15119082-15119104 CTTCACACGAAGGAGGAGGAAGG - Intronic
1163796778 19:19342442-19342464 GCTCCCTAGAGGAAGGAGCAGGG + Intronic
1163815119 19:19460476-19460498 CTTCCTATCAGGAAGGAAGAAGG - Intronic
1164439169 19:28258954-28258976 CATCCCAAGAGACAGCAGGATGG - Intergenic
1164732402 19:30516273-30516295 CTGCCCAGGAGGACGGAGGACGG - Intronic
1165181916 19:33978952-33978974 CATCCCCAGAGGCAGGGGGAGGG + Intergenic
1165814356 19:38632520-38632542 CTCCCCAAGGGGAAGGGGTAGGG + Intronic
1165952727 19:39483247-39483269 CCTCCCCAGTGGAAGGAGGAGGG - Intronic
1166753027 19:45173774-45173796 CTCCCCAGGAGGAAGGAGTGAGG + Intronic
1167215886 19:48164406-48164428 CATCCCAAGAGGAAAACGGAGGG - Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1168072090 19:53959040-53959062 CATCCAGAGAGGAGGGAGGAGGG - Intergenic
1168151442 19:54451015-54451037 CTTCCCAAAGGGAAGGAGAAGGG - Intronic
924971184 2:128294-128316 CTCCTCAGGAGCAAGGAGGAGGG + Intergenic
927642650 2:24855195-24855217 CTTCCTAAGAAGAAGGGGGTGGG - Intronic
928136789 2:28693795-28693817 CATCCAAGGGGGAAGGAGGATGG - Intergenic
929435997 2:41928886-41928908 ATGCCCAAGAGAAAGGAGGCTGG - Intergenic
929436663 2:41933859-41933881 CTTCCCTAAAGCAAGGAAGAGGG - Intergenic
929581886 2:43086559-43086581 CTCCCCAAGAGGAAGTGGGTGGG - Intergenic
929767918 2:44865454-44865476 GTTTCCAAGAGTTAGGAGGAGGG + Intergenic
931122922 2:59240545-59240567 CTTTTCTAGAGGCAGGAGGATGG - Intergenic
932257838 2:70302181-70302203 GTTCCCAAGCGGGAGGAGGGCGG - Intergenic
932544046 2:72688453-72688475 TTGCCCACCAGGAAGGAGGATGG - Intronic
932625925 2:73295866-73295888 CTGCCTGAGAGGGAGGAGGAGGG + Intergenic
933505782 2:83175653-83175675 GTTCTGAAAAGGAAGGAGGAGGG - Intergenic
933567813 2:83972443-83972465 CCTCCCAAGAGAAAGGAAGGGGG + Intergenic
933750406 2:85599448-85599470 CCTCCCAAGAGGATGGGGGGTGG - Intronic
934658829 2:96132411-96132433 CTTCCCCACAGGAAGCAGGCAGG + Intronic
934969554 2:98751878-98751900 CCACACAACAGGAAGGAGGAAGG - Intergenic
936004209 2:108867608-108867630 CTTCCAAAAAGGAATGAGGGTGG + Intronic
936497892 2:113038460-113038482 CTTCTAAAGAGGAAGCATGAAGG - Intronic
936974382 2:118204656-118204678 GTTCCCAGGAGGCAGCAGGAAGG - Intergenic
937032198 2:118750054-118750076 GTTCCCAAGAGGAGGGGGCACGG - Intergenic
937332305 2:121039091-121039113 CTTCCCAGGCTGTAGGAGGAAGG - Intergenic
939317866 2:140576313-140576335 CTTTCCCAAAGGAAGTAGGAAGG - Intronic
939680087 2:145119618-145119640 GTTCCCAAGAGCCAGGAGAAAGG + Intergenic
939914290 2:148020841-148020863 CTTTCCCTTAGGAAGGAGGAGGG + Intronic
940055670 2:149510353-149510375 CTACTCAGGAGGCAGGAGGATGG - Intergenic
940888449 2:159011923-159011945 GTCCCCAAGAAGAAGGAGGAGGG + Intronic
940939208 2:159538455-159538477 TTTGCCAAGAAGCAGGAGGAAGG - Intronic
942118588 2:172753982-172754004 CTTCCCAGGAGGAAAGTGGCAGG + Intronic
942128578 2:172853173-172853195 CTTCAGAAAATGAAGGAGGATGG - Intronic
942284208 2:174397585-174397607 CTTCCTCAAAGGAAGGAAGAAGG - Intronic
942707246 2:178789560-178789582 ATCCCCATGAGGAAGGGGGAAGG - Intronic
942791977 2:179771009-179771031 CTTCCCAAAAAGAAAGGGGAGGG + Intronic
944240186 2:197478769-197478791 GTCCCAAAGAGGAAAGAGGAAGG - Intergenic
944530036 2:200658720-200658742 CTTCCTATGAGAAAGGACGATGG - Intronic
946027328 2:216679690-216679712 CTTCATAAGCGGCAGGAGGAGGG + Intronic
946060225 2:216934902-216934924 CTTCCAAATAGTAAGGGGGATGG - Intergenic
947142149 2:227029294-227029316 GTCACCAAGAGGAAGGAGGAAGG - Intronic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
948168326 2:235879999-235880021 CTACTCAGGAGGAAGGAGGGAGG + Intronic
948377279 2:237529846-237529868 TCTCCCAGGAGGAGGGAGGAGGG - Intronic
948758049 2:240170437-240170459 CTTCCCAGGAGGATGGAGTCTGG - Intergenic
1170500203 20:16967977-16967999 CCACCCGAGGGGAAGGAGGAAGG - Intergenic
1170552255 20:17488181-17488203 TTTCCCAACATGAAGGTGGAAGG + Intergenic
1171400924 20:24872661-24872683 CATCCCCAGGGGAAGGGGGAGGG + Intergenic
1171492538 20:25531654-25531676 CTCACGAAGAGGAAGGAGCAGGG - Intronic
1172604681 20:36206648-36206670 CTTCCCCAAAGGAAGGGGCAGGG + Intronic
1173157957 20:40631018-40631040 ATTCCCAAGAGAAAGGGTGAAGG + Intergenic
1173205780 20:40991931-40991953 ACTCCCTAGAGGAAGGAGGAAGG + Intergenic
1173653612 20:44683634-44683656 CCTCTCAAGAGGCAGGAGGAAGG - Intergenic
1173853029 20:46230940-46230962 CTGCCTTAGAGGGAGGAGGAGGG + Intronic
1173898930 20:46572535-46572557 CTGGCCTAGAGGAAGGAGGCTGG - Intronic
1174174795 20:48637745-48637767 CTTCCCATCTGGAAGGAGAAGGG + Exonic
1176045028 20:63088093-63088115 CTGCCCAACAGGAGGGAGCACGG + Intergenic
1176410390 21:6446656-6446678 CTTGCCAGGAGAAAGCAGGAGGG - Intergenic
1176658595 21:9612926-9612948 TATCCCTAGAGGAAGGGGGAGGG - Intergenic
1177294240 21:19154398-19154420 CTTCCCAACAGCCAGCAGGAAGG + Intergenic
1177732286 21:25043147-25043169 CTTCCAAAGAGGATGTAGCATGG + Intergenic
1179685883 21:43054978-43055000 CTTGCCAGGAGAAAGCAGGAGGG - Intronic
1180873500 22:19162052-19162074 CTTCCCATGAGGAAGGAGCCAGG - Intergenic
1181293769 22:21818657-21818679 TTTCCCAAGACAAAGAAGGAAGG + Intronic
1181881964 22:25988386-25988408 CTTCCCTAGCAGATGGAGGATGG + Intronic
1181971184 22:26691297-26691319 CTTAACAAGAGGCTGGAGGAAGG + Intergenic
1181994311 22:26863055-26863077 CCTCCAAAGAGAGAGGAGGAGGG + Intergenic
1182246803 22:28964616-28964638 CCTCCCAAGAGATAGGAGGTGGG - Intronic
1182868830 22:33628092-33628114 GCTCCCAAGAAGAAAGAGGAGGG + Intronic
1182952014 22:34385388-34385410 CTTTCCTAGAGGAAGGAAAAAGG - Intergenic
1183705028 22:39470836-39470858 CTGCCCAAGATCACGGAGGAGGG + Intronic
1184323357 22:43761134-43761156 CTTGCAGAGTGGAAGGAGGAAGG - Intronic
1184370745 22:44080501-44080523 CCTTACAAGAGGAAGCAGGAGGG - Intronic
1184465438 22:44666724-44666746 CTTGCCAGGAGGGAGGAGGGAGG + Intergenic
1185004556 22:48268061-48268083 CCGGCCATGAGGAAGGAGGAGGG + Intergenic
1185376383 22:50484394-50484416 CTTCCCTAGGGGAAGGAGCTGGG + Exonic
1185379735 22:50502909-50502931 TTTCCCAGGAGGCATGAGGATGG - Intergenic
949533317 3:4978211-4978233 CTTCCCAACAGGCAGGGAGAGGG + Intergenic
949573155 3:5312598-5312620 CTTTCCATGCAGAAGGAGGAAGG - Intergenic
950680801 3:14583852-14583874 CCTCCCAAGATGGAGGAGGAGGG - Intergenic
952014768 3:28943219-28943241 CTTCCGAAGTTGAAGGAGGAAGG - Intergenic
953117545 3:40008090-40008112 CTTCCCCAGAGGAACTGGGAGGG - Intronic
953751436 3:45611529-45611551 TGTCCCAAGAGGTGGGAGGAAGG + Intronic
953827646 3:46267936-46267958 CATCCCAAGGGGAGAGAGGAGGG + Intergenic
954035770 3:47850250-47850272 TCCCCAAAGAGGAAGGAGGAAGG + Intergenic
954196534 3:49000432-49000454 ATTGCCAAGAGGAAGGAAAATGG - Intronic
954429397 3:50461939-50461961 CTTCCCTGGAGCAAGGTGGAAGG + Intronic
954438796 3:50510345-50510367 GTTACCAACAGGAAGGTGGATGG - Intergenic
954569722 3:51630469-51630491 CATCCCAAATTGAAGGAGGAAGG - Intronic
954628066 3:52033519-52033541 CTTCCCATGAGGACGAAGTAAGG + Intergenic
956063585 3:65373673-65373695 GTTCCTAATAGGAAGGATGAAGG - Intronic
957193357 3:77039103-77039125 CATCCCCAAGGGAAGGAGGAAGG - Intronic
957253881 3:77811912-77811934 CCTCCCAAAAGGAAGATGGATGG + Intergenic
958643216 3:96835772-96835794 CTTCACAAGAGTAAGAAGAAAGG - Intronic
960055857 3:113275939-113275961 CCTCCCCAGAGGCAGGGGGACGG + Intronic
961220208 3:125193707-125193729 CTTCCCCTGAGGCAGAAGGAAGG + Intronic
961448210 3:126990988-126991010 CTGCTCAGGAGGAAGGAGCAGGG - Intronic
961590679 3:127978559-127978581 GTTCCAAGGAGGAAGGAAGAGGG + Intronic
961921968 3:130436154-130436176 CTTCACAAGAGGAAAGATCATGG - Intronic
962261861 3:133915462-133915484 CCTCCCAAGAGGGAAGTGGAGGG - Intergenic
963604999 3:147406089-147406111 CTTCCCAGGAGGAGGGAAAAGGG - Intronic
964431742 3:156614355-156614377 CTTCATAATAGGAAGGAGGCTGG + Intergenic
964499454 3:157332400-157332422 GTTGCCAAGAGCTAGGAGGAGGG - Intronic
965919124 3:173891289-173891311 GTTCCCAAGTGGAAGGATTATGG + Intronic
965919398 3:173894301-173894323 CTTACCAAGAGGTAAAAGGAAGG + Intronic
965919606 3:173896075-173896097 CTTACCAAGAGGTAAAAGGAAGG - Intronic
966801482 3:183768267-183768289 CTTGCCAAGAGGAAGGGAGCAGG + Intronic
966828063 3:183982131-183982153 CTTCCAAAGGGGAGGCAGGAGGG + Intronic
967183902 3:186929776-186929798 CTGCCCAACAGGAGGGCGGAAGG - Intergenic
967587823 3:191235991-191236013 TTTCCCCATATGAAGGAGGAAGG + Intronic
968650103 4:1757069-1757091 GGCACCAAGAGGAAGGAGGATGG - Intergenic
968707196 4:2085140-2085162 CTTCCAAATAGGTAGGTGGAAGG + Intronic
969657082 4:8504648-8504670 CTTCCCCACAGGGAGGATGAAGG - Intergenic
970151825 4:13098070-13098092 CTTCCTAAGAGAAAGGTGCAGGG + Intergenic
970512231 4:16792801-16792823 TTTAACAAGAGGAAGGAGGAAGG + Intronic
971056175 4:22915253-22915275 CTTCCAAAGAGGCAGTGGGATGG + Intergenic
971201004 4:24509136-24509158 CTTTACAAGAGGGAGCAGGAGGG - Intergenic
971250793 4:24971664-24971686 CTTGCCAAGAGGAAGGGAGTTGG - Intronic
971324211 4:25630940-25630962 CTACTCAAGAGGTGGGAGGATGG - Intergenic
972876329 4:43365584-43365606 GTCCCCAAGAGGAAGAAGGGAGG - Intergenic
973863896 4:55092716-55092738 TGTCCAAAGAGGCAGGAGGATGG + Intronic
973972536 4:56227901-56227923 CTTCCTAAGAGGCAGGGAGAGGG - Intronic
974317329 4:60298896-60298918 CTTCCCTATAGGAAGGAGTTGGG + Intergenic
976151715 4:82099154-82099176 CTCTCCAAGAAGAAGGTGGAGGG - Intergenic
976397206 4:84569025-84569047 CTTCTCAAGAGGATGGATGTTGG + Intergenic
978660027 4:111114736-111114758 CTTCAAAAAAGGAAGAAGGAAGG - Intergenic
979341427 4:119528949-119528971 CTTCCTCACAGGTAGGAGGAGGG + Intronic
979398519 4:120219020-120219042 CATCCAAATAGGAAGGAAGAAGG - Intergenic
979603283 4:122609290-122609312 CTACTCAAGAAGAATGAGGAGGG + Intergenic
980537974 4:134153969-134153991 ATTCCAAAGAGGAAAAAGGAAGG + Intergenic
981008619 4:139901622-139901644 CTCCCCATAAGGGAGGAGGATGG + Intronic
982288649 4:153759430-153759452 CTTCCGCCGAGGAGGGAGGAGGG + Intronic
982657156 4:158164041-158164063 CTTCCCAAGCTCAAGGAGGTGGG - Intronic
985362578 4:189191537-189191559 GTTCACATGAGGAATGAGGATGG + Intergenic
985416812 4:189743141-189743163 TATCCCTAGAGGAAGGGGGAGGG + Intergenic
985509258 5:302966-302988 CTTCCCAAGGGGAAGTTGGGAGG + Intronic
985739013 5:1603926-1603948 CTTCCCAAGGGGAAGTTGGGAGG - Intergenic
986752464 5:10801070-10801092 CTGACCAAGAGAAAGGAAGAAGG + Intergenic
987626949 5:20414458-20414480 CTTCCCAAAATTGAGGAGGAAGG + Intronic
987736279 5:21847525-21847547 CTGCCTTAGAGGAAGGAAGAAGG - Intronic
987818493 5:22933067-22933089 ATTCCAAAGAGTAAGTAGGAAGG - Intergenic
988713076 5:33797980-33798002 CCTACCAAGAGGCAGTAGGATGG - Intronic
989590716 5:43110850-43110872 CTCCCGTAGAGGAAGGAGGTGGG + Intronic
991139069 5:63217764-63217786 CTTCAGAGTAGGAAGGAGGAGGG - Intergenic
992748303 5:79839875-79839897 CTTCCTAAAAGCAAGGAGGCTGG + Intergenic
994414465 5:99450510-99450532 CTTCCCCAAATGATGGAGGAGGG - Intergenic
996765609 5:127031468-127031490 CTTGCGAAGGGGAAGGAGGGCGG - Intergenic
997026083 5:130063501-130063523 GTTCTCAAGAGGAATGAAGATGG - Intronic
998442960 5:142177471-142177493 CTTCCAAGGAGTAAGGAGCAAGG + Intergenic
998474399 5:142408357-142408379 TGTCCAAAGAGGAAGGAGCATGG + Intergenic
998864036 5:146476864-146476886 CTACCCAGGAGGCAGGAGGCTGG - Intronic
999254754 5:150204131-150204153 CTTGCAAAGAGGAAGATGGAGGG - Intronic
999777624 5:154823593-154823615 CTGCCCAAGGGAAGGGAGGAGGG + Intronic
1000920595 5:167132487-167132509 CTTCTCAGGGGGAAGGAAGAGGG - Intergenic
1001191535 5:169637169-169637191 CTGCCCAACGGGAGGGAGGAGGG + Intergenic
1001226300 5:169947324-169947346 TTTTCCAAGGGGAATGAGGAGGG + Intronic
1001426750 5:171627958-171627980 GTTCCAAAGAGGAAGGAAGGAGG - Intergenic
1001452652 5:171838204-171838226 CCTCCCAAAAGGAAGGAGCGGGG - Intergenic
1001586553 5:172836729-172836751 CATTCCAAGAGAAGGGAGGAGGG + Intronic
1001617418 5:173054315-173054337 CTTTCCAAGACGACGGAAGAGGG + Intergenic
1002083279 5:176750132-176750154 CTTCAGAAGGGGAAGGAGAAAGG + Intergenic
1002439348 5:179256275-179256297 GTGCCCAACAGGAAAGAGGACGG + Intronic
1002533834 5:179865249-179865271 CTTCCCAAGATGAACCAGGTAGG - Exonic
1002900170 6:1404450-1404472 CATCCCAAGAGGAATGGGGCAGG + Intergenic
1005309300 6:24543932-24543954 CTTCCCACAGGGAAGGAGCAGGG + Intergenic
1006020652 6:31115830-31115852 TTTGAGAAGAGGAAGGAGGAAGG + Exonic
1006929713 6:37680388-37680410 CCTCCCAAGAGGAAGTGAGAAGG + Intronic
1007016932 6:38478139-38478161 CTTCCTACCAGGAAGGGGGAGGG + Intronic
1007122812 6:39397429-39397451 TTTTCAAAGAGGAAAGAGGAAGG + Intronic
1007288791 6:40768567-40768589 CTTCCCAAGATAAAGAAGCAGGG - Intergenic
1007472340 6:42099074-42099096 ATTCTCAAGGGGAAGGAGGGAGG + Intergenic
1007604017 6:43103527-43103549 ACTCCCAAGTGAAAGGAGGAAGG + Intronic
1007614763 6:43173307-43173329 CTTCCCAAGACAAAGGAGTAAGG + Intronic
1007689130 6:43687451-43687473 CTTCACAAGGCGGAGGAGGACGG - Intronic
1007828700 6:44621517-44621539 CTTCCCAGGTGGAAGGGGCAGGG + Intergenic
1007966363 6:46007018-46007040 GTTCCCCAGAGGAGGGAGCATGG - Intronic
1009698568 6:67143223-67143245 ATTCCTGAGAGGAAGAAGGAGGG - Intergenic
1010042105 6:71396953-71396975 CCTCCCAAAAGCAAGGAGGAAGG + Intergenic
1011735613 6:90308115-90308137 CTTTTTAAGAGGGAGGAGGAGGG - Intergenic
1012264250 6:97121815-97121837 ATTCCCAAGAGGAGAGAAGATGG + Intronic
1012720605 6:102737621-102737643 CTTCCCGGGATGAAGGAGTAAGG + Intergenic
1013356705 6:109351546-109351568 CTGGCCAATAGGAAGGAGGAAGG + Intergenic
1014439520 6:121458258-121458280 CTACTCAAGAGGCAGGAGGATGG - Intergenic
1014939645 6:127422820-127422842 ATTCCAAAGAGGAAAGGGGAAGG - Intergenic
1015047837 6:128798523-128798545 ATTCCCAACAAGATGGAGGAAGG + Intergenic
1015976726 6:138798260-138798282 CTTCCCCAGAGGTCAGAGGATGG + Intronic
1016014340 6:139168240-139168262 TATCCTGAGAGGAAGGAGGAGGG - Intronic
1016998327 6:149976783-149976805 CTTCCCATGAGCATAGAGGACGG + Intergenic
1017001778 6:150002333-150002355 CTTCCCATGAGCACAGAGGATGG - Intergenic
1017007436 6:150038084-150038106 CATCCCCAGGGCAAGGAGGATGG - Intergenic
1017007849 6:150040861-150040883 CTTAACAGGAGGAAGGAGTAGGG + Intergenic
1017019360 6:150127827-150127849 CTTGCAAAAAGGAAGGTGGAGGG - Intergenic
1017349677 6:153425718-153425740 ATGCCCAGGAGGAAGGAGGTAGG - Intergenic
1017490181 6:154938116-154938138 CTCCCAAAGAGGGAGGAAGATGG - Intronic
1017550884 6:155506063-155506085 CGTGCCAAGATGAAGGTGGAGGG + Intergenic
1017958944 6:159205008-159205030 CTTCCCTAGAGCCAGCAGGAGGG - Intronic
1018039555 6:159909918-159909940 CTTACCAAGAGGTAGGAGGTAGG + Exonic
1018067504 6:160134133-160134155 CTTCCCCGTAGGCAGGAGGAAGG - Intronic
1018298701 6:162377086-162377108 CATCCTAAGAGGATGGTGGAGGG + Intronic
1018433660 6:163742846-163742868 CTTCCTAAGGGGTTGGAGGATGG + Intergenic
1019168369 6:170114623-170114645 CATCGCAAGAAGAGGGAGGAAGG - Intergenic
1019257011 7:59076-59098 GTTCCCAAGAGGAGGGGGCATGG + Intergenic
1020076760 7:5263494-5263516 CTTCCCAAGAGCCCGGAGGATGG - Intergenic
1020111600 7:5451010-5451032 TTTCCCATGAGGAAAGAAGATGG - Intronic
1020567208 7:9812541-9812563 CTCCCCACAAGGAAAGAGGAGGG + Intergenic
1020767084 7:12336159-12336181 CTTCCCAGGAGGAAGGACAATGG + Exonic
1021817104 7:24457921-24457943 CTTCCATAAGGGAAGGAGGAAGG + Intergenic
1021905813 7:25332015-25332037 CTTCTCAAGAGGAAAGGGAAGGG - Intergenic
1022216930 7:28272551-28272573 CTCCCCCAGAGGAAGGAGGAAGG - Intergenic
1023090051 7:36609042-36609064 CTCCCCCAGAGGAAGGATGCTGG + Intronic
1024355442 7:48409776-48409798 CATCCAAAGAAGAATGAGGAGGG + Intronic
1024482063 7:49874067-49874089 CTTTCCCTGAGGAAGGAGTAAGG + Intronic
1025202336 7:56970100-56970122 CTTCCCAAAAGCCCGGAGGATGG + Intergenic
1025669612 7:63606827-63606849 CTTCCCAAAAGCCCGGAGGATGG - Intergenic
1026045901 7:66905100-66905122 GTTGCCAAGAGGCAGGAGAATGG - Intergenic
1028494045 7:91444441-91444463 CTTCCCCAGTGGAAGGATGGGGG - Intergenic
1029168362 7:98613226-98613248 CCTCCCAAGAGGAAAGACAAGGG - Intergenic
1029389708 7:100266831-100266853 CTGCCCTAGAGGCAGGAGGCAGG + Intronic
1029492799 7:100881594-100881616 CCTCCCCAGAGCATGGAGGATGG - Intronic
1031037966 7:116808654-116808676 CTGCCCTTCAGGAAGGAGGAGGG + Intergenic
1031682605 7:124692803-124692825 CTTACCAAGAGGAATTTGGATGG + Intergenic
1031920778 7:127599311-127599333 TTTCCCAAGTGGAAGCAGGAGGG - Intronic
1032141280 7:129332806-129332828 CTTCCCTAGAGGAAGGGAAAGGG + Intronic
1032271177 7:130408087-130408109 CTTCCCTTGGGGAAGGAGGCAGG - Intronic
1032401078 7:131624817-131624839 CTTTCCACGAGGAATGAGGATGG - Intergenic
1032690124 7:134277270-134277292 CTTCCCAACAGCATGCAGGAAGG - Intergenic
1032832792 7:135645300-135645322 CTCCTCAAGAGGAAGCAGCAAGG - Intronic
1033059424 7:138091352-138091374 CTTTCCCTGATGAAGGAGGAGGG + Intronic
1033090692 7:138383065-138383087 TTTGGCAAAAGGAAGGAGGAAGG - Intergenic
1033614351 7:142998070-142998092 CTCCCTCAGAGAAAGGAGGAAGG + Intergenic
1034063746 7:148117318-148117340 GTCCCCAGGAGGAAGTAGGAAGG + Intronic
1034280450 7:149850366-149850388 CTTCCCAAGTCAAAGGAGGGTGG - Intronic
1034448132 7:151123692-151123714 CTGCCCAGGAGGAGGGAGGCAGG + Intronic
1034825166 7:154255593-154255615 CTTCCCACAGGGCAGGAGGAGGG - Intronic
1034951807 7:155303167-155303189 CTTCCGATGGTGAAGGAGGAGGG - Intronic
1035811469 8:2495190-2495212 CTGCCCAAAGGGAAGGACGAGGG - Intergenic
1037670802 8:21013607-21013629 CTTATCCAGAGGAAGGAGGGGGG - Intergenic
1037754180 8:21700725-21700747 CTTCCCCCAAGGAAGAAGGAAGG + Intronic
1038596376 8:28890246-28890268 CCTCCCAAAGGGAAGGCGGATGG + Intergenic
1039010483 8:33087972-33087994 CTTCCCAACGGAAAAGAGGAGGG - Intergenic
1039563461 8:38531515-38531537 CTTGGGAAGAGGAAGGAGGAAGG + Intergenic
1039712263 8:40067625-40067647 CATCCCAAGAGGAGTAAGGAGGG + Intergenic
1041081501 8:54219111-54219133 CTTCCCTGGAGCAAGGAGCAAGG - Intergenic
1042677464 8:71337785-71337807 CTCCACAGGAGAAAGGAGGAAGG - Intronic
1043661376 8:82746450-82746472 CTTCCCAGAGAGAAGGAGGAGGG + Intergenic
1044963537 8:97554262-97554284 CTTCCCACCTGGAGGGAGGATGG + Intergenic
1045842741 8:106598501-106598523 CTTCCACAGAGGAAGCAGGGAGG - Intronic
1046448782 8:114359649-114359671 CATCCCTAGAAGAAGGGGGAGGG + Intergenic
1047980351 8:130174597-130174619 CCTCCCCAGAGGTGGGAGGAGGG - Intronic
1048598716 8:135895549-135895571 CATTCCAAGTAGAAGGAGGAAGG - Intergenic
1049260520 8:141636538-141636560 CCTCCCTAAAGGAGGGAGGAAGG - Intergenic
1049474944 8:142792816-142792838 CTTGCCCAGAGGAGGCAGGATGG - Intergenic
1050685913 9:8169163-8169185 CTTCCCTAAATAAAGGAGGAGGG - Intergenic
1052350511 9:27453977-27453999 CTTCTTAACAGGAAGGAGGTAGG - Intronic
1052938652 9:34114493-34114515 CTTCCCATGAAGAAGCAGGGTGG - Intronic
1054932596 9:70651670-70651692 CTATGCAGGAGGAAGGAGGAAGG - Intronic
1055398018 9:75893378-75893400 CATGCCATGATGAAGGAGGAAGG + Intronic
1055789638 9:79910130-79910152 CTGCCCAAGGGAGAGGAGGAGGG + Intergenic
1056180575 9:84078584-84078606 ATGCCCAAGAGGAAGGCTGAAGG + Intergenic
1056197010 9:84238737-84238759 CCACCCAAGGGGAAGGACGAGGG - Intergenic
1056947704 9:91013861-91013883 CTTCCCCAGAGGAAGAAGATGGG + Intergenic
1058129193 9:101230491-101230513 GCTCCCAAGGGGAAGGAGAAAGG - Intronic
1058930388 9:109713200-109713222 GCTCCCAAGAAGAAGGAAGAAGG - Intronic
1058945546 9:109852257-109852279 CATTCCAAAAGGAGGGAGGAAGG - Intronic
1059387014 9:113972538-113972560 CTTCCCACCAAGAAGCAGGAGGG - Intronic
1060438214 9:123614611-123614633 CTTCCCAAGACAAAGTGGGAGGG + Intronic
1060944520 9:127562037-127562059 CTGCCCGCGGGGAAGGAGGAGGG + Intronic
1061090081 9:128421313-128421335 GGCCCCAAGAGGAAGGAGTAGGG - Intronic
1061306618 9:129736245-129736267 CTTCCCAAGCTCAAGGTGGAGGG + Intergenic
1061559102 9:131391391-131391413 CCTCACAAGAGGAAGGAAGGAGG - Intergenic
1061587699 9:131579306-131579328 CTCCCACAGAGGAAGGAGGCAGG + Exonic
1061747809 9:132753138-132753160 ATTCCCAGGAGGAAGGAGCCAGG + Intronic
1062158133 9:135065468-135065490 TTCCCCAAGGGGAAGCAGGATGG - Intergenic
1062167505 9:135115295-135115317 CTTCGGAAGAGGGAGGAGGCCGG + Intronic
1062187247 9:135224502-135224524 CTTCCCAAGGGGGAGGACGGTGG + Intergenic
1062459608 9:136657419-136657441 CTTCCCAGGAGGGAGGAAGGAGG - Intergenic
1062460502 9:136660790-136660812 CTCCCCAAGAAGAGGAAGGAAGG + Intronic
1062578150 9:137218015-137218037 CTTCCAACCTGGAAGGAGGAGGG + Intergenic
1203636323 Un_KI270750v1:116505-116527 TATCCCTAGAGGAAGGGGGAGGG - Intergenic
1186021771 X:5264382-5264404 CTTCCCAAATGTAAGGAGGGGGG + Intergenic
1187581306 X:20610267-20610289 CTTCCCAAGCAGCAGAAGGAAGG + Intergenic
1189668884 X:43386727-43386749 CTTCCTGATAGGAGGGAGGAGGG + Intergenic
1189941066 X:46121739-46121761 CTTACCAAGAGGTGGGGGGAAGG - Intergenic
1190843073 X:54164418-54164440 GTTACCAAGAGCTAGGAGGAGGG - Intronic
1193558974 X:82994051-82994073 ATTCCCAAAAATAAGGAGGAGGG - Intergenic
1194383316 X:93222384-93222406 ATTGCCAAGAGGAATGTGGAAGG - Intergenic
1195621143 X:106956095-106956117 CTTCCCAAGAGGAAGGAGGAAGG + Intronic
1195676204 X:107508995-107509017 CTCCCCAGGAGGTAGGAAGATGG - Intergenic
1196895261 X:120329864-120329886 ATTACCAAGAGGAAGCAGCAGGG - Intergenic
1197423960 X:126272710-126272732 AGTTCCCAGAGGAAGGAGGAGGG - Intergenic
1197876588 X:131115085-131115107 CTTCTCAAGTGGAAGGAAGAGGG + Intergenic
1198766971 X:140090637-140090659 AATCCCAAGATGAAGGAGCAAGG - Intergenic
1199049868 X:143224474-143224496 ATTTCAAAGAGAAAGGAGGAGGG + Intergenic
1199616166 X:149657895-149657917 CTTCCCTGGAGAAAGTAGGAAGG + Intergenic
1199626474 X:149745353-149745375 CTTCCCTGGAGAAAGTAGGAAGG - Intergenic
1200491883 Y:3835860-3835882 ATTTCCAAGACCAAGGAGGATGG - Intergenic
1200887219 Y:8281671-8281693 CTGGCCAAGAAGGAGGAGGATGG - Intergenic